Identification of potential markers and sensitive tissues for low or high salinity stress in an intertidal mud crab (Macrophthalmus japonicus)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54

YFSIM3135_proof ■ 20 September 2014 ■ 1/10

Fish & Shellfish Immunology xxx (2014) 1e10

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Identification of potential markers and sensitive tissues for low or high salinity stress in an intertidal mud crab (Macrophthalmus japonicus) Q5 Q1

Chamilani Nikapitiya a, b, Won-Seok Kim b, Kiyun Park b, Ihn-Sil Kwak b, * a b

Q2

Department of Aqualife Medicine, Chonnam National University, Chonnam 550-749, Republic of Korea Faculty of Marine Technology, Chonnam National University, Chonnam 550-749, Republic of Korea

a r t i c l e i n f o

a b s t r a c t

Article history: Received 27 March 2014 Received in revised form 26 August 2014 Accepted 10 September 2014 Available online xxx

Macrophthalmus japonicus is an intertidal mud crab is an ecologically important species in Korea, can tolerate a wide range of natural and anthropogenic stressors. Environmental changes especially salinity cause physiological stress to the marine habitats. Differential gene transcription of M. japonicus tissues provided information about tissue specific responses against salinity. Five potential genes were identified and their transcription levels were determined quantitatively comparison to seawater (SW: 31 ± 1 psu) in M. japonicus gills and hepatopancreas after exposed them to different salinities. Ecdysteroid receptor (Mj-EcR), trypsin (Mj-Tryp), arginine kinase (Mj-AK), lipopolysaccharide and b-1,3-glucan binding protein (Mj-LGBP) and peroxinectin (Mj-Prx) in hepatopancreas up-regulated against different salinities. In contrast, the gills, Mj-EcR, Mj-Tryp and Mj-AK showed late up-regulated responses to 40 psu compared to SW. All genes except Mj-LGBP showed up regulation in the gills as time dependent manner. These genes can be considered as potential markers to assess responses in salinity changes. This study suggests hepatopancreas is a suitable tissue for transcriptional, biochemical and physiological responses analysis on M. japonicus in low and high salinity stress.

Keywords: Arginine kinase Ecdysteroid receptor LGBP Macrophthalmus japonicas Peroxinectin Salinity change Trypsin

© 2014 Elsevier Ltd. All rights reserved.

1. Introduction Variations in the surrounding environment provide an important control on the distribution and abundance of aquatic habitat especially in estuarine environments, which is the transitional region between fresh and ocean environments. The response of coastal and estuaries environment is driven by one of the fundamental environmental factors, salinity, which affects the living organism's physiology [42]. Salinity could be changed in responses to the sea level rise due to global warming, ocean acidification, and to changes in the amount and timing of the fresh water delivery [45]. In Korea, estuarine systems show remarkable degree of environmental variations; therefore, daily average of salinity may differ by several percentages within few kilometers in marine environment. However, the consequences of the variations in the salinity environments in estuarine and coastal systems are not well exploited. The changes in the environmental conditions are reported to cause physiological, metabolic and immunological changes and develop stress to the aquatic animals [2,12,14,58]. For stress

* Corresponding author. Tel.: þ82 61 6597148; fax: þ82 61 6597149. E-mail address: [email protected] (I.-S. Kwak).

management of living organisms, studying the changes in gene expression has been an important component [2,28,39,40,50,64]. Over the past decades, molecular approaches (e.g. gene library construction, next generation sequencing, transcriptome analysis, gene expression profiling, microarray) have facilitated the investigation of thousands of genes expression patterns in response to environmental challengers, which allows the basic tools for identification of the molecular mechanism underlying these responses [56]. Intertidal mud crab (Macrophthalmus japonicus) belongs to Phylum Arthropoda; sub phylum Crustacea; order Decapoda, is distributed widely in Indo-Pacific region and dominantly in Japan [25], including Korea. Apart from its commercial importance, this species is an important component of the estuarine and bay ecosystems and can be used as sensitive indicator over a number of environmental changes. M. japonicus, which is relatively large (up to 35 mm carapace width) and one of the most abundant macrobenthos, is also a burrowing species that inhabit muddy tidal flats [38]. Therefore, M. japonicus is particularly a good model organism for understanding the changes of different environmental conditions (temperature, salinity, dissolved oxygen content, sediment toxicant contaminant levels etc.) in both coastal as well as estuarine systems.

http://dx.doi.org/10.1016/j.fsi.2014.09.018 1050-4648/© 2014 Elsevier Ltd. All rights reserved.

