Identification of paralogous genes of firefly luciferase in the Japanese firefly, Luciola cruciata

Gene 368 (2006) 53 – 60 www.elsevier.com/locate/gene

Identification of paralogous genes of firefly luciferase in the Japanese firefly, Luciola cruciata Yuichi Oba a , Mitsunori Sato a , Yuichiro Ohta a , Satoshi Inouye b,⁎ a

Graduate School of Bioagricultural Sciences, Nagoya University, Chikusa-ku, Nagoya 464-8601, Japan b Yokohama Research Center, Chisso Co., 5-1 Okawa, Kanazawa-ku, Yokohama 236-8605, Japan Received 2 August 2005; received in revised form 29 September 2005; accepted 9 October 2005 Avialable online 27 December 2005 Received by N. Saitou

Abstract Two homologous genes of firefly luciferase, LcLL1 and LcLL2, were cloned from the Japanese firefly Luciola cruciata, and were expressed and characterized. The gene product of LcLL1 had long-chain fatty acyl-CoA synthetic activity, but not luciferase activity. The other gene product of LcLL2 did not show enzymatic activities of acyl-CoA synthetase and luciferase. RT-PCR analysis showed that the transcript of LcLL1 was abundant in larva but very low in adult, while LcLL2 was expressed in both larva and adult. Phylogenetic analysis indicated that LcLL1 and LcLL2 are paralogous genes of firefly luciferase. Recently, we found that CG6178 in Drosophila melanogaster is an orthologue of firefly luciferase and shows fatty acyl-CoA synthetic activity, but not luciferase activity. These results suggest that firefly luciferase might be evolved from a fatty acylCoA synthetase by gene duplication in insects. © 2005 Elsevier B.V. All rights reserved. Keywords: Bioluminescence; CG6178; Evolution; Fatty acyl-CoA synthetase; Gene duplication

1. Introduction The bioluminescence reaction in firefly is catalyzed by luciferase (monooxygenase, [EC 1.13.12.7]) with firefly luciferin in the presence of ATP, Mg2+ and O2. The cDNA encoding luciferase was firstly isolated from North American firefly Photinus pyralis (de Wet et al., 1987) and then from the Japanese firefly Luciola cruciata (Masuda et al., 1989). At the present time, the genes of firefly luciferase have been cloned from over 14 Lampyridae species. However, the gene origin of firefly luciferase is not identified (Wood, 1995; Viviani, 2002). Recently, we have identified that firefly luciferase has two catalytic functions of luminescence and fatty acyl-CoA synthesis (Oba et al., 2003). Luciferases in P. pyralis and L. cruciata can catalyze the thioesterification of medium-chain Abbreviations: LcLL, Luciola cruciata luciferase-like gene; LcLuc, Luciola cruciata luciferase gene; NCR, non-coding region; ORF, open reading frame; PpLuc, Photinus pyralis luciferase. ⁎ Corresponding author. Tel.: +81 45 786 5518; fax: +81 45 786 5512. E-mail address: [email protected] (S. Inouye). 0378-1119/$ - see front matter © 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2005.10.023

(C10 to C14) and long-chain (C16 to C20) fatty acids to produce their fatty acyl-CoA in the presence of ATP, Mg2+ and CoA, like a fatty acyl-CoA synthetase ([EC 6.2.1.2] and [EC 6.2.1.3]) in mammals (Oba et al., 2005). We also found that CG6178, an orthologous gene of firefly luciferase in Drosophila melanogaster, is a fatty acyl-CoA synthetase, but not a luciferase (Oba et al., 2004). These results suggested that firefly luciferase might be evolved from fatty acyl-CoA synthetase in insects. It is known that fatty acyl-CoA synthetase plays an essential role in the fatty acid metabolism and is utilized both in biosynthesis of cellular lipids and in degradation via the β-oxidation system for energy production. In mammals, five isozymes of fatty acyl-CoA synthetase have been identified, showing that their substrate specificities and tissue distributions were different (Minekura et al., 2001). Four isozymes have been found in Saccharomyces cerevisiae (Johnson et al., 1994). It has been generally accepted that the gene duplication allows the evolutional chance to produce a novel function of gene (Ohno, 1970). Under these backgrounds, we predict that firefly may possess paralogous genes of firefly luciferase in its

54

Y. Oba et al. / Gene 368 (2006) 53–60

genome, and the paralogue should be a fatty acyl-CoA synthetase. Here we describe two paralogous genes of firefly luciferase in L. cruciata. Two genes have high sequence similarity to firefly luciferase, but their gene products did not give luminescence activity at all. One gene encodes a fatty acylCoA synthetase, but the other is functionally unknown.

luciferin, Nacalai Tesque, Kyoto, Japan); α-linolenic acid (NOF Corporation, Tokyo, Japan); lauric acid sodium salt (TCI, Tokyo, Japan); [1-14C]α-linolenic acid (53.7 mCi/mmol) and [α-32P]ATP (3000 Ci/mmol) (Perkin Elmer, Boston, MA); [1-14C]lauric acid (60.0 mCi/mmol) and [1-14C]oleic acid (56.0 mCi/mmol) (Amersham Biosciences, Buckinghamshire, UK).

