- Email: [email protected]
Identification of nucleoporin 93 (Nup93) that mediates antiviral innate immune responses
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Identification of nucleoporin 93 (Nup93) that mediates antiviral innate immune responses Warunthorn Monwan, Takumi Kawasaki**, Md Zobaer Hasan, Daisuke Ori, Taro Kawai* Laboratory of Molecular Immunobiology, Division of Biological Science, Graduate School of Science and Technology, Nara Institute of Science and Technology (NAIST), Nara, 630-0192, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 27 September 2019 Accepted 5 November 2019 Available online xxx
RIG-I-like receptors (RLRs) are cytoplasmic sensors for viral RNA that elicit antiviral innate immune responses. RLR signaling culminates in the activation of the protein kinase TBK1, which mediates phosphorylation and nuclear translocation of IRF3 that regulates expression of type I interferon genes. Here, we found that Nucleoporin 93 (Nup93), components of nuclear pore complex (NPC), plays an important role in RLR-mediated antiviral responses. Nup93-deficient RAW264.7 macrophage cells exhibited decreased expression of Ifnb1 and Cxcl10 genes after treatment with a synthetic RLR agonist stimulation as well as Newcastle Disease Virus infection. Silencing Nup93 in murine primary macrophages and embryonic fibroblasts also resulted in reduced expression of these genes. IRF3 nuclear translocation during RLR signaling was impaired in Nup93-deficient RAW264.7 cells. Notably, the activation of TBK1 during RLR signaling was also decreased in Nup93-deficient cells. We found that Nup93 formed a complex with TBK1, and Nup93 overexpression enhanced TBK1-mediated IFNb promoter activation. Taken together, our findings suggest that Nup93 regulates antiviral innate immunity by enhancing TBK1 activity and IRF3 nuclear translocation. © 2019 Elsevier Inc. All rights reserved.
Keywords: Innate immunity Virus infection Nup Type I IFN
1. Introduction Innate immunity is crucially important in initial responses to protect the host from infection. Innate immune cells such as macrophages and dendritic cells (DCs) recognize pathogen-associated molecular patterns (PAMPs) derived from pathogens through germline-encoded pattern-recognition receptors (PRRs). Recognition of PAMPs by PRRs in these cells triggers innate immune responses to produce pro-inflammatory cytokines and type I interferons (IFNs) [1,2],. RIG-I-like receptor (RLR) family, consisting of RIG-I and MDA5, recognizes RNA derived from RNA viruses in the cytoplasm. RLRs possess N-terminal two caspase recruitment domains (CARDs), a central DEAD box helicase/ATPase domain and a C-terminal regulatory domain. RIG-I recognizes short double-stranded (ds) RNA with 50 -triphosphate or -diphosphate group and short synthetic dsRNA analogue, polyinosinic:polycytidylic acid (poly(I:C))
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (T. Kawasaki), [email protected] (T. Kawai).
whereas MDA5 recognizes long dsRNA and long poly(I:C) [3,4]. RIGI and MDA5 initiate signaling by interacting with an adapter molecule localized to mitochondria namely IPS-1 (also known MAVS) [5e7]. IPS-1 further activates signaling cascades leading to the activation of protein kinases TBK1 and IKKa/b. The activated TBK1 phosphorylates the transcription factor IRF3. Phosphorylated IRF3 forms a homodimer and translocates to the nucleus from cytoplasm. IKKa/b phosphorylate IkB proteins and triggers their degradation, allowing the transcription factor NF-kB to translocate to the nucleus. IRF3 and NF-kB cooperatively regulate the expression of pro-inflammatory cytokines genes and type I IFN genes [8,9]. Nuclear pore complex (NPC) is the bidirectional transport of materials between nucleus and cytoplasm [10,11]. NPC consists of approximately 30 different types of nucleoporins (Nups), which mediate trafficking of various macromolecules. Nups are evolutionally conserved in distant eukaryotes ranging from yeast to human. Numerous studies have been suggesting that Nups are involved in the regulation of innate immune signaling pathways in insects and mammals. In Drosophila, Nup98 promotes antiviral gene expression to restrict RNA virus infection [12], and Nup214Nup88 complex mediates NF-kB translocation and induction of
https://doi.org/10.1016/j.bbrc.2019.11.035 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: W. Monwan et al., Identification of nucleoporin 93 (Nup93) that mediates antiviral innate immune responses, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.035
2
W. Monwan et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
immune response genes [13]. In human, Nup96 is induced by IFNs and involved in antiviral functions [14,15]. Nup93 is essential for NPC formation and located at inner-ring Nups. N-terminal coiled-coil region in Nup93 mediates the recruitment of Nup62 complex and establishment of the permeability barrier and transport competency of the NPC. C-terminal region of Nup93 contains the NIC96 domain which has two alphahelical (a) regions and is blinkered by beta-sheet (b) [16]. Previous reports suggested that Nup93 interacts with other NPC such as Expotin1 (XPO1) and regulates antiviral immune response through DExD box RNA helicase (DDX3), which mediates the export of HIV1 transcripts [17]. Moreover, it was reported that DDX3 binds to TBK1 and mediates TBK1-dependent antiviral innate immunity [18]. Here, we found that Nup93 plays important roles in RLRmediated innate immune responses by forming a complex with and facilitating TBK1 activity. 2. Materials and methods 2.1. Reagents Lipopolysaccharide (LPS) and High molecular weight (HMW) poly(I:C) were purchased from InvivoGen. Sense and anti-sense IFN stimulatory DNA (ISD) sequences were synthesized by Eurofin Genomics and annealed manually (50 -TACAGATCTACTAGTGATC TATGACTGATCTGTACATGATCTACA-30 ). Poly(I:C) and ISD were each mixed with Lipofectamine 2000 (Life Technologies) a ratio 1:1 (mg/ ml) in Opti-MEM (Life technologies) for stimulation. Newcastle Disease Virus (NDV) was provided according to the previous report [5]. 2.2. Cells RAW264.7, HEK293 and murine embryonic fibroblast (MEF) cells were cultured in Dulbecco’s modified Eagle’s medium (Nacalai Tesque) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Thermo Fisher Scientific) in 5% CO2-humidified incubator. Mouse bone marrow-derived macrophages (BMMs) were cultured in RPMI 1640 (Nacalai Tesque) containing 10% FBS, 100 units/ml penicillin 100 mg/ml streptomycin (Nacalai Tesque), 100 mM of b-mercaptoethanol (Nacalai Tesque) and 20 ng/ml of murine macrophage colony-stimulating factor (M-CSF) (BioLegend). 2.3. Generation of Nup93 knockout (KO) RAW264.7 cells and retrovirus transfer of Nup93 gene Generation of KO cells were described as previously [19,20]. Briefly, single-guide RNA (gRNA) targeting murine Nup93 exon 4 (gRNA 50 - CACCTGTAAATTTCGTTCTACATG -30 ) were inserted to pX330 vector (addgene). Partial fragment of Nup93 was inserted into pCAG-EGxxFP plasmid. These plasmids were electroplated into RAW264.7 cells and EGFP positive cells were sorted by FACSAria (BD Bioscience). Nup93 deficiency was confirmed by sequence analysis and Western blotting (WB). Murine Nup93 and Nup93 mutant with a deletion from 591 to 594 a.a. (Nup93D) was cloned into pMRX-IRES-puro vector and pMRX and pVSV-G were cotransfected into Platinum-E cells with Lipofectamine 2000 (Life Technologies) in Opti-MEM medium at ratio 1:2 (mg/ml). After transfection, cells were added with 10% FBS and cultured for 24e48 h. Supernatants were filtered through 0.22 mm Millex-GV Filter (Millipore) and were transferred to Nup93 KO cells with polybrene (InvivoGen).