Please cite this article in press as: Nikapitiya C, et al., Identification of potential markers and sensitive tissues for low or high salinity stress in an intertidal mud crab (Macrophthalmus japonicus), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.09.018

55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3135_proof ■ 20 September 2014 ■ 2/10

2

C. Nikapitiya et al. / Fish & Shellfish Immunology xxx (2014) 1e10

Salinity affects the living organism's physiology. In aquatic organisms, osmoregulatory adaptive mechanisms have been developed in order for them to survive in different salinity conditions. Several reports on the cellular and molecular responses of osmoregulatory enzymes and transport proteins of teleost and crustaceans gills have been published under acute and long term salinity stress conditions [6,7,12,16,46] however, high salinity exposure conditions have rarely been reported. Recently, transcriptome analysis of the gills of the swimming crab, Portunus trituberculatus, against salinity stress using Illumina Deep Sequencing technology has been reported [36]. Expression patterns of the three conditions of salinity exposure (optimal; 33 ppt, low; 5 ppt and high; 50 ppt seawater) has been compared to understand the salinity stress and identify the genes involved in osmoregulation of the swimming crab. No or very little information is available about the variations in gene expressions related to salinity tolerance in M. japonicus. We hypothesize intertidal M. japonicus will provide good model organism to study underlining physiological, biochemical and immunological gene regulatory pathways related to different environmental changes and indicative organism for the changes in the salinity in benthic environment. In this study, five candidate genes (ecdysteroid receptor; Mj-EcR, arginine kinase; Mj-AK, trypsin; Mj-Tryp, lipopolysaccharide and b1,3-glucan binding protein; Mj-LGBP and peroxinectin; Mj-Prx) have been selected from M. japonicus based on the previously published works related to salinity exposure in other crustacean species [12,23,31] to investigate M. japonicus transcriptional responses after exposed to different salinity conditions experimentally. Further, we investigated the M. japonicus survival against different salinity conditions. This research will provide insights into identify potential markers of M. japonicus associated with low or high salinity conditions. Consequently, it will be useful to predict the possible impact of salinity changes on the aquatic environment.

before exposed to different salinity conditions in ASW for tissue distribution analysis studies. Three animals were subjected to tissue extraction for each time intervals in each salinity exposure conditions as well as SW exposed crabs used for tissue distribution analysis. Sampled tissues were snap frozen in liquid nitrogen and were stored at 80  C until taken for RNA isolation. Throughout the experiment, water temperature, salinity, dissolve oxygen (DO) were measured daily for all the treatments. 2.3. RNA extraction and cDNA synthesis Total RNA was extracted from the gills and hepatopancreas of each treatment and control group (25e30 mg/crab) using the TRIzol® reagent (Life technologies, USA) according to manufactures protocol. RNA was further treated by Recombinant DNase I (RNase free) (TaKaRa, Japan) to remove genomic DNA contamination. RNA was quantified using a NanoDrop-1000 (Thermoscientific, USA) and the concentration was adjusted to the same using nuclease free water. RNA integrity was checked by 1.2% agarose gel electrophoresis, and aliquots of the samples were stored at 80  C. One microgram of the total RNA from Gill and hepatopancreas was used as a template to synthesize cDNA using PrimeScript™ 1st strand cDNA Synthesis Kit (TaKaRa, Japan) according to manufactures protocol. Briefly, 1 mg of RNA was added to the 10 mL of reaction mixture containing 1 mL of oligo dT primer (50 mM), 1 mL of dNTP mixture (10 mM) with nuclease free water as a remaining. Then, the samples were incubated at 65  C for 5 min and cooled immediately on ice. Then, that mixture was added to reaction mixture containing 4 mL of 5 PrimeScript buffer, 0.5 mL of RNase inhibitor (20 units), 1.0 mL of PrimerScript RTase (200 units) and 4.5 mL of RNase free water to become the total volume of 20 mL. The mixture was incubated at 42  C for 1 h, and then at 95  C for 5 min, and cooled to 4  C. The synthesized cDNA was diluted to 30-fold and was stored at 20  C until used.