2. Materials and methods

2.2. Molecular cloning of LcLL1 (L. cruciata luciferase-like gene 1), LcLL2 and LcLuc (L. cruciata luciferase gene) from L. cruciata

2.1. Experimental animals and materials Adults of L. cruciata were collected at Seki City, Gifu, Japan in June, 2003. The larvae were purchased from Hotaru Research Project Team (Hyogo, Japan). To confirm the species of L. cruciata, the nucleotide sequence (1.1 kb) of the mitochondrial ND5 gene for NADH dehydrogenase subunit 5 was determined, as previously described (Su et al., 1996). The species of adult was identified by 100% identity with that of L. cruciata (GenBank accession nos. AB052457, AB052493), and the larva showed 99.8% identity with that of L. cruciata (GenBank accession no. AB052537). The PCR reaction was carried out using DNA polymerase Ex Taq (Takara, Shiga, Japan) with a thermal cycler GeneAmp 9700 (Applied Biosystems, Foster City, CA). Synthetic oligonucleotide primers were obtained from Proligo (Boulder, CO). DNA sequence was determined with a genetic analyzer ABI PRISM 3100-Avant (Applied Biosystems) using BigDye terminator ver. 1.1 cycle sequencing kit (Applied Biosystems). The following materials were obtained from commercial sources: oleic acid sodium salt, palmitoleic acid and arachidonic acid sodium salt (SigmaAldrich, St. Louis, MO); D-luciferin sodium salt (firefly

Total RNA was extracted using SV Total RNA Isolation System (Promega, Madison, WI) and cDNA was constructed by M-MLV reverse transcriptase (Promega) with Oligo(dT)15 (Promega) as a primer. For cloning of a paralogous gene from L. cruciata, PCR procedures were performed using appropriate synthetic primers as listed in Table 1. The amplicons were cloned into pGEM-T Easy vector (Promega) and the nucleotide sequences were determined. To obtain the full length of cDNA, the RACE technique was carried out using SMART RACE cDNA amplification Kit (Clontech, Palo Alto, CA). The cDNA of complete open reading frame (ORF) was obtained by PCR using the primers, designed by 5′ end of 5′-RACE product and 3′ end of 3′-RACE product, with LA Taq polymerase (Takara) and anti-Taq high (Toyobo, Tokyo, Japan). (i) Cloning of LcLL1 from the anterior half of a larva of L. cruciata. Total RNA (1.7 μg) was prepared from the sample (wet weight 134 mg). PCR was carried out with primers of LH1 and LH3 (94 °C, 1 min; 42 °C, 1 min; 72 °C, 1 min; 35 cycles), and then nested PCR with primers

Table 1 PCR primers used in this study Name LH1 LH2 LH3 LH4 L1-1 L1-2 L1-3 L1-4 L1-5 L2-1 L2-2 L2-3 L2-4 Luc-1 Luc-2 L1-RTf L1-RTr L2-RTf L2-RTr Luc-RTf Luc-RTr RP49-f RP49-r a

Primer sequencesa 5′ GGW-WCH-ACY-GGN-YTN-CCN-AA 3′ 5′ ACY-GGN-YTN-CCN-AAR-GGN-GT 3′ 5′ AC-YTG-RTA-NCC-YTT-RTA-YTT 3′ 5′ TG-RTA-NCC-YTT-RTA-YTT-DAT 3′ 5′ A-ATA-GCC-TCC-ATT-TAT-GAT-AAT-TGC 3′ 5′ A-TAT-ATA-AAT-GAT-CCC-GAT-AGT-ACT 3′ 5′ GGC-GAT-GTG-GCT-TAT-TAT-GAT-G 3′ 5′ CGTCTCGAGATT-ATG-GAA-AAA-AAT-GT 3′ 5′ CCAATT-TTA-TAA-TTT-TGC-CC 3′ 5′ GC-TCC-GCC-TTC-TTT-AAT-ATG-TCG-TGC-GG 3′ 5′ G-AGT-TTG-GGT-CCG-TAC-GAA-ATT-GGT-GAG 3′ 5′ GGCTCGAG-ATG-CGA-ACT-GAA-GAT-AAT-A 3′ 5′ CGCAAAGTGTTAGTTACCAATAACT 3′ 5′ ACTCGAG-ATG-GAA-AAC-ATG-GAA-AAC-G 3′ 5′ AATTCA-CAT-CTT-AGC-AAC-TGG-TTT-C 3′ 5′ GGA-GTA-ATG-CTT-ACG-CAT-TT 3′ 5′ G-TAG-GTT-CAA-T/CT-GTT-AAC-T 3′ 5′ CC-GCA-CGA-CAT-ATT-AAA-GAA-G 3′ 5′ CG-AAC-ATT-TTT-GAT-GTT-TAA-T/TT-TTT-AAT-AAC 3′ 5′ A-GAT-CCG-ATT-TAT-GGT-AAC-C 3′ 5′ GGG-AAG-ATT-AAA-G/CG-TCT-AG 3′ 5′ CCGATCGTTATTGTAAACTAAAGAG 3′ 5′ CGATTTTGCATCATTAACACCTGCA 3′