2.4. Knockdown BMMs and MEFs 1 106 cells/100 ml were electroporated with 3 mM siRNA by Neon Transfection System (Thermo Fisher Scienctific) at 1400 mA, 20 ms, 1 pulse. After 48 h, cells were stimulated with poly(I:C) and subjected to RT-qPCR and WB analysis. siRNAs for Nup93; 50 -CTGAAGAATGAGAAAGATAATGCCTTG-30 (Fasmac) and scramble siRNA used as control. 2.5. Luciferase assay Luciferase assay was performed as described previously [5]. pGL3-IFNb-Luc plasmid containing a firefly luciferase gene downstream of IFN-b promoter, was used as a reporter plasmids and pTKLuc plasmid containing Renilla luciferase gene downstream of the TK promoter was used as an internal control. Lucifearase expression was measured by using Dual-Luciferase Reporter assay (Promega) and TriStar2 LB Multidetection Microplate Reader (Berthold). 2.6. Immunoprecipitation and pull down HEK293T (1 107 cells) were transfected with expression plasmids for GST-TBK1, FLAG-Nup93 or empty by Opti-MEM (Life Technologies) containing polyethyleneimine (Polysciences, Inc.). After 24e48 h, cells were lysed with lysis buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 5 mM EDTA, 1% NP-40). Lysates were sonicated by 0.2 mm 20% amplitude sonication (Qsonica) and were centrifuged for 15 m at 13,500 rpm. Supernatants were incubated with anti-FLAG antibody agarose beads (Sigma) or Glutathione sepharose beads (Thermo Fisher Scientific), and rotated for 3 h at 4 C. Beads were collected by centrifuging at 5000 rpm for 5 min before washing 3 times with lysis buffer. Sample buffer was applied to beads and eluted samples were subjected to WB with anti-GST (Santa Cruz Biotechnology) and anti-FLAG antibodies (Sigma). 2.7. RT-qPCR RAW264.7 and BMMs at 3 105 cells/well in 24 well plates (Corning) were stimulated with 1 mg/ml LPS for 2 h, 1 mg/ml poly(I:C), and 1 mg/ml ISD for 6 h. Stimulations were terminated by administration of Tri reagent (MRC). Total RNA was extracted by Trizol reagent according to the manufacturer’s protocol. Firststrand cDNA was synthesized using ReverTra Ace Synthesis kit (Toyobo). Real-time RT-PCR analysis was performed with Power up sybergreen Supermix (Applied Biosystem). The following primers used for qRT-PCR: Ifnb1, sense 50 -ATGGTGGTCCGAGCAGAGAT-30 , reverse 50 - CCACCACTCATTCTGAGGCA-30 , Cxcl10, sense 50 CCTGCAGGATGATGGTCAAG-30 , reverse 50 - GAATTCTTGTTCGG CAGTT-30 , Tnfa, sense 50 - CACAGAAAGCATGATCCGCGACGT-30 , reverse, 50 -CGGCAGAGAGGAGGTTGACTTTCT-30 , Gapdh, sense 50 TGACGTGCCGCCTGGAGAAA-30 , reverse 50 - AGTGTAGCCCAA GATGCCCTTCAG-30 , Nup93, sense 50 - CAGAAAGTGAAGGTTTTC CAGTCA-30 , reverse 50 - GTGAAATCTGTACTCAGAAACAAAATT-30 . 3. Results 3.1. Reduced antiviral innate immune responses by Nup93deficiency We measured the transcription of Nup93 mRNA in BMMs after stimulation with LPS, poly (I:C) and ISD by qRT-PCR (Fig. 1A), and found that Nup93 mRNA was significantly upregulated after these stimulations, suggesting that Nup93 is an inducible gene during innate immune activation. To investigate the functional role of Nup93 in innate immune
Please cite this article as: W. Monwan et al., Identification of nucleoporin 93 (Nup93) that mediates antiviral innate immune responses, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.035
W. Monwan et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3
Fig. 1. Reduced antiviral innate immune responses in Nup93 KO cells (A) BMMs were stimulated with LPS, poly(I:C) and ISD and expression of Nup93 and Gapdh genes was quantified by RT-qPCR. (B) Cell lysates from WT and Nup93 KO cells were subjected to WB with anti-Nup93 and anti-Actin antibodies. (C) WT and Nup93 KO cells were stimulated with poly(I:C) and expression of Ifnb, Cxcl10 and Tnfa was measured by RT-qPCR (D, E) Cells were stimulated with poly(I:C) or ISD and production of IFNb, CXCL10 and TNFa was measured by ELISA assay. (F) Cells were infected with NDV at MOI ¼ 10 and Ifnb1 mRNA expression was measured by RT-qPCR. Data are representative of three independent experiments, and mean values and SEs are depicted. *p < 0.05, **p < 0.01 paired Student’s t test.
responses, we disrupted Nup93 gene in RAW264.7 murine macrophage cell line by CRISPR/Cas9 system (Supplemental Fig. 1). Disruption of Nup93 was confirmed by WB with anti-Nup93 antibody (Fig. 1B). Then, wild type (WT) and Nup93-deficient (KO) cells were stimulated with poly(I:C) and cytokine gene expression was measured by qRT-PCR. Expression of Ifnb1 and Cxcl10 mRNA, which is largely dependent on IRF3, was significantly reduced in Nup93 KO cells in comparison with WTcells whereas expression of Tnfa, which is regulated by NF-kB, was comparable between WT and KO cells (Fig. 1C). Production of IFNb and CXCL10 after stimulation with poly(I:C) and ISD, a synthetic dsDNA that stimulates cytosolic DNA sensors such as cGAS [13,14] was also impaired in Nup93 KO cells (Fig.1D and E). Ifnb1 expression after infection with Newcastle Disease virus (NDV), which is sensed by RIG-I, was also abrogated in Nup93 KO cells. Furthermore, reduction of Ifnb1 and Cxcl10 was also found in Nup93 KO cells stimulated with LPS, a bacteria component that activates Toll-like receptor 4 (TLR4) (Supplemental Fig. 2). As signaling via RLRs, cGAS and TLR4 is known to culminate in the activation of TBK1IRF3 and IKKa/beNFekB axis, these results suggest that Nup93 is required for activation of TBK1-IRF3 signaling pathways. 3.2. Reduced antiviral innate immune responses by Nup93 knockdown in primary cells To further analyze Nup93 function with regard to antiviral
innate immune responses, we knocked down Nup93 in BMMs and MEFs. Knockdown efficacy of Nup93 was verified by WB with antiNup93 antibody (Fig. 2A, D) and RT-qPCR analysis (Fig. 2B, E). Ifnb1 and Cxcl10 after poly(I:C) stimulation were significantly reduced in Nup93 siRNA-treated BMMs and MEFs cells as compared with control siRNA-treated cells (Fig. 2C, F). These results suggest an involvement of Nup93 in antiviral innate immune responses in primary cells. 3.3. Impaired IRF3 and TBK1 activation in Nup93 KO cells Reduction of innate immune response in Nup93 KO cells suggests that IRF3 activation is impaired in Nup93 KO cells. To this end, we visualized IRF3 localization by immunofluorescence. In unstimulated condition, IRF3 mainly localized in cytoplasm in both WT and Nup93 KO cells. After poly I:C stimulation, around 60% of WT cells showed IRF3 nuclear localization whereas around 40% of Nup93 KO cells showed the nuclear translocation (Fig. 3A and B), suggesting that Nup93 is required for IRF3 nuclear translocation. Intriguingly, poly(I:C) stimulation induced IRF3 phosphorylation in WT cells, which was reduced in Nup93 KO cells (Fig. 3C). We then investigated whether or not TBK1 auto-phosphorylation is impaired in Nup93 KO cells. TBK1 auto-phosphorylation was increased by poly(I:C) stimulation in WT, and it was reduced in Nup93 KO cells (Fig. 3D). These results collectively suggest that
Please cite this article as: W. Monwan et al., Identification of nucleoporin 93 (Nup93) that mediates antiviral innate immune responses, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.035
4
W. Monwan et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 2. Nup93 knockdown inhibits Ifnb1 induction after poly(I:C) stimulation. (A, B) BMMs were electroporated with siRNA for control or Nup93, and expression of Nup93 was examined by WB (A) and RT-qPCR (B). (C) Ifnb1 and Cxcl10 mRNA expression in BMMs after poly(I:C) stimulation was measured by RT-qPCR. (D, E) MEFs were electroporated with siRNA and expression of Nup93 was confirmed by WB (D) and RT-qPCR (E). (F) Ifnb1 and Cxcl10 mRNA expression in MEFs after poly(I:C) stimulation was measured by RT-qPCR. Gapdh used as an internal control. Data are representative of three independent experiments, and mean values and SEs are depicted. *p < 0.05, **p < 0.01 paired Student’s t-test.