2. Materials and methods 2.1. Experimental M. japonicus maintenance Hundred and eighty four adult crabs (weight: 8.0 g ± 2.0; width: 3 cm ± 0.5; Height: 2.5 cm ± 0.5) were obtained from the local fish market in Yeosu on September 2013 and transported to the laboratory of Marine technology, Chonnam National University. The crabs were acclimatized to laboratory culture conditions for one day in natural sea water tanks (1800  1400  1200 ) with aeration at 16 ± 1  C. Crabs were fed with a small amount (approx. 200 mg) of Tetramin (Tetra-Werke, Melle, Germany) daily. 2.2. Salinity exposure experiments Crabs were divided into four groups (n ¼ 46) and then, each group was again divided into two groups (n ¼ 23). Out of the two groups (from each four groups), one set was kept to determine the survival percentage exposed to each different salinity conditions for 14 days. Second set was kept for tissue sampling for RNA extraction at different time intervals (day 1, 4, and 7) post salinity exposure conditions mentioned below. The four salinity exposure conditions used were 10 psu in artificial sea water (ASW), 25 psu in ASW and 40 psu in ASW and sea water (SW) (31 ± 1 psu). The ASW was prepared by dissolving Instant Ocean® Aquarium Sea Salt mixture (Instant Ocean, France) in tap water to obtain required salinity. The mortality was checked daily up to 14 days post salinity exposure and cumulative survival percentage was determined. Gills and hepatopancreas tissue were extracted from all the time points mentioned above. Gills, hepatopancreas, muscle, heart, stomach and gonad were extracted from the crabs where exposed to SW,

2.4. Transcriptional analysis of M. japonicus candidate genes by quantitative real time polymerase chain reaction (qRT-PCR) In this study, Mj-EcR, Mj-AK, Mj-Tryp, Mj-LGBP and Mj-Prx transcriptional responses were investigated by qRT-PCR after exposed to different salinity conditions experimentally. Due to the absence of prior sequence knowledge for M. japonicus, GS-FLX transcriptome data base has been generated previously from the M. japonicus whole body by our laboratory in order to investigate markers against various environment factors (un-published, manuscript in preparation). It provided us to identify list of gene candidates that previously reported for other arthropods especially to other crustaceans which could be associated with salinity changes in M. japonicus. Hence, M. japonicus homologue genes for particular interest were identified by the screening of this M. japonicus GS-FLX transcriptome data base. Gene specific primers were designed based on the full or partial coding sequences of those 5 candidate genes using primer3 software. Three candidate housekeeping (an internal reference) genes (glyceraldehyde-3phosphate dehydrogenase; Mj-GAPDH, b-actin; Mj- b-actin, elongation factor a1; Mj-Efa) were selected and their respective gene specific primers were designed to find the best housekeeping gene. Table 1 shows all the gene names, accession numbers and primer sequences used in this study. qRT-PCR was carried out using the Accuprep®2x Greenstar qPCR Master Mix (Bioneer, Korea) in a 20 mL reaction volume containing 3 mL of 30-fold diluted original cDNA, 10 mL of 2x SYBR, 0.5 mL of each forward and reverse primer (10 mM), and 6.0 mL DEPC-treated water, by Exicycler™96 (Bioneer, Korea). The qRT-PCR cycling protocol was as follows: one cycle of 95  C for 10 min, amplification for 40 cycles (95  C; 15 s, 60  C; 45 s),

Please cite this article in press as: Nikapitiya C, et al., Identification of potential markers and sensitive tissues for low or high salinity stress in an intertidal mud crab (Macrophthalmus japonicus), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.09.018

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3135_proof ■ 20 September 2014 ■ 3/10

C. Nikapitiya et al. / Fish & Shellfish Immunology xxx (2014) 1e10

Q4

2.5. Statistical analysis

Table 1 Primers used in the real-time PCR amplification. Name

Accession number

Primer sequence (50 -30 )