Primer positionsb

Note for PCR c

G (202)∼K (208) T (204)∼V (210)c V (451)∼K (445)c Q (450)∼I (444)c S (221)∼A (213)d G (390)∼T (398)d G (411)∼E (418)d 5′NCR∼V (5)d 3′NCR∼R (533)d A (236)∼T (227)e K (380)∼E (389)e 5′NCR∼I(7)e 3′NCRe 5′NCR∼D (7)c 3′NCR∼K (524)c G(200)∼F(206)d Q (324)∼L (317)d T (227)∼G (234)e E (389)∼K (380)e R (225)∼Q (232)c P (436)∼A (430)c

LcLL1 and 2 fragments LcLL1 and 2 fragments LcLL1 and 2 fragments LcLL1 and 2 fragments 5′-RACE for LcLL1 3′-RACE for LcLL1 3′-RACE for LcLL1 LcLL1 for full-ORF LcLL1 for full-ORF 5′-RACE for LcLL2 3′-RACE for LcLL2 LcLL2 for full-ORF LcLL2 for full-ORF LcLuc for full-ORF LcLuc for full-ORF RT-PCR for LcLL1 RT-PCR for LcLL1 RT-PCR for LcLL2 RT-PCR for LcLL2 RT-PCR for LcLuc RT-PCR for LcLuc RT-PCR for Lc-rp49 RT-PCR for Lc-rp49

Abbreviations: H = A/C/T, N = A/C/G/T, R = A/G, W = A/T, Y = C/T. bSingle letter with number in parenthesis indicates the amino acid position in cLcLuc, dLcLL1 and LcLL2. Slashes indicate the putative splicing site. Underline refers to Xho I site. NCR, non-coding region; ORF, open reading frame.

e

Y. Oba et al. / Gene 368 (2006) 53–60

of LH2 and LH3 (94 °C, 1 min; 48 °C, 1 min; 72 °C, 1 min; 35 cycles). 5′-RACE was carried out with gene specific primer L1-1 and Universal Primer Mix (UPM Clontech) (94 °C, 1 min; 71–57 °C, 2 min; 30 cycles), the annealing and extension temperature was reduced by 0.5 °C for every cycles. The amplicon was diluted and used for nested 5′-RACE PCR with primer L1-1 and Nested Universal primer (NUP, Clontech) (94 °C, 1 min; 54 °C, 1 min; 72 °C, 2 min; 30 cycles). 3′-RACE was carried out with primers of L1-2 and UPM, and then nested 3′-RACE with primers of L1-3 and NUP. The PCR conditions were same as that of 5′-RACE and

55

nested 5′-RACE, respectively. The cDNA with complete ORF was generated by PCR with primers of L1-4 and L1-5 (94 °C, 1 min; 53 °C, 1 min; 72 °C, 2 min; 35 cycles). (ii) Cloning of LcLL2 from the whole body of a male adult of L. cruciata. Total RNA (39.5 μg) was prepared from the sample (wet weight 103 mg). PCR was carried out with primers of LH1 and LH4 (94 °C, 1 min; 40 °C, 1 min; 72 °C, 2 min; 35 cycles), and then nested PCR with primers of LH2 and LH3 (94 °C, 30 s; 40 °C, 30 s; 72 °C, 2 min; 35 cycles). 5′-RACE was carried out with primers of L2-1 and UPM (94 °C, 1 min; 72–66

Fig. 1. Comparison of the amino acid sequences deduced from LcLL1, LcLL2, LcLuc and CG6178. The identical amino acids in three or four species are shown with black shading. Double arrows represent the regions for PCR primers of LH1, LH2, LH3 and LH4. The amino acid sequence of LcLuc is from GenBank accession no. M26194. The numbers on the right margin refer to the position of amino acid residues.