Fig. 3. Nup93 is required for IRF3 nuclear translocation following poly(I:C) stimulation. (A) WT and Nup93 KO cells stimulated with or without poly(I:C) were stained with anti-IRF3 antibody (green) and Hoechst 33,342 (blue). Cells images were collected with confocal microscope. (B) Cells with nuclear IRF3 were counted and bar graph showed the percentage of nuclear located cells in total cells. N ¼ 3; mean values and SEs are depicted. *p < 0.05 paired Student’s t-test. (C, D) WT and Nup93 KO cells were stimulated with poly(I:C). Whole cell lysates (WCL) were immunoblotted with anti-phospho IRF3 and total IRF3 antibodies (C) and anti-phospho TBK1 and total TBK1 antibodies (D).
Please cite this article as: W. Monwan et al., Identification of nucleoporin 93 (Nup93) that mediates antiviral innate immune responses, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.035
W. Monwan et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
TBK1 activation and subsequent IRF3 phosphorylation was impaired by Nup93 deficiency. 3.4. Nup93 interacts with TBK1 and facilitates TBK1 activity Nup93 contains a conserved domain called NucleoporinInteracting Component of 96 kDa (NIC96) domain having two ahelical regions fused with b sheet (Fig. 4A). To understand the functional relationship between TBK1 and Nup93, we constructed a mutant Nup93 with a deletion between 591 and 594 amino acids (a.a.) in the b sheet of NIC96 domain (Nup93D). Then, Nup93 or Nup93D was co-transfected with TBK1 expression plasmid along with a luciferase reporter plasmid driven by IFNb promoter into HEK293T cells. Overexpression of TBK1 alone significantly enhanced the IFNb promoter activation, which was further enhanced with co-expression with Nup93 but not Nup93D (Fig. 4B). Then, Nup93 KO cells were exogenously expressed with Nup93 or Nup93D and expression level of these genes was about 10 times higher than the basal level (Fig. 4C). WT, Nup93 KO cells, Nup93 KO transferred with Nup93 cells, and Nup93 KO transferred with Nup93D cells were stimulated with poly(I:C) and expression of Ifnb was measured by qRT-PCR (Fig. 4C). Exogenous expression of Nup93 into Nup93 KO cells restored Infb expression while Nup93D failed to restore the expression, demonstrating that NIC96 domain is necessary for TBK1-mediated IFNb induction. Then, we examined interaction between Nup93 and TBK1. FLAG-
5
Nup93 expression plasmid was co-transfected with GST-TBK1 or GST expression plasmid into HEK293T cells, and the cell lysates were incubated with Glutathione sepharose. Proteins bound to sepharose beads were analyzed by WB with anti-FLAG antibody. FLAG-Nup93 was co-precipitated with GST-TBK1 but not with GST alone (Fig. 4 D). Furthermore, endogenous TBK1 was also immunoprecipitated with FLAG-Nup93 as revealed by WB with anti-TBK1 antibody (Fig. 4E). Finally, we examined whether b sheet at NIC96 domain in Nup93 is required for TBK1 interaction. FLAG-Nup93 or -Nup93D was co-transfected with GST-TBK1 into HEK293T cells and the cell lysates were incubated with Glutathione sepharose (Fig. 4F). GST-TBK1-associated proteins were blotted with antiFALG antibody. Nup93 interacted with TBK1 whereas Nup93D modestly interacted with TBK1, suggesting that the b sheet at NIC96 domain in Nup93 is required for a robust interaction with TBK1. 4. Discussion In this study, we identified Nup93, a subunit of NPC, as a regulator of antiviral innate immunity. Nup93 gene was upregulated after LPS, poly(I:C) and ISD stimulation (Fig. 1A), suggesting that Nup93 is inducible upon infection that modulates innate immune responses. Nup93-deficiency impaired Ifnb1 and Cxcl10 expression as well as production of IFNb and CXCL10 by poly(I:C) stimulation (Fig. 1C, D, E). Moreover, Nup93-deficiency also suppressed Ifnb1 expression after NDV infection (Fig. 1F). Notably, IRF3
Fig. 4. Nup93 associates with and regulates TBK1 (A) Schematic diagrams of Nup93 and Nup93D. (B) HEK293T cells were co-transfected with Mock, FLAG-Nup93, FLAG-Nup93D and GST-TBK1 along with a luciferase reporter plasmid driven by IFN-b promoter, and luciferase activity was measured (C) Nup93 KO cells were infected with retrovirus encoding FLAGNup93 or FLAG-Nup93D. Expression of WT and Nup93D was measured by RT-qPCR. WT, Nup93 KO and Nup93 KO þ Nup93 or Nup93D cells were stimulated with poly(I:C) and Ifnb1 and Gapdh expression was measured by RT-qPCR. (D) HEK293T cells were transfected with FLAG-empty, GST-empty, FLAG-Nup93 and GST-TBK1 expression plasmids. GST proteins were pulled down by Glutathione sepharose beads. (E) FLAG-empty or FLAG-Nup93 was overexpressed in RAW264.7 cells. WCLs were precipitated with anti-FLAG antibody and precipitants were subjected to WB with anti-TBK1 or anti-FLAG antibody. (F) GST-TBK1 was co-expressed with FLAG-Nup93 or FLAG-Nup93D in HEK293T cells. WCLs were precipitated with Glutathione sepharose beads and blotted with anti-FLAG or anti-TBK1 antibody. Data are representative of three independent experiments, and mean values and SEs are depicted. *p < 0.05, **p < 0.01 paired Student’s t-test.