Mj-EcR 1F Mj-EcR 2R Mj-AK 3F Mj-AK 4R Mj-LGBP 5F Mj-LGBP 6R Mj-Tryp 7F Mj-Tryp 8F Mj-Prx 9F Mj-Prx 10R Mj-GAPDH 11F Mj-GAPDH12R Mj-b-actin 13F Mj-b-actin 14R Mj-Efa 15F Mj-Efa-16R

KJ653258

GGACGAGATGACATGTCCCC CTTCTTCTTGAGGTCGCCGT TACGACATCTCCAACAAGCG AAGAATACCGTCCTGCATCTCC AATGGCTTCTTCCCTGACGG CTGATCTTGCCCTCACCCTG CCTAGAGGTCGGGGTCAAGA CCTATCCAGCTCGAGCAGTG CTGACCACCATACACACGCT TGGAACACTTGCTCGTCCTG TGCTGATGCACCCATGTTTG AGGCCCTGGACAATCTCAAAG CGTATTCCCCTCCATCGTCG GATACCTCGCTTGCTCTGGG GGCCAGGTTCAACGAGATCA AAGCCAGAGATGGGGAGGAT

KJ653259 KJ653260 KJ653261 KJ653262 KJ653265 KJ653263 KJ653264

3

Amplification size (bp) 75 75 131 91 98

Statistical analysis was performed using SigmaStat 3.1, Systat. Tissue distribution statistical analysis was performed using OneWay of Analysis of Variance (ANOVA) followed by KruskaleWallis ANOVA on Ranks test. Independent samples t-test was performed to compare the statistical significance of gene expression between gills and hepatopancreas exposed to different salinity conditions. Two-way ANOVA was performed to determine effect of time and salinity treatment on gene expression. Differences were considered to be statistically significant at p < 0.05. All data represented means ± standard error.

147

3. Results 106 96

followed by 68e94  C melting curve analysis to confirm that a specific single PCR product was amplified and detected. The baseline was set automatically by Exicycler™96 real time system software (version 3.54.8). The amplification efficiencies of the primers were analyzed by the equation E ¼ 10(1/slope)1 (where E ¼ efficiency) in the 10-fold serially diluted cDNA samples. All PCR assays produced a strong linear fit with the cDNA template dilutions (R2  0.95) and the PCR efficiency was 92% for all assays. The relative expression level of each transcript was determined using the best reference gene selected (Mj-GAPDH) as an internal reference gene by the 2DDCt method [33]. The calculated relative expression levels of each gene in each tissue was compared with the respective gene expression level in gills in tissue specific expression analysis (relative fold change mRNA expression for particular candidate gene in gill ¼ 1). To determine the fold change mRNA expression of the animals exposed to different salinity conditions, the average relative expression of each individual at each time point (n ¼ 3) was compared to the average relative expression of SW exposed individuals at their respective time points (n ¼ 3).

3.1. Cumulative survival of M. japonicus after exposed to different salinity conditions Cumulative survival percentage (%) of crab over 14 days after exposed to different salinity conditions is given in Fig. 1. Crabs exposed to 10 psu started to die from day 6 (94.7% survival), with drastically high number of dead crab at day 8 (21% survival), which continued until day 9, and finally, no survivals (0%) were observed at day 12. In 25 psu, crab started to die from day 11 (84.2% survival) onwards, continued gradually, showing 68.4% survival at day 14. Crabs exposed to 40 psu started to die at day 9 reaching the same survival % at day 11 as 25 psu and thereafter, survival % was higher in 25 psu (68.4% survival of day 14) than the 40 psu (52.6% survival of day 14). One crab died from the animals that had been exposed to SW at day 10 post salinity exposure, showing the highest survival percentage (94.7%) among the treatments. 3.2. mRNA expression analysis of M. japonicus candidate genes against different salinity exposure conditions 3.2.1. Evaluation of the best reference gene for qRT-PCR on M. japonicus Evaluation of the best reference gene for qPCR is essential. In this study, Mj-GAPDH, Mj-b-actin, and Mj-Elfa were analyzed to find the best house-keeping gene for the salinity exposure experiment.

Fig. 1. Cumulative survival percentage (%) of M. japonicus that had been exposed at different salinity levels of 10, 25, 40 psu and sea water (SW) (31 þ 1 psu) up to 2 weeks (14 days).