56

Y. Oba et al. / Gene 368 (2006) 53–60

Table 2 Comparison of paralogous and orthologous proteins with firefly luciferase Proteins

LcLuc LcLL1 LcLL2 PpLuc CG6178 a

Numbers of A.A. (C-terminal seq.) 548 (−AKM) 548 (−AKM) 536 (−AKL) 545 (−SKL) 550 (−SKL) 544 (−SKL)

Calculated values a Mass

pI

59,904 60,017 59,842 61,189 60,745 59,939

6.74 7.07 9.09 7.78 6.42 8.26

GenBank acc. no. AB220162 M26194 AB196455 AB196456 AAA29795 NM_142964

Calculated from ExPASy web (http://au.expasy.org/tools/pi_tool.html).

°C, 2 min; 30 cycles), the annealing and extension temperature was reduced by 0.2 °C for every cycles. The amplicon was diluted and used for nested 5′RACE PCR with primers of L2-1 and NUP by the same PCR condition. 3′-RACE was carried out with primers of L2-2 and UPM, and then nested 3′-RACE with primers of L2-2 and NUP. The PCR conditions were same as that of 5′-RACE. The cDNA with complete ORF was generated by PCR with primers of L2-3 and L2-4 (94 °C, 30 s; 53 °C, 30 s; 72 °C, 2 min; 28 cycles). (iii) Cloning of LcLuc from the posterior half of a larva of L. cruciata. Total RNA (7.3 μg) was prepared from the sample (wet weight 108 mg). The cDNA with complete ORF was generated by PCR with primers of Luc-1 and Luc-2 (94 °C, 1 min; 47 °C, 1 min; 72 °C, 2 min; 30 cycles). 2.3. Expression of LcLL1, LcLL2 and LcLuc and partial purification The ORF of cDNA for LcLL1, LcLL2 and LcLuc amplified by PCR procedures was digested and inserted into Xho I/Pst I site of pTrcHisA expression vector (Invitrogen, Carlsbad, CA) to give pTrcHis-LcLL1, pTrcHis-LcLL2 and pTrcHis-LcLuc, respectively. The expression plasmid was transformed in Escherichia coli strain BL21 (Novagen, Madison, WI) and the purification of His-tagged protein was performed using Ni-chelate affinity chromatography, as previously described (Oba et al., 2004) with some modifications as follows; the strains were grown in 0.9 L of Luria–Bertani broth at 20 °C instead of 25 °C. His·Bind Resin (ϕ 8 × 10 mm, Novagen) was utilized for chromatography, and the bound proteins were eluted by stepwise with 10 ml of 5, 20 and 300 mM imidazole in buffer. The eluted fraction by 300 mM imidazole was concentrated with an Amicon Centriplus YM-50 (Millipore, Billerica, MA). 2.4. SDS-PAGE and Western blot analysis SDS-PAGE was carried out using a 12.5% separation gel by the method of Laemmli (1970) and the gel was stained with Quick CBB (Wako, Osaka, Japan). For Western blot analysis, the separated proteins were electrotransfered onto a polyvinyliden difluoride membrane Immobilon-P (Millipore, Billerica,

MA) and reacted with QIAexpress Penta-His antibody (Qiagen, Hilden, Germany). The specifically bound antibody was visualized by treatment with alkaline phosphatase conjugated anti-mouse IgG (Promega) with nitro blue tetrazolium chloride (Wako) and 5-bromo-4-chloro-3-indolyl phosphate disodium salt 1.5-hydrate (Wako). 2.5. Luminescence assay The reaction mixture (100 μl) contained firefly luciferin (10 μM), ATP (250 μM), CoA (250 μM), MgCl2 (5 mM) and the enzyme in 100 mM Tris–HCl (pH 7.0). The reaction was started by the addition of enzyme at 22–23 °C. The light intensity (Imax) of luminescence activity was determined with a luminometer model AB-2200 (Atto, Tokyo, Japan). The detection limit of the luminometer was 1 pg of recombinant aequorin (4.8 × 1015 photons/mg protein). 2.6. Detection of fatty acyl-CoA The reaction mixture (20 μl) contained 14C-labeled fatty acid (10 μM: [1-14C]lauric acid, 12.0 nCi; [1-14C]oleic acid, 11.1 nCi; [1-14C]α-linolenic acid, 10.8 nCi), ATP (250 μM) CoA (250 μM), MgCl2 (5 mM) and the enzyme in 100 mM Tris–HCl (pH 7.0). The final concentrations of His-LcLL1, His-LcLL2 and His-LcLuc in the reaction mixtures were approximately 1.25 nM. After incubation for 2 h at 25 °C, the reaction was terminated by addition of 20 μl of ethanol and 6 μl was developed on a TLC plate (Silica gel 60 F254, Merck, Whitehouse Station, NJ) in 1,4-dioxane / ammonium hydroxide / water (3 : 0.5 : 2). Rf values of lauroyl-CoA, oleoylCoA and α-linolenoyl-CoA were 0.36, 0.39 and 0.35, respectively, and their radioactivities were measured on imaging analyzer BAS 2500 (Fuji film, Tokyo, Japan). For determination of pH dependency, 100 mM acetate–NaOH (pH 4.0), 100 mM MES–NaOH (pH 5.2, 6.3), 100 mM Tris– HCl (pH 7.0–9.4) and Glycine–NaOH (pH 10.2) buffers were used. 2.7. Substrate specificity of LcLL1 and LcLL2 To characterize the substrate specificity of LcLL1, the released AMP from ATP was determined by TLC analysis. A reaction mixture (20 μl) contained [α-32P]ATP (0.33 μCi, 5.6 nM), ATP (100 μM), CoA (250 μM), MgCl2 (5 mM), Table 3 Sequence identities of amino acid and nucleotide sequences among LcLuc, LcLL1, LcLL2, PpLuc and CG6178