Please cite this article as: W. Monwan et al., Identification of nucleoporin 93 (Nup93) that mediates antiviral innate immune responses, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.035
6
W. Monwan et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
phosphorylation and nuclear translocation were impaired in Nup93 KO cells. Thus, these results suggest that Nup93 positively mediates RLR-IRF3-dependent antiviral innate immune responses. It was shown that depletion of Nup93 in Xenopus laevis results in defective nuclear pore assembly [16,23]. Nup93 was also shown to be important for a recruitment of Nup62 complex at c-terminal domain of Nup93, which establishes the permeability barrier and transport competency of NPC [16]. Indeed, Nup93 knockdown suppresses nuclear transport of SMAD4 during bone morphogenetic protein-7 (BMP7) stimulation [24]. Thus, it is considered that Nup93-deficiency impairs IRF3 nuclear translocation. However, we found that IRF3 phosphorylation, which occurs in the cytoplasm in a manner dependent on TBK1 activation, was reduced in Nup93 KO cells (Fig. 3C). We found that TBK1 auto-phosphorylation was reduced in Nup93 KO cells (Fig. 3D), and Nup93 interacted with TBK1 and facilitated IFNb promoter activity induced by TBK1 overexpression (Fig. 4B). Thus, Nup93 may have a role to regulate TBK1 activation. Nup93 contains the NIC96 domain that is important for interaction with other Nup family proteins and transport of regulatory proteins between nucleus and cytoplasm. Mutation of Glycine 591 in NIC96 domain in Nup93 was shown to abrogate the interaction with Importin 7 [24]. From this notion, we generated deletion mutant that targets b sheet between a helix in NIC96 domain, and found that Nup93D failed to enhance the promoter activity induced by TBK1 overexpression and rescue Ifnb1 induction in Nup93 KO cells (Fig. 4B and C). These findings collectively suggest that Nup93 regulates TBK1 activation via the NIC96 domain. Nups are known as the NPC that regulates nucleocytoplasmic transport [25e27]; however, recent studies have suggested that Nups are synthesized as soluble proteins in the cytoplasm. Nups have a mobility both on and off with nuclear membrane [28,29]. Indeed, several Nups including Nup88, Nup214, Nup205 are shown to localize at cytoplasmic puncta known as stress granule in human cells [30]. It is therefore likely that Nup93 may have a bifunctional role which regulates TBK1 activity as well as NPC formation. Furthermore, we found that Nup93 interacts with TBK1 and its interaction was reduced by deletion of b sheet at NIC96 domain in Nup93, suggesting that b sheet at NIC96 domain in Nup93 is required for TBK1 interaction which maximizes its activities, but the other region in Nup93 is also involved in association with TBK1. A previous report from Wang and colleagues showed that the ubiquitin chains create an anchoring platform for recruiting and activating TBK1 to the perinuclear microsomes [31]. It may be possible that Nup93 interacts with TBK1 when TBK1 is recruited to the nuclear membrane along with perinuclear microsomes during viral infection, which should be investigated in the future. Here we found that Nup93 enhances activation of TBK1. Nup93 may also have a role to transport of phosphorylated IRF3 from cytosol to nucleus. Nup93 may bifunctionally work for the regulation of activation of cytosolic signaling molecules such as TBK1 as well as nuclear transport of IRF3 via NPC formation. However, additional studies are needed to elucidate the mechanism underlying innate immune regulation by Nup93. As described in the introduction, Nup93 is a conserved gene among several species. Innate immune response is also one of well conserved host defense system, and therefore it is interesting to clarify innate immune regulation by Nup93 in other species as well. Further work in examining the role of Nup93 in mammalian viral infection will lead to better understanding of the regulation of innate immune system and development of therapeutic applications targeting viral diseases. Acknowledgement We thank C. Suzuki for secretarial assistance. We also thank Dr. T. Sueyoshi and Mr. T. Deguchi for their technical assistance. This
study was supported by JSPS KAKENHI Grant-in-Aid for Scientific Research B (JP17H04066) and C (JP19K07608), Uehara Memorial Foundation and Takeda Science Foundation. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.11.035. References [1] C.A. Janeway Jr., R. Medzhitov, Innate immune recognition, Annu. Rev. Immunol. 20 (1) (2002) 197e216. [2] C.A. Janeway, Approaching the asymptote? Evolution and revolution in immunology, Cold Spring Harbor Symp. Quant. Biol. 54 (1989) 1e13. [3] Y.-M. Loo, M. Gale Jr., Immune signaling by RIG-I-like receptors, Immunity 34 (5) (2011) 680e692. [4] M. Yoneyama, T. Fujita, Structural mechanism of RNA recognition by the RIGI-like receptors, Immunity 29 (2) (2008) 178e181. [5] T. Kawai, et al., IPS-1, an adaptor triggering RIG-I-and Mda5-mediated type I interferon induction, Nat. Immunol. 6 (10) (2005) 981. [6] T. Kawai, S. Akira, Innate immune recognition of viral infection, Nat. Immunol. 7 (2) (2006) 131e137. [7] H. Ishikawa, G.N. Barber, STING is an endoplasmic reticulum adaptor that facilitates innate immune signalling, Nature 455 (7213) (2008) 674. [8] K.A. Fitzgerald, et al., IKKE and TBKI are essential components of the IRF3 signalling pathway, Nat. Immunol. 4 (491) (2003). [9] S. Sharma, B.R. TenOever, N. Grandvaux, G.P. Zhou, R. Lin, J. Hiscott, Triggering the interferon antiviral response through an IKK-related pathway, Science 80 (2003). [10] E. Grossman, O. Medalia, M. Zwerger, Functional architecture of the nuclear pore complex, Annu. Rev. Biophys. 41 (2012) 557e584. [11] C. Li, A. Goryaynov, W. Yang, The selective permeability barrier in the nuclear pore complex, Nucleus 7 (5) (2016) 430e446. [12] D. Panda, et al., Nup98 promotes antiviral gene expression to restrict RNA viral infection in Drosophila, Proc. Natl. Acad. Sci. 111 (37) (2014) E3890eE3899. [13] N. Xylourgidis, P. Roth, N. Sabri, V. Tsarouhas, C. Samakovlis, The nucleoporin Nup214 sequesters CRM1 at the nuclear rim and modulates NFkB activation in Drosophila, J. Cell Sci. 119 (21) (2006) 4409e4419. [14] J. Enninga, D.E. Levy, G. Blobel, B.M.A. Fontoura, Role of nucleoporin induction in releasing an mRNA nuclear export block, Science (80- 295 (5559) (2002) 1523e1525. [15] A.M.C. Faria, et al., The nucleoporin Nup96 is required for proper expression of interferon-regulated proteins and functions, Immunity 24 (3) (2006) 295e304. €tenmeyer, W. Antonin, The C-terminal [16] R. Sachdev, C. Sieverding, M. Flo domain of Nup93 is essential for assembly of the structural backbone of nuclear pore complexes, Mol. Biol. Cell 23 (4) (2012) 740e749. [17] V.S.R.K. Yedavalli, C. Neuveut, Y. Chi, L. Kleiman, K.-T. Jeang, Requirement of DDX3 DEAD box RNA helicase for HIV-1 Rev-RRE export function, Cell 119 (3) (2004) 381e392. [18] M. Baril, et al., Genome-wide RNAi screen reveals a new role of a WNT/ CTNNB1 signaling pathway as negative regulator of virus-induced innate immune responses, PLoS Pathog. 9 (6) (2013), e1003416. [19] T. Sueyoshi, T. Kawasaki, Y. Kitai, D. Ori, S. Akira, T. Kawai, Hu antigen R regulates antiviral innate immune responses through the stabilization of mRNA for polo-like kinase 2, J. Immunol. 200 (3814) (2018). [20] M. Murase, et al., Intravesicular acidification regulates lipopolysaccharide inflammation and tolerance through TLR4 trafficking, J. Immunol. 200 (2798) (2018). [23] P. Grandi, et al., Nup93, a vertebrate homologue of yeast Nic96p, forms a complex with a novel 205-kDa protein and is required for correct nuclear pore assembly, Mol. Biol. Cell 8 (10) (1997) 2017e2038. [24] D.A. Braun, et al., Mutations in nuclear pore genes NUP93, NUP205 and XPO5 cause steroid-resistant nephrotic syndrome, Nat. Genet. 48 (4) (2016) 457. [25] M. Beck, E. Hurt, The nuclear pore complex: understanding its function through structural insight, Nat. Rev. Mol. Cell Biol. 18 (2) (2017) 73. [26] A. Ibarra, M.W. Hetzer, Nuclear pore proteins and the control of genome functions, Genes Dev. 29 (4) (2015) 337e349. [27] K.E. Knockenhauer, T.U. Schwartz, The nuclear pore complex as a flexible and dynamic gate, Cell 164 (6) (2016) 1162e1171. [28] J.M. Cronshaw, A.N. Krutchinsky, W. Zhang, B.T. Chait, M.J. Matunis, Proteomic analysis of the mammalian nuclear pore complex, J. Cell Biol. 158 (5) (2002) 915e927. [29] G. Rabut, V. Doye, J. Ellenberg, Mapping the dynamic organization of the nuclear pore complex inside single living cells, Nat. Cell Biol. 6 (11) (2004) 1114e1121. [30] K. Zhang, et al., Stress granule assembly disrupts nucleocytoplasmic transport, Cell 173 (4) (2018) 958e971, e17. [31] Q. Wang, et al., The E3 ubiquitin ligase AMFR and INSIG1 bridge the activation of TBK1 kinase by modifying the adaptor STING, Immunity 41 (6) (2014) 919e933.