Please cite this article in press as: Nikapitiya C, et al., Identification of potential markers and sensitive tissues for low or high salinity stress in an intertidal mud crab (Macrophthalmus japonicus), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.09.018

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3135_proof ■ 20 September 2014 ■ 4/10

4

C. Nikapitiya et al. / Fish & Shellfish Immunology xxx (2014) 1e10

Expression stability was analyzed using geNorm ranking and the comparative deltaeCt method as described [52,59]. Among these, the expression of Mj-GAPDH was identified as the most stable (data not shown), hence the qRT-PCR data was normalized with MjGAPDH. 3.2.2. Tissue distribution analysis for M. japonicus genes exposed to seawater In order to determine tissue specific gene expression profile for each gene transcription, M. japonicus exposed to SW was used to conduct qRT-PCR on various crab tissues using gene specific primers (from specific partial or full length coding sequences). Fold change mRNA expression of each candidate gene in each tissue was determined with respect to the expression in gill tissue (relative fold change expression of each gene in gill ¼ 1) (Fig. 2). All the genes mRNA were constitutively expressed in all the investigated tissues. One way ANOVA in tissue distribution analysis showed no significant differences in gene expression among tissues (p > 0.05). However, in this study, most of the genes were highly expressed in hepatopancreas compared to gill, whereas gill showed the lowest expression among all the tissues analyzed except Mj-Prx. Mj-EcR showed the highest expression in hepatopancreas followed by gonad and heart and the lowest expression in gill, muscle and stomach (Fig. 2A). In contrast, Mj-AK was higher in stomach and

muscle compared to gonad and heart (Fig. 2B), even though the magnitude of expression fold was low compared to Mj-EcR. Moreover, Mj-Tryp expression was higher in hepatopancreas, heart, gonad, and muscle compared to gill where the highest expression was observed in hepatopancreas (Fig. 2C). Further, comparatively very high expression (5000-fold) was observed in hepatopancreas than all the tissues for Mj-LGBP, where the second highest expression was observed in stomach compared to gill (60-fold) (Fig. 2D). In contrast, Mj-Prx mRNA expression in different tissues showed all most similar levels of expression with gills showing the highest expression in gonads, however, individual variability was high (Fig. 2E). 3.2.3. Transcriptional responses of M. japonicus candidate genes against different salinity exposure conditions 3.2.3.1. Expression analysis of Mj-EcR mRNA. Gills and hepatopancreas tissues from different salinity exposed crabs were used to analyze mRNA expression levels in response to different salinity conditions. Independent sample t-test analysis indicted that Mj-EcR expression was not significantly different between gills and hepatopancreas (p>0.05) may be due to individual variability. However, two-way ANOVA results showed the significant interaction between days and salinity (p ¼ 0.002) in gill Mj-EcR expression as well

Fig. 2. Tissue specific mRNA expression of M. japonicus ecdysteroid receptor (Mj-EcR); A, arginine kinase (Mj-AK); B, lipopolysachcharide and b-1,3- glucan binding protein (MjLGBP); C, trypsin (Mj-Tryp); D and peroxinectin (Mj-Prx); E in sea water (SW) (31 þ 1 psu). Tissues: Gi; gill, Hp; hepatopancreas, Ms: muscle, Gn: gonads (male), Ht; heart, St; stomach. Each bar represents the mean value from 3 individuals with the statistical error (SE) ±. Tissue specific relative fold change mRNA expression was calculated by a 2-DDCt method, using Mj-GAPDH as a reference gene. The calculated relative expression levels of each gene in each tissue were compared with respective gene expression level in gills in tissue specific expression analysis (relative fold change mRNA expression for particular candidate gene in gill ¼ 1).

Please cite this article in press as: Nikapitiya C, et al., Identification of potential markers and sensitive tissues for low or high salinity stress in an intertidal mud crab (Macrophthalmus japonicus), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.09.018

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3135_proof ■ 20 September 2014 ■ 5/10