LcLuc LcLL1 LcLL2 PpLuc CG6178

LcLuc

LcLL1

LcLL2

PpLuc

CG6178

– 53.9 58.0 66.5 47.1

40.7 – 55.2 50.9 48.8

45.7 43.9 – 55.1 50.3

67.5 40.1 45.1 – 47.9

40.1 39.0 40.9 40.8 –

Upper diagonal shows % identity of amino acids. Lower diagonal shows % identity of nucleotides.

Y. Oba et al. / Gene 368 (2006) 53–60

57

substrate (10 μM) and His-LcLL1 or His-LcLL2 (1.25 nM) in 100 mM Tris–HCl (pH 7.0). After incubation for 1 h at 25 °C, the reaction was terminated by addition 20 μl of ethanol and 2 μl was spotted on a TLC plate. First development was in 1,4-dioxane / 50 mM acetic acid (4 : 1), followed by second development in 1,4-dioxane / ammonium hydroxide / water (6 : 1 : 5). The radioactivity of 32P-AMP (Rf = 0.51) was measured with BAS 2500. The relative intensity was obtained by subtracting the background value without substrate. 2.8. Phylogenetic analysis Amino acid sequences were acquired from NCBI Database (http://www.ncbi.nlm.nih.gov/) and FlyBase (http://flybase.bio. indiana.edu/). The multiple alignments of 27 amino acid sequences were obtained by the program Clustalx-1.83.1 (Thompson et al., 1997). The BLOSUM was selected for the protein weight matrix. All sites containing gap were excluded, and 412 characters were included for analysis. A phylogenetic tree was constructed by the neighbor-joining method (Saitou and Nei, 1987) using the program PAUP*4.0beta10 (Swofford, 2003). 2.9. RT-PCR Total RNA (2 μg) prepared from a larva and an adult of L. cruciata was converted to cDNA and the specific primers for LcLL1, LcLL2 and LcLuc (Table 1) were used for gene

Fig. 3. SDS-PAGE and Western blot analyses of LcLL1, LcLL2 and LcLuc. Panel A: SDS-PAGE of partially purified His-LcLL1 (lane 1), His-LcLL2 (lane 2), control preparation from BL21 cells with pTrcHisA (lane 3) and purified HisLcLuc (lane 4). Lane M shows the size maker (Protein marker II wide range, Tefco, Tokyo, Japan). Panel B: Western blot analysis with anti-His6 antibody in panel A. Lane numbers are same as in panel A.

amplifications. As an internal control, the gene of ribosomal protein rp49 in L. cruciata (Lc-rp49, GenBank accession no. AB205198) was amplified with the primers of RP49-f and RP49-r (Table 1). For the positive control, each plasmid containing ORF of LcLL1, LcLL2 and LcLuc was used. PCR conditions were as follows: denaturing at 94 °C for 30 s; annealing at 50 °C (LcLL1), 56 °C (LcLL2 and LcLuc), and 52 °C (Lc-rp49) for 30 s; extension at 72 °C for 30 s; cycle

Fig. 2. Phylogenetic analysis of firefly luciferases and their similar genes. Numbers on the nodes indicate % bootstrap values from 10,000 replicates. Horizontal branch lengths show the genetic distances. GenBank accession number is shown in parenthesis.