Please cite this article as: W. Monwan et al., Identification of nucleoporin 93 (Nup93) that mediates antiviral innate immune responses, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.035
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Identification of nucleoporin 93 (Nup93) that mediates antiviral innate immune responses Warunthorn Monwan, Takumi Kawasaki**, Md Zobaer Hasan, Daisuke Ori, Taro Kawai* Laboratory of Molecular Immunobiology, Division of Biological Science, Graduate School of Science and Technology, Nara Institute of Science and Technology (NAIST), Nara, 630-0192, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 27 September 2019 Accepted 5 November 2019 Available online xxx
RIG-I-like receptors (RLRs) are cytoplasmic sensors for viral RNA that elicit antiviral innate immune responses. RLR signaling culminates in the activation of the protein kinase TBK1, which mediates phosphorylation and nuclear translocation of IRF3 that regulates expression of type I interferon genes. Here, we found that Nucleoporin 93 (Nup93), components of nuclear pore complex (NPC), plays an important role in RLR-mediated antiviral responses. Nup93-deficient RAW264.7 macrophage cells exhibited decreased expression of Ifnb1 and Cxcl10 genes after treatment with a synthetic RLR agonist stimulation as well as Newcastle Disease Virus infection. Silencing Nup93 in murine primary macrophages and embryonic fibroblasts also resulted in reduced expression of these genes. IRF3 nuclear translocation during RLR signaling was impaired in Nup93-deficient RAW264.7 cells. Notably, the activation of TBK1 during RLR signaling was also decreased in Nup93-deficient cells. We found that Nup93 formed a complex with TBK1, and Nup93 overexpression enhanced TBK1-mediated IFNb promoter activation. Taken together, our findings suggest that Nup93 regulates antiviral innate immunity by enhancing TBK1 activity and IRF3 nuclear translocation. © 2019 Elsevier Inc. All rights reserved.
Keywords: Innate immunity Virus infection Nup Type I IFN
1. Introduction Innate immunity is crucially important in initial responses to protect the host from infection. Innate immune cells such as macrophages and dendritic cells (DCs) recognize pathogen-associated molecular patterns (PAMPs) derived from pathogens through germline-encoded pattern-recognition receptors (PRRs). Recognition of PAMPs by PRRs in these cells triggers innate immune responses to produce pro-inflammatory cytokines and type I interferons (IFNs) [1,2],. RIG-I-like receptor (RLR) family, consisting of RIG-I and MDA5, recognizes RNA derived from RNA viruses in the cytoplasm. RLRs possess N-terminal two caspase recruitment domains (CARDs), a central DEAD box helicase/ATPase domain and a C-terminal regulatory domain. RIG-I recognizes short double-stranded (ds) RNA with 50 -triphosphate or -diphosphate group and short synthetic dsRNA analogue, polyinosinic:polycytidylic acid (poly(I:C))
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (T. Kawasaki), [email protected] (T. Kawai).
whereas MDA5 recognizes long dsRNA and long poly(I:C) [3,4]. RIGI and MDA5 initiate signaling by interacting with an adapter molecule localized to mitochondria namely IPS-1 (also known MAVS) [5e7]. IPS-1 further activates signaling cascades leading to the activation of protein kinases TBK1 and IKKa/b. The activated TBK1 phosphorylates the transcription factor IRF3. Phosphorylated IRF3 forms a homodimer and translocates to the nucleus from cytoplasm. IKKa/b phosphorylate IkB proteins and triggers their degradation, allowing the transcription factor NF-kB to translocate to the nucleus. IRF3 and NF-kB cooperatively regulate the expression of pro-inflammatory cytokines genes and type I IFN genes [8,9]. Nuclear pore complex (NPC) is the bidirectional transport of materials between nucleus and cytoplasm [10,11]. NPC consists of approximately 30 different types of nucleoporins (Nups), which mediate trafficking of various macromolecules. Nups are evolutionally conserved in distant eukaryotes ranging from yeast to human. Numerous studies have been suggesting that Nups are involved in the regulation of innate immune signaling pathways in insects and mammals. In Drosophila, Nup98 promotes antiviral gene expression to restrict RNA virus infection [12], and Nup214Nup88 complex mediates NF-kB translocation and induction of
https://doi.org/10.1016/j.bbrc.2019.11.035 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: W. Monwan et al., Identification of nucleoporin 93 (Nup93) that mediates antiviral innate immune responses, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.035
2
W. Monwan et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
immune response genes [13]. In human, Nup96 is induced by IFNs and involved in antiviral functions [14,15]. Nup93 is essential for NPC formation and located at inner-ring Nups. N-terminal coiled-coil region in Nup93 mediates the recruitment of Nup62 complex and establishment of the permeability barrier and transport competency of the NPC. C-terminal region of Nup93 contains the NIC96 domain which has two alphahelical (a) regions and is blinkered by beta-sheet (b) [16]. Previous reports suggested that Nup93 interacts with other NPC such as Expotin1 (XPO1) and regulates antiviral immune response through DExD box RNA helicase (DDX3), which mediates the export of HIV1 transcripts [17]. Moreover, it was reported that DDX3 binds to TBK1 and mediates TBK1-dependent antiviral innate immunity [18]. Here, we found that Nup93 plays important roles in RLRmediated innate immune responses by forming a complex with and facilitating TBK1 activity. 2. Materials and methods 2.1. Reagents Lipopolysaccharide (LPS) and High molecular weight (HMW) poly(I:C) were purchased from InvivoGen. Sense and anti-sense IFN stimulatory DNA (ISD) sequences were synthesized by Eurofin Genomics and annealed manually (50 -TACAGATCTACTAGTGATC TATGACTGATCTGTACATGATCTACA-30 ). Poly(I:C) and ISD were each mixed with Lipofectamine 2000 (Life Technologies) a ratio 1:1 (mg/ ml) in Opti-MEM (Life technologies) for stimulation. Newcastle Disease Virus (NDV) was provided according to the previous report [5]. 2.2. Cells RAW264.7, HEK293 and murine embryonic fibroblast (MEF) cells were cultured in Dulbecco’s modified Eagle’s medium (Nacalai Tesque) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Thermo Fisher Scientific) in 5% CO2-humidified incubator. Mouse bone marrow-derived macrophages (BMMs) were cultured in RPMI 1640 (Nacalai Tesque) containing 10% FBS, 100 units/ml penicillin 100 mg/ml streptomycin (Nacalai Tesque), 100 mM of b-mercaptoethanol (Nacalai Tesque) and 20 ng/ml of murine macrophage colony-stimulating factor (M-CSF) (BioLegend). 2.3. Generation of Nup93 knockout (KO) RAW264.7 cells and retrovirus transfer of Nup93 gene Generation of KO cells were described as previously [19,20]. Briefly, single-guide RNA (gRNA) targeting murine Nup93 exon 4 (gRNA 50 - CACCTGTAAATTTCGTTCTACATG -30 ) were inserted to pX330 vector (addgene). Partial fragment of Nup93 was inserted into pCAG-EGxxFP plasmid. These plasmids were electroplated into RAW264.7 cells and EGFP positive cells were sorted by FACSAria (BD Bioscience). Nup93 deficiency was confirmed by sequence analysis and Western blotting (WB). Murine Nup93 and Nup93 mutant with a deletion from 591 to 594 a.a. (Nup93D) was cloned into pMRX-IRES-puro vector and pMRX and pVSV-G were cotransfected into Platinum-E cells with Lipofectamine 2000 (Life Technologies) in Opti-MEM medium at ratio 1:2 (mg/ml). After transfection, cells were added with 10% FBS and cultured for 24e48 h. Supernatants were filtered through 0.22 mm Millex-GV Filter (Millipore) and were transferred to Nup93 KO cells with polybrene (InvivoGen).