C. Nikapitiya et al. / Fish & Shellfish Immunology xxx (2014) 1e10

as hepatopancreas (p ¼ 0.001). Transcription levels of Mj-EcR were significantly up regulated in gill at 40 psu compared to other salinity exposed conditions at day 4 and 7 showing approx. 5.0-fold and 6.75-fold higher expression than the SW at day 4 and 7, respectively (Fig. 3A). At 10 psu, in gill, down regulated Mj-EcR mRNA expression was observed compared to each respective days of SW. However, increased trend of expression was observed with the time compared to day 1 for all the salinity conditions. In contrast, hepatopancreas tissue exposed to 25 psu at day 4 showed significantly higher expression than SW and all the other salinity treatment conditions at day 4 (Fig. 3B) and it was significantly higher than day 1 and 7. Similarly, in 10 psu, expression level was significantly higher at day 4 than the day 1 and 7. Generally, all the salinity conditions at day 4 and 7 showed higher expression than the basal level of SW at day 1, indicating Mj-EcR is inducible against salinity changes (Table 2). 3.2.3.2. Expression analysis of Mj-Tryp mRNA. Mj-Tryp expression levels were significantly different between gills and hepatopancreas (p ¼ 0.002). The level of Mj-Tryp was up regulated in gills exposed to SW, 10, 25 and 40 psu at day 4 and 7 compared to day 1 of respective salinity exposed conditions, and day 1 showed slight

5

down regulated expression levels compared to SW for other salinities (Table 2, Fig. 3C). Mj-Tryp expression was gradually increased at 25 psu in time-dependent manner and was significantly higher at day 7 (2.4-fold) than the day 1. Significantly increased transcription level trend was observed for Mj-Tryp at 40 psu with the time and at day 4 showed significantly higher expressions (3.67- fold) than in other salinities at day 4. Highest expression of approx. 3.73-fold was observed at day 7 in 40 psu and this expression level was significantly higher than at 10 psu conditions (1.23-fold) (Fig. 3C). Two-way ANOVA results showed significant interaction between days and salinity (p ¼ 0.003) in hepatopancreas Mj-Tryp expression. Following the exposed period, differential Mj-Tryp expression pattern was observed in hepatopancreas and inducible expression was observed for all the salinity conditions including in SW compared to day 1 SW. In contrast to gill, expression levels of Mj-Tryp was significantly higher (66.8-fold) at day 4 than at day 1 in 10 psu exposed conditions, then significantly decreased to 30.45-fold up to day 7, however, it was still significantly higher than the day 1 expression level at 10 psu. 3.2.3.3. Expression analysis of Mj-AK mRNA. Mj-AK expression was not significantly different between gills and hepatopancreas

Fig. 3. qRT-PCR analysis of ecdysteroid receptor (Mj-EcR) expression (Gi; A, Hp; B), arginine kinase (Mj-AK) expression (Gi; C, Hp; D), and trypsin (Mj-Tryp) expression (Gi; E, Hp; F) in gill (Gi) and hepatopancreas (Hp) of M. japonicus that had been exposed at different salinity levels of 10, 25, 40 psu and sea water (SW) (31 ± 1 psu) at different time points (day 1, 4 and 7). Each bar represents the mean value from 3 individuals with the statistical error (SE) ±. The relative expression level of each transcript was determined using Mj-GAPDH by the 2DDCt method. Relative fold-change in gene expression after different salinity exposure was determined by dividing the average relative expression of each individual at each time point (n ¼ 3) by the average relative expression of SW exposed individuals at their respective time points (n ¼ 3). (relative fold change mRNA expression for particular candidate gene for SW at each time point ¼ 1). Significant salinity with in the days represents by “*” whereas significance of the days for each salinity represents by different letters.

Please cite this article in press as: Nikapitiya C, et al., Identification of potential markers and sensitive tissues for low or high salinity stress in an intertidal mud crab (Macrophthalmus japonicus), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.09.018

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3135_proof ■ 20 September 2014 ■ 6/10

6

C. Nikapitiya et al. / Fish & Shellfish Immunology xxx (2014) 1e10

Table 2 Summary of relative expression level of ecdysteroid receptor (Mj-EcR), arginine kinase (Mj-AK), trypsin (Mj-Tryp), lipopolysachcharide and b-1,3- glucan binding protein (MjLGBP) and peroxinectin (Mj-Prx) in gill and hepatopancreas of M. japonicus that had been exposed at different salinity levels of 10, 25, 40 psu and sea water (SW) (31 ± 1 psu) at different time points (day 1, 4 and 7) by color schematic representation. Each transcript was determined using Mj-GAPDH by the 2DDCt method. Relative fold-change in gene expression was determined by dividing the average relative expression of each individual at each time point (n ¼ 3) by the average relative expression of SW exposed individuals at day 1 (n ¼ 3). (relative fold change mRNA expression for particular candidate gene for SW at day 1 ¼ 1).