58

Y. Oba et al. / Gene 368 (2006) 53–60

Table 4 Luminescence activity in LcLL1 and LcLL2 Protein a

His-LcLL1 His-LcLL2 His-LcLuc Control c None a b c

− CoA

+CoA

Imax (rlu/s)

Integrated (rlu) b

Imax (rlu/s)

Integrated (rlu) b

6 7 4167 8 5

6.4 × 102 9.4 × 102 2.1 × 106 1.5 × 103 5.7 × 102

7 7 5534 7 5

4.1 × 102 8.1 × 102 2.7 × 106 9.5 × 102 8.1 × 102

Approx. 0.1 pmol of the protein was used for assay. Light emission was integrated for 0 to 60 s. Control preparation from BL21 cells with pTrcHisA.

numbers were 45 for LcLL1, 35 for LcLL2 and LcLuc and 25 for Lc-rp49, respectively. 3. Results 3.1. Isolation of paralogous genes of firefly luciferase from L. cruciata To clone a paralogous gene of firefly luciferase from L. cruciata, RT-PCR procedures were performed. The PCR primers (LH1, LH2, LH3 and LH4 in Table 1) were designed from the conserved amino acid sequences between firefly luciferase and CG6178 of D. melanogaster (arrows in Fig. 1), and the homologous gene fragments from adults and larvae were isolated. The complete cDNA was obtained by the method of RACE-PCR procedures. The cDNAs isolated from the anterior half of larva and whole body of adult of L. cruciata were assigned to ‘LcLL1‘ (L. cruciata luciferase-like gene 1) and ‘LcLL2’, respectively. The luciferase cDNA of L. cruciata (LcLuc, GenBank accession no. AB220162) was also isolated from a posterior half of a larva by PCR procedures, and showed 13 nucleotide substitutions with 5 amino acid differences (K149Q, E273G, K372S, S465N and N494S) comparing with firefly luciferase (GenBank accession no. M26194) reported by Masuda et al. (1989). The amino acid sequences of gene products of LcLL1 and LcLL2 were compared with that of LcLuc, PpLuc (P. pyralis luciferase) and CG6178 (Table 2). The homology and phylogenetic analyses of amino acid sequences were carried out and summarized in Table 3 and Fig. 2. LcLL1 and LcLL2 possess

Fig. 5. Substrate specificity of LcLL1 for carboxylic acids. Fatty acyl-CoA synthetic activity of His-LcLL1 was determined by the formation of AMP from ATP as described in Section 2.7. The data represents the means ± SEM for triplicate determinations. Relative activity is expressed as a percentage with respect to α-linolenic acid. Abbreviations: C12:0, lauric acid; C16:1n-9c, palmitoleic acid; C18:1n-9, oleic acid; C18:3n-3, α-linolenic acid; C20:4n-6, arachidonic acid; luciferin, firefly luciferin.

a peroxisomal targeting signal sequence at the C-terminus (Neuberger et al., 2003a,b) as same as beetle luciferases and CG6178 (Oba et al., 2005). 3.2. Expression and preparation of LcLL1, LcLL2 and LcLuc To characterize LcLL1, LcLL2 and LcLuc, the Histagged proteins were expressed in E. coli cells. As the expression level of His-LcLL1 and His-LcLL2 was very low, crude extracts of the expressed proteins were partially purified by Ni-chelate affinity chromatography. The expressed proteins were analyzed on SDS-PAGE and identified by Western blot analysis using anti-His6 antibody (Fig. 3, lane 1 and lane 2). Under same procedures, HisLcLuc was purified homogenously (Fig. 3A, lane 4). The protein concentrations of His-LcLL1, His-LcLL2 and HisLcLuc were estimated by the intensity on Western blot analysis with anti-His6 antibody. The ratios of concentration of His-LcLL1, His-LcLL2 and His-LcLuc were approximately 1 : 20 : 1500, respectively. By comparing with the intensity of PpLuc (Promega) stained by Coomassie brilliant blue, the concentration of purified His-LcLuc was estimated to be 7.6 μM. In this preparation, the concentrations of HisLcLL1 and His-LcLL2 were approximately 5 and 100 nM,

Fig. 4. Detection of 14C-fatty acyl CoA from various fatty acids produced by LcLL1, LcLL2 and LcLuc by TLC. Fatty acids: panel A, [1-14C]lauric acid; panel B, [1-14C]oleic acid; panel C, [1-14C]α-linolenic acid. Proteins: lane 1, His-LcLL1; lane 2, His-LcLL2; lane 3, His-LcLuc; lane 4, control preparation. The arrow in autoradiography indicates the position of fatty acyl-CoA produced from fatty acid.

Y. Oba et al. / Gene 368 (2006) 53–60

Fig. 6. Detection of transcripts of LcLL1, LcLL2 and LcLuc by RT-PCR analysis. Template DNA: lane 1, cDNA from a larva; lane 2, cDNA from an adult; lane 3, genomic DNA; lane 4, the plasmid containing LcLL1; lane 5, the plasmid containing LcLL2; lane 6, the plasmid containing LcLuc. Lane M indicates molecular maker. The RT-PCR conditions were described in Section 2.9 and Lcrp49 is amplified as a control. The primer set used for amplification was shown in Table 1.