2.4. Knockdown BMMs and MEFs 1 106 cells/100 ml were electroporated with 3 mM siRNA by Neon Transfection System (Thermo Fisher Scienctific) at 1400 mA, 20 ms, 1 pulse. After 48 h, cells were stimulated with poly(I:C) and subjected to RT-qPCR and WB analysis. siRNAs for Nup93; 50 -CTGAAGAATGAGAAAGATAATGCCTTG-30 (Fasmac) and scramble siRNA used as control. 2.5. Luciferase assay Luciferase assay was performed as described previously [5]. pGL3-IFNb-Luc plasmid containing a firefly luciferase gene downstream of IFN-b promoter, was used as a reporter plasmids and pTKLuc plasmid containing Renilla luciferase gene downstream of the TK promoter was used as an internal control. Lucifearase expression was measured by using Dual-Luciferase Reporter assay (Promega) and TriStar2 LB Multidetection Microplate Reader (Berthold). 2.6. Immunoprecipitation and pull down HEK293T (1 107 cells) were transfected with expression plasmids for GST-TBK1, FLAG-Nup93 or empty by Opti-MEM (Life Technologies) containing polyethyleneimine (Polysciences, Inc.). After 24e48 h, cells were lysed with lysis buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 5 mM EDTA, 1% NP-40). Lysates were sonicated by 0.2 mm 20% amplitude sonication (Qsonica) and were centrifuged for 15 m at 13,500 rpm. Supernatants were incubated with anti-FLAG antibody agarose beads (Sigma) or Glutathione sepharose beads (Thermo Fisher Scientific), and rotated for 3 h at 4 C. Beads were collected by centrifuging at 5000 rpm for 5 min before washing 3 times with lysis buffer. Sample buffer was applied to beads and eluted samples were subjected to WB with anti-GST (Santa Cruz Biotechnology) and anti-FLAG antibodies (Sigma). 2.7. RT-qPCR RAW264.7 and BMMs at 3 105 cells/well in 24 well plates (Corning) were stimulated with 1 mg/ml LPS for 2 h, 1 mg/ml poly(I:C), and 1 mg/ml ISD for 6 h. Stimulations were terminated by administration of Tri reagent (MRC). Total RNA was extracted by Trizol reagent according to the manufacturer’s protocol. Firststrand cDNA was synthesized using ReverTra Ace Synthesis kit (Toyobo). Real-time RT-PCR analysis was performed with Power up sybergreen Supermix (Applied Biosystem). The following primers used for qRT-PCR: Ifnb1, sense 50 -ATGGTGGTCCGAGCAGAGAT-30 , reverse 50 - CCACCACTCATTCTGAGGCA-30 , Cxcl10, sense 50 CCTGCAGGATGATGGTCAAG-30 , reverse 50 - GAATTCTTGTTCGG CAGTT-30 , Tnfa, sense 50 - CACAGAAAGCATGATCCGCGACGT-30 , reverse, 50 -CGGCAGAGAGGAGGTTGACTTTCT-30 , Gapdh, sense 50 TGACGTGCCGCCTGGAGAAA-30 , reverse 50 - AGTGTAGCCCAA GATGCCCTTCAG-30 , Nup93, sense 50 - CAGAAAGTGAAGGTTTTC CAGTCA-30 , reverse 50 - GTGAAATCTGTACTCAGAAACAAAATT-30 . 3. Results 3.1. Reduced antiviral innate immune responses by Nup93deficiency We measured the transcription of Nup93 mRNA in BMMs after stimulation with LPS, poly (I:C) and ISD by qRT-PCR (Fig. 1A), and found that Nup93 mRNA was significantly upregulated after these stimulations, suggesting that Nup93 is an inducible gene during innate immune activation. To investigate the functional role of Nup93 in innate immune
Please cite this article as: W. Monwan et al., Identification of nucleoporin 93 (Nup93) that mediates antiviral innate immune responses, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.035
W. Monwan et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3
Fig. 1. Reduced antiviral innate immune responses in Nup93 KO cells (A) BMMs were stimulated with LPS, poly(I:C) and ISD and expression of Nup93 and Gapdh genes was quantified by RT-qPCR. (B) Cell lysates from WT and Nup93 KO cells were subjected to WB with anti-Nup93 and anti-Actin antibodies. (C) WT and Nup93 KO cells were stimulated with poly(I:C) and expression of Ifnb, Cxcl10 and Tnfa was measured by RT-qPCR (D, E) Cells were stimulated with poly(I:C) or ISD and production of IFNb, CXCL10 and TNFa was measured by ELISA assay. (F) Cells were infected with NDV at MOI ¼ 10 and Ifnb1 mRNA expression was measured by RT-qPCR. Data are representative of three independent experiments, and mean values and SEs are depicted. *p < 0.05, **p < 0.01 paired Student’s t test.
responses, we disrupted Nup93 gene in RAW264.7 murine macrophage cell line by CRISPR/Cas9 system (Supplemental Fig. 1). Disruption of Nup93 was confirmed by WB with anti-Nup93 antibody (Fig. 1B). Then, wild type (WT) and Nup93-deficient (KO) cells were stimulated with poly(I:C) and cytokine gene expression was measured by qRT-PCR. Expression of Ifnb1 and Cxcl10 mRNA, which is largely dependent on IRF3, was significantly reduced in Nup93 KO cells in comparison with WTcells whereas expression of Tnfa, which is regulated by NF-kB, was comparable between WT and KO cells (Fig. 1C). Production of IFNb and CXCL10 after stimulation with poly(I:C) and ISD, a synthetic dsDNA that stimulates cytosolic DNA sensors such as cGAS [13,14] was also impaired in Nup93 KO cells (Fig.1D and E). Ifnb1 expression after infection with Newcastle Disease virus (NDV), which is sensed by RIG-I, was also abrogated in Nup93 KO cells. Furthermore, reduction of Ifnb1 and Cxcl10 was also found in Nup93 KO cells stimulated with LPS, a bacteria component that activates Toll-like receptor 4 (TLR4) (Supplemental Fig. 2). As signaling via RLRs, cGAS and TLR4 is known to culminate in the activation of TBK1IRF3 and IKKa/beNFekB axis, these results suggest that Nup93 is required for activation of TBK1-IRF3 signaling pathways. 3.2. Reduced antiviral innate immune responses by Nup93 knockdown in primary cells To further analyze Nup93 function with regard to antiviral
innate immune responses, we knocked down Nup93 in BMMs and MEFs. Knockdown efficacy of Nup93 was verified by WB with antiNup93 antibody (Fig. 2A, D) and RT-qPCR analysis (Fig. 2B, E). Ifnb1 and Cxcl10 after poly(I:C) stimulation were significantly reduced in Nup93 siRNA-treated BMMs and MEFs cells as compared with control siRNA-treated cells (Fig. 2C, F). These results suggest an involvement of Nup93 in antiviral innate immune responses in primary cells. 3.3. Impaired IRF3 and TBK1 activation in Nup93 KO cells Reduction of innate immune response in Nup93 KO cells suggests that IRF3 activation is impaired in Nup93 KO cells. To this end, we visualized IRF3 localization by immunofluorescence. In unstimulated condition, IRF3 mainly localized in cytoplasm in both WT and Nup93 KO cells. After poly I:C stimulation, around 60% of WT cells showed IRF3 nuclear localization whereas around 40% of Nup93 KO cells showed the nuclear translocation (Fig. 3A and B), suggesting that Nup93 is required for IRF3 nuclear translocation. Intriguingly, poly(I:C) stimulation induced IRF3 phosphorylation in WT cells, which was reduced in Nup93 KO cells (Fig. 3C). We then investigated whether or not TBK1 auto-phosphorylation is impaired in Nup93 KO cells. TBK1 auto-phosphorylation was increased by poly(I:C) stimulation in WT, and it was reduced in Nup93 KO cells (Fig. 3D). These results collectively suggest that
Please cite this article as: W. Monwan et al., Identification of nucleoporin 93 (Nup93) that mediates antiviral innate immune responses, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.035
4
W. Monwan et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 2. Nup93 knockdown inhibits Ifnb1 induction after poly(I:C) stimulation. (A, B) BMMs were electroporated with siRNA for control or Nup93, and expression of Nup93 was examined by WB (A) and RT-qPCR (B). (C) Ifnb1 and Cxcl10 mRNA expression in BMMs after poly(I:C) stimulation was measured by RT-qPCR. (D, E) MEFs were electroporated with siRNA and expression of Nup93 was confirmed by WB (D) and RT-qPCR (E). (F) Ifnb1 and Cxcl10 mRNA expression in MEFs after poly(I:C) stimulation was measured by RT-qPCR. Gapdh used as an internal control. Data are representative of three independent experiments, and mean values and SEs are depicted. *p < 0.05, **p < 0.01 paired Student’s t-test.
Fig. 3. Nup93 is required for IRF3 nuclear translocation following poly(I:C) stimulation. (A) WT and Nup93 KO cells stimulated with or without poly(I:C) were stained with anti-IRF3 antibody (green) and Hoechst 33,342 (blue). Cells images were collected with confocal microscope. (B) Cells with nuclear IRF3 were counted and bar graph showed the percentage of nuclear located cells in total cells. N ¼ 3; mean values and SEs are depicted. *p < 0.05 paired Student’s t-test. (C, D) WT and Nup93 KO cells were stimulated with poly(I:C). Whole cell lysates (WCL) were immunoblotted with anti-phospho IRF3 and total IRF3 antibodies (C) and anti-phospho TBK1 and total TBK1 antibodies (D).
Please cite this article as: W. Monwan et al., Identification of nucleoporin 93 (Nup93) that mediates antiviral innate immune responses, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.035
W. Monwan et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
TBK1 activation and subsequent IRF3 phosphorylation was impaired by Nup93 deficiency. 3.4. Nup93 interacts with TBK1 and facilitates TBK1 activity Nup93 contains a conserved domain called NucleoporinInteracting Component of 96 kDa (NIC96) domain having two ahelical regions fused with b sheet (Fig. 4A). To understand the functional relationship between TBK1 and Nup93, we constructed a mutant Nup93 with a deletion between 591 and 594 amino acids (a.a.) in the b sheet of NIC96 domain (Nup93D). Then, Nup93 or Nup93D was co-transfected with TBK1 expression plasmid along with a luciferase reporter plasmid driven by IFNb promoter into HEK293T cells. Overexpression of TBK1 alone significantly enhanced the IFNb promoter activation, which was further enhanced with co-expression with Nup93 but not Nup93D (Fig. 4B). Then, Nup93 KO cells were exogenously expressed with Nup93 or Nup93D and expression level of these genes was about 10 times higher than the basal level (Fig. 4C). WT, Nup93 KO cells, Nup93 KO transferred with Nup93 cells, and Nup93 KO transferred with Nup93D cells were stimulated with poly(I:C) and expression of Ifnb was measured by qRT-PCR (Fig. 4C). Exogenous expression of Nup93 into Nup93 KO cells restored Infb expression while Nup93D failed to restore the expression, demonstrating that NIC96 domain is necessary for TBK1-mediated IFNb induction. Then, we examined interaction between Nup93 and TBK1. FLAG-
5
Nup93 expression plasmid was co-transfected with GST-TBK1 or GST expression plasmid into HEK293T cells, and the cell lysates were incubated with Glutathione sepharose. Proteins bound to sepharose beads were analyzed by WB with anti-FLAG antibody. FLAG-Nup93 was co-precipitated with GST-TBK1 but not with GST alone (Fig. 4 D). Furthermore, endogenous TBK1 was also immunoprecipitated with FLAG-Nup93 as revealed by WB with anti-TBK1 antibody (Fig. 4E). Finally, we examined whether b sheet at NIC96 domain in Nup93 is required for TBK1 interaction. FLAG-Nup93 or -Nup93D was co-transfected with GST-TBK1 into HEK293T cells and the cell lysates were incubated with Glutathione sepharose (Fig. 4F). GST-TBK1-associated proteins were blotted with antiFALG antibody. Nup93 interacted with TBK1 whereas Nup93D modestly interacted with TBK1, suggesting that the b sheet at NIC96 domain in Nup93 is required for a robust interaction with TBK1. 4. Discussion In this study, we identified Nup93, a subunit of NPC, as a regulator of antiviral innate immunity. Nup93 gene was upregulated after LPS, poly(I:C) and ISD stimulation (Fig. 1A), suggesting that Nup93 is inducible upon infection that modulates innate immune responses. Nup93-deficiency impaired Ifnb1 and Cxcl10 expression as well as production of IFNb and CXCL10 by poly(I:C) stimulation (Fig. 1C, D, E). Moreover, Nup93-deficiency also suppressed Ifnb1 expression after NDV infection (Fig. 1F). Notably, IRF3
Fig. 4. Nup93 associates with and regulates TBK1 (A) Schematic diagrams of Nup93 and Nup93D. (B) HEK293T cells were co-transfected with Mock, FLAG-Nup93, FLAG-Nup93D and GST-TBK1 along with a luciferase reporter plasmid driven by IFN-b promoter, and luciferase activity was measured (C) Nup93 KO cells were infected with retrovirus encoding FLAGNup93 or FLAG-Nup93D. Expression of WT and Nup93D was measured by RT-qPCR. WT, Nup93 KO and Nup93 KO þ Nup93 or Nup93D cells were stimulated with poly(I:C) and Ifnb1 and Gapdh expression was measured by RT-qPCR. (D) HEK293T cells were transfected with FLAG-empty, GST-empty, FLAG-Nup93 and GST-TBK1 expression plasmids. GST proteins were pulled down by Glutathione sepharose beads. (E) FLAG-empty or FLAG-Nup93 was overexpressed in RAW264.7 cells. WCLs were precipitated with anti-FLAG antibody and precipitants were subjected to WB with anti-TBK1 or anti-FLAG antibody. (F) GST-TBK1 was co-expressed with FLAG-Nup93 or FLAG-Nup93D in HEK293T cells. WCLs were precipitated with Glutathione sepharose beads and blotted with anti-FLAG or anti-TBK1 antibody. Data are representative of three independent experiments, and mean values and SEs are depicted. *p < 0.05, **p < 0.01 paired Student’s t-test.