59

To detect fatty acyl-CoA synthetic activity, 14C-labeled fatty acids including lauric acid, oleic acid and α-linolenic acid as a substrate were reacted with His-LcLL1 and His-LcLL2 in the presence of ATP, CoA and Mg2+. The enzymatic products were analyzed by TLC and identified as 14C-labeled fatty acyl-CoA. As the results, His-LcLL1 exhibited significant fatty acyl-CoA synthetic activity with fatty acids, but His-LcLL2 did not show any detectable activity of fatty acyl-CoA synthesis (Fig. 4). The optimal pH of His-LcLL1 (1.25 nM) for fatty acyl-CoA synthesis was determined to be 7–7.5, and His-LcLL2 (25 nM) did not show any activity between pH 4–10 (data not shown). The substrate specificity of His-LcLL1 was examined using various carboxylic compounds in the presence of [α-32P]ATP, CoA and Mg2+. After enzymatic reaction, 32P-AMP derived from [α-32P]ATP was separated and quantified. The fatty acylCoA synthetic activity for medium- and long-chain fatty acids including lauric acid, palmitoleic acid, oleic acid, α-linolenic acid and arachidonic acid were detected, but acetic acid and firefly luciferin were not utilized as a substrate (Fig. 5). Thus, LcLL1 was classified as a fatty acyl-CoA synthetase with suitable substrates for C16 to C18 fatty acids. On the other hand, His-LcLL2 (25 nM) did not show any fatty acyl-CoA synthetic activity in this assay (data not shown).

respectively. The partially purified proteins were used for following enzymatic assays.

3.4. Gene expression of LcLL1, LcLL2 and LcLuc in larva and adult

3.3. Determination of luminescence activity and fatty acyl-CoA synthetic activity

To investigate the gene expression of LcLL1, LcLL2 and LcLuc in larva and adult of L. cruciata, RT-PCR with specific primers were performed (Fig. 6). As the gene expression of rp49 in D. melanogaster is constant through the development (O'Connell and Rosbash, 1984), rp49 in L. cruciata (Lc-rp49) was chosen for an internal control. The expression levels of LcLL1 and LcLuc were abundant in larva but were very low in adult. While the LcLL2 expression was abundant in both larva and adult.

Under luminescence conditions of firefly luciferin, ATP, and Mg2+, no detectable luminescence was observed in His-LcLL1 and His-LcLL2, in the presence or absence of CoA. On the other hand, His-LcLuc gave significant luminescence activity (Table 4). Thus, LcLL1 and LcLL2 were not an enzyme catalyzing the luminescence reaction with firefly luciferin.

Fig. 7. Schematic representation of evolutional process of firefly luciferase from ancestral fatty acyl-CoA synthetase.

60

Y. Oba et al. / Gene 368 (2006) 53–60

4. Discussion It is hypothesized that gene duplication allows a gene to obtain novel function. If one copy of a gene keep the original function, the duplicate becomes free to accumulate mutation (Ohno, 1970; Zhang, 2003). Recently, genome sequences in various organisms have been reported and many duplicated genes were found in all organisms (Taylor and Raes, 2004). Our previous investigations suggested that firefly luciferase might be evolved from a fatty acyl-CoA synthetase in insect (Oba et al., 2003, 2004, 2005). If our hypothesis is acceptable, the paralogous genes of firefly luciferase may be present in firefly and the gene product probably has a fatty acyl-CoA synthetic activity. In this study, we cloned two homologous genes of firefly luciferase from the Japanese firefly L. cruciata and assigned LcLL1 and LcLL2 (Fig. 1). Phylogenetic analysis indicated that LcLL1 and LcLL2 have higher similarity to the gene of LcLuc than CG6178 in D. melanogaster, and are not the allelic or geological variant of LcLuc (Fig. 2). Thus, LcLL1 and LcLL2 are paralogous genes of firefly luciferase and may be derived from gene duplication before the luminous beetle was diverged (Fig. 2). To characterize the enzymatic properties of LcLL1 and LcLL2, the genes were expressed in E. coli and the partial purified proteins were used for determination of luminescence activity (Table 4) and acyl-CoA synthetic activity (Figs. 4 and 5). Both LcLL1 and LcLL2 did not show luminescence activity at all, and LcLL1 only gave significant activity of acyl-CoA synthesis from fatty acids, especially long-chain fatty acids (C16:1, C18:1 and C18:3). The substrate specificity of LcLL1 is different from that of firefly luciferase, which is suitable for medium-chain fatty acids (C12) (Oba et al., 2005). The function of LcLL2 is unknown. To investigate the gene expression of LcLL1, LcLL2 and LcLuc in firefly, RT-PCR with specific primers was performed using larva and adult (Fig. 6). As the results, LcLL1 is expressed predominantly in larva than in adult, and LcLL2 is in both larva and adult. This suggested that LcLL1 and LcLL2 might be functional genes. Interestingly, the gene expression of LcLuc in adult was very low, in spite of showing their strong luminescence intensity. In conclusion, based on our analyses of paralogous gene cloned from L. cruciata, we propose the evolutional process of firefly luciferase in insect as follows (Fig. 7): (i) A gene of fatty acyl-CoA synthetase in an ancestral insect is duplicated to give several paralogous genes. (ii) One of paralogous genes acquires luciferase (oxygenase) activity with maintaining fatty acyl-CoA synthetic activity (LcLuc). (iii) Other paralogues inherit a fatty acyl-CoA synthetic activity (LcLL1), acquire a different catalytic activity (LcLL2?) or become a pseudogene. Acknowledgments We are grateful to Prof. M. Ojika for his interest and encouragement in this work. This work was supported in part by