Please cite this article as: W. Monwan et al., Identification of nucleoporin 93 (Nup93) that mediates antiviral innate immune responses, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.035
6
W. Monwan et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
phosphorylation and nuclear translocation were impaired in Nup93 KO cells. Thus, these results suggest that Nup93 positively mediates RLR-IRF3-dependent antiviral innate immune responses. It was shown that depletion of Nup93 in Xenopus laevis results in defective nuclear pore assembly [16,23]. Nup93 was also shown to be important for a recruitment of Nup62 complex at c-terminal domain of Nup93, which establishes the permeability barrier and transport competency of NPC [16]. Indeed, Nup93 knockdown suppresses nuclear transport of SMAD4 during bone morphogenetic protein-7 (BMP7) stimulation [24]. Thus, it is considered that Nup93-deficiency impairs IRF3 nuclear translocation. However, we found that IRF3 phosphorylation, which occurs in the cytoplasm in a manner dependent on TBK1 activation, was reduced in Nup93 KO cells (Fig. 3C). We found that TBK1 auto-phosphorylation was reduced in Nup93 KO cells (Fig. 3D), and Nup93 interacted with TBK1 and facilitated IFNb promoter activity induced by TBK1 overexpression (Fig. 4B). Thus, Nup93 may have a role to regulate TBK1 activation. Nup93 contains the NIC96 domain that is important for interaction with other Nup family proteins and transport of regulatory proteins between nucleus and cytoplasm. Mutation of Glycine 591 in NIC96 domain in Nup93 was shown to abrogate the interaction with Importin 7 [24]. From this notion, we generated deletion mutant that targets b sheet between a helix in NIC96 domain, and found that Nup93D failed to enhance the promoter activity induced by TBK1 overexpression and rescue Ifnb1 induction in Nup93 KO cells (Fig. 4B and C). These findings collectively suggest that Nup93 regulates TBK1 activation via the NIC96 domain. Nups are known as the NPC that regulates nucleocytoplasmic transport [25e27]; however, recent studies have suggested that Nups are synthesized as soluble proteins in the cytoplasm. Nups have a mobility both on and off with nuclear membrane [28,29]. Indeed, several Nups including Nup88, Nup214, Nup205 are shown to localize at cytoplasmic puncta known as stress granule in human cells [30]. It is therefore likely that Nup93 may have a bifunctional role which regulates TBK1 activity as well as NPC formation. Furthermore, we found that Nup93 interacts with TBK1 and its interaction was reduced by deletion of b sheet at NIC96 domain in Nup93, suggesting that b sheet at NIC96 domain in Nup93 is required for TBK1 interaction which maximizes its activities, but the other region in Nup93 is also involved in association with TBK1. A previous report from Wang and colleagues showed that the ubiquitin chains create an anchoring platform for recruiting and activating TBK1 to the perinuclear microsomes [31]. It may be possible that Nup93 interacts with TBK1 when TBK1 is recruited to the nuclear membrane along with perinuclear microsomes during viral infection, which should be investigated in the future. Here we found that Nup93 enhances activation of TBK1. Nup93 may also have a role to transport of phosphorylated IRF3 from cytosol to nucleus. Nup93 may bifunctionally work for the regulation of activation of cytosolic signaling molecules such as TBK1 as well as nuclear transport of IRF3 via NPC formation. However, additional studies are needed to elucidate the mechanism underlying innate immune regulation by Nup93. As described in the introduction, Nup93 is a conserved gene among several species. Innate immune response is also one of well conserved host defense system, and therefore it is interesting to clarify innate immune regulation by Nup93 in other species as well. Further work in examining the role of Nup93 in mammalian viral infection will lead to better understanding of the regulation of innate immune system and development of therapeutic applications targeting viral diseases. Acknowledgement We thank C. Suzuki for secretarial assistance. We also thank Dr. T. Sueyoshi and Mr. T. Deguchi for their technical assistance. This
study was supported by JSPS KAKENHI Grant-in-Aid for Scientific Research B (JP17H04066) and C (JP19K07608), Uehara Memorial Foundation and Takeda Science Foundation. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.11.035. References [1] C.A. Janeway Jr., R. Medzhitov, Innate immune recognition, Annu. Rev. Immunol. 20 (1) (2002) 197e216. [2] C.A. Janeway, Approaching the asymptote? Evolution and revolution in immunology, Cold Spring Harbor Symp. Quant. Biol. 54 (1989) 1e13. [3] Y.-M. Loo, M. Gale Jr., Immune signaling by RIG-I-like receptors, Immunity 34 (5) (2011) 680e692. [4] M. Yoneyama, T. Fujita, Structural mechanism of RNA recognition by the RIGI-like receptors, Immunity 29 (2) (2008) 178e181. [5] T. Kawai, et al., IPS-1, an adaptor triggering RIG-I-and Mda5-mediated type I interferon induction, Nat. Immunol. 6 (10) (2005) 981. [6] T. Kawai, S. Akira, Innate immune recognition of viral infection, Nat. Immunol. 7 (2) (2006) 131e137. [7] H. Ishikawa, G.N. Barber, STING is an endoplasmic reticulum adaptor that facilitates innate immune signalling, Nature 455 (7213) (2008) 674. [8] K.A. Fitzgerald, et al., IKKE and TBKI are essential components of the IRF3 signalling pathway, Nat. Immunol. 4 (491) (2003). [9] S. Sharma, B.R. TenOever, N. Grandvaux, G.P. Zhou, R. Lin, J. Hiscott, Triggering the interferon antiviral response through an IKK-related pathway, Science 80 (2003). [10] E. Grossman, O. Medalia, M. Zwerger, Functional architecture of the nuclear pore complex, Annu. Rev. Biophys. 41 (2012) 557e584. [11] C. Li, A. Goryaynov, W. Yang, The selective permeability barrier in the nuclear pore complex, Nucleus 7 (5) (2016) 430e446. [12] D. Panda, et al., Nup98 promotes antiviral gene expression to restrict RNA viral infection in Drosophila, Proc. Natl. Acad. Sci. 111 (37) (2014) E3890eE3899. [13] N. Xylourgidis, P. Roth, N. Sabri, V. Tsarouhas, C. Samakovlis, The nucleoporin Nup214 sequesters CRM1 at the nuclear rim and modulates NFkB activation in Drosophila, J. Cell Sci. 119 (21) (2006) 4409e4419. [14] J. Enninga, D.E. Levy, G. Blobel, B.M.A. Fontoura, Role of nucleoporin induction in releasing an mRNA nuclear export block, Science (80- 295 (5559) (2002) 1523e1525. [15] A.M.C. Faria, et al., The nucleoporin Nup96 is required for proper expression of interferon-regulated proteins and functions, Immunity 24 (3) (2006) 295e304. €tenmeyer, W. Antonin, The C-terminal [16] R. Sachdev, C. Sieverding, M. Flo domain of Nup93 is essential for assembly of the structural backbone of nuclear pore complexes, Mol. Biol. Cell 23 (4) (2012) 740e749. [17] V.S.R.K. Yedavalli, C. Neuveut, Y. Chi, L. Kleiman, K.-T. Jeang, Requirement of DDX3 DEAD box RNA helicase for HIV-1 Rev-RRE export function, Cell 119 (3) (2004) 381e392. [18] M. Baril, et al., Genome-wide RNAi screen reveals a new role of a WNT/ CTNNB1 signaling pathway as negative regulator of virus-induced innate immune responses, PLoS Pathog. 9 (6) (2013), e1003416. [19] T. Sueyoshi, T. Kawasaki, Y. Kitai, D. Ori, S. Akira, T. Kawai, Hu antigen R regulates antiviral innate immune responses through the stabilization of mRNA for polo-like kinase 2, J. Immunol. 200 (3814) (2018). [20] M. Murase, et al., Intravesicular acidification regulates lipopolysaccharide inflammation and tolerance through TLR4 trafficking, J. Immunol. 200 (2798) (2018). [23] P. Grandi, et al., Nup93, a vertebrate homologue of yeast Nic96p, forms a complex with a novel 205-kDa protein and is required for correct nuclear pore assembly, Mol. Biol. Cell 8 (10) (1997) 2017e2038. [24] D.A. Braun, et al., Mutations in nuclear pore genes NUP93, NUP205 and XPO5 cause steroid-resistant nephrotic syndrome, Nat. Genet. 48 (4) (2016) 457. [25] M. Beck, E. Hurt, The nuclear pore complex: understanding its function through structural insight, Nat. Rev. Mol. Cell Biol. 18 (2) (2017) 73. [26] A. Ibarra, M.W. Hetzer, Nuclear pore proteins and the control of genome functions, Genes Dev. 29 (4) (2015) 337e349. [27] K.E. Knockenhauer, T.U. Schwartz, The nuclear pore complex as a flexible and dynamic gate, Cell 164 (6) (2016) 1162e1171. [28] J.M. Cronshaw, A.N. Krutchinsky, W. Zhang, B.T. Chait, M.J. Matunis, Proteomic analysis of the mammalian nuclear pore complex, J. Cell Biol. 158 (5) (2002) 915e927. [29] G. Rabut, V. Doye, J. Ellenberg, Mapping the dynamic organization of the nuclear pore complex inside single living cells, Nat. Cell Biol. 6 (11) (2004) 1114e1121. [30] K. Zhang, et al., Stress granule assembly disrupts nucleocytoplasmic transport, Cell 173 (4) (2018) 958e971, e17. [31] Q. Wang, et al., The E3 ubiquitin ligase AMFR and INSIG1 bridge the activation of TBK1 kinase by modifying the adaptor STING, Immunity 41 (6) (2014) 919e933.
Please cite this article as: W. Monwan et al., Identification of nucleoporin 93 (Nup93) that mediates antiviral innate immune responses, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.035