a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan (to Y.O.), and in part by the Program for Promotion of Fundamental Studies in Health Science of the Pharmaceutical and Medical Devices Agency (PMDA) of Japan (to S.I.). References de Wet, J.R., Wood, K.V., DeLuca, M., Helinski, D.R., Subramani, S., 1987. Firefly luciferase gene: structure and expression in mammalian cells. Mol. Cell. Biol. 7, 725–737. Johnson, D.R., Knoll, L.J., Levin, D.E., Gordon, J.I., 1994. Saccharomyces cerevisiae contains four fatty acid activation (FAA) genes: an assessment of their role in regulating protein N-myristoylation and cellular lipid metabolism. J. Cell Biol. 127, 751–762. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Masuda, T., Tatsumi, H., Nakano, E., 1989. Cloning and sequence analysis of cDNA for luciferase of a Japanese firefly, Luciola cruciata. Gene 77, 265–270. Minekura, H., et al., 2001. Genomic organization and transcription units of the human acyl-CoA synthetase 3 gene. Gene 278, 185–192. Neuberger, G., Maurer-Stroh, S., Eisenhaber, B., Hartig, A., Eisenhaber, F., 2003a. Motif refinement of the peroxisomal targeting signal 1 and evaluation of taxon-specific differences. J. Mol. Biol. 328, 567–579. Neuberger, G., Maurer-Stroh, S., Eisenhaber, B., Hartig, A., Eisenhaber, F., 2003b. Prediction of peroxisomal targeting signal 1 containing proteins from amino acid sequence. J. Mol. Biol. 328, 581–592. Oba, Y., Ojika, M., Inouye, S., 2003. Firefly luciferase is a bifunctional enzyme: ATP-dependent monooxygenase and a long chain fatty acyl-CoA synthetase. FEBS Lett. 540, 251–254. Oba, Y., Ojika, M., Inouye, S., 2004. Characterization of CG6178 gene product with high sequence similarity to firefly luciferase in Drosophila melanogaster. Gene 329, 137–145. Oba, Y., Sato, M., Ojika, M., Inouye, S., 2005. Enzymatic and genetic characterization of firefly luciferase and Drosophila CG6178 as a fatty acylCoA synthetase. Biosci. Biotechnol. Biochem. 69, 819–828. O'Connell, P., Rosbash, M., 1984. Sequence, structure, and codon preference off the Drosophila ribosomal protein 49 gene. Nucleic Acid Res. 12, 5495–5513. Ohno, S., 1970. Evolution by Gene Duplication. Springer-Verlag, NY. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Su, Z.-H., Ohama, T., Okada, T.S., Nakamura, K., Ishikawa, R., Osawa, S., 1996. Phylogenetic relationships and evolution of the Japanese Carabinae ground beetles based on mitochondrial ND5 gene sequences. J. Mol. Evol. 42, 124–129. Swofford, D.L., 2003. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts. Taylor, J.S., Raes, J., 2004. Duplication and divergence: the evolution of new genes and old ideas. Annu. Rev. Genet. 38, 615–643. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876–4882. Viviani, V.R., 2002. The origin, diversity, and structure function relationships of insect luciferases. Cell. Mol. Life Sci. 59, 1833–1850. Wood, K.V., 1995. The chemical mechanism and evolutionary development of beetle bioluminescence. Photochem. Photobiol. 62, 662–673. Zhang, J., 2003. Evolution by gene duplication: an update. Trends Ecol. Evol. 18, 292–298.