(p>0.05). Two-way ANOVA results in gill indicated that there was a significant difference in Mj-AK expression among days and salinity but not with their interactions. As shown in Fig. 3E and Table 2, Mj-AK expression in gills was not induced compared to sea water throughout the experiment period when compared with each day SW Mj-AK expression levels and the expressions were slightly down except at 40 psu. Mj-AK expression at 40 psu were gradually increased in exposed time dependent manner and was significantly higher at day 4 (2.7fold) and 7 (3.83-fold) than day 1 (0.97-fold). Moreover, the Mj-AK expression levels in 40 psu at day 7 was significantly higher than 10 and 25 psu. In contrast, hepatopancreas Mj-AK expressions were generally up regulated compared to expression levels of each day exposed to SW (Fig. 3E) even though the expression levels are not significant (p > 0.05). In particular, hepatopancreas showed early phase Mj-AK inducible response at day 1 for 10 (2.0-fold) and 40 psu (2.03-fold) and day 4 for 10 (1.8-fold), 25 (3.17-fold), and 40 psu (1.67-fold) (Table 2). Moreover, decreased time dependent trend of Mj-AK expression levels in both 10 and 40 psu was observed.

3.2.3.4. Expression analysis of Mj-LGBP mRNA. The expression profile of Mj-LGBP in gill and hepatopancreas after exposed to different salinity conditions is shown in Fig. 4A and B, respectively. Gills and hepatopancreas Mj-LGBP mRNA expression levels were significantly different (p < 0.001). The days, salinity treatments and days  salinity interactions were significantly different for Mj-LGBP expression levels. The level of Mj-LGBP transcription in gills exposed to 40 psu at day 4 and 7 was significantly higher than gills exposed at day 1 at 40 psu (Fig. 4A). Moreover, 40 psu exposed gills at day 7 showed significantly higher up regulation than all the other salinities at day 7 (29.33-fold). Even though, 10 and 25 psu also showed inducible expression at day 4 and 7

compared to day 1 SW, those were below the day 4 and 7 SW expression levels. Hepatopancreas showed contrast expression trend to gill at 10, 25 and 40, and expressions were down regulated depending on the exposed period (Fig. 4B). In particular, 10 and 25 psu exposed were time-dependent on down regulation. At 25 psu, Mj-LGBP was up regulated at day 1 followed by decreased trend at day 4 and then significantly down regulated (p < 0.05) at day 7 compared to day 1. At 10 psu, the Mj-LGBP was induced at day 1 and kept constant until day 4 and then significantly down regulated (p < 0.05) compared to day 1 and 4. However, at 40 psu, the expression level was slightly up regulated until day 4 and then down regulated. 3.2.3.5. Expression analysis of Mj-Prx mRNA. Mj-Prx mRNA expressions between gills and hepatopancreas were not significantly different (p > 0.05). Two-way ANOVA results showed that the days, salinity treatments and days  salinity interactions were significantly different for Mj-Prx expression levels. As shown in Fig. 4C, Mj-Prx transcription level in gills exposed at 40 psu were significantly higher than the SW and other salinity conditions at day 1 (3.07-fold), 4 (2.10-fold), and 7 (19.10-fold). In 10 psu, the exposed gill tissue exhibited slight induced level expression at day 1 followed by continuous down regulated expression pattern at day 4 and 7, compared to SW at day 1. Slight induction at day 1 followed by induced expression at day 4 and then decreased trend of Mj-Prx expressions in gill were observed at 25 psu compared to day 1 SW. In contrast to gill expression, hepatopancreas exposed to 25 psu showed significant Mj-Prx up regulation from day 1 followed by peaked expression at day 7 (7.4-fold) compared to SW at day 1. Hepatopancreas exposed to 10 psu also exhibited up regulation pattern of Mj-Prx from day 4 followed by day 7 (4.10-fold) compared to SW at day 1. Two-way ANOVA results showed that the days and salinity treatments are significantly different however, the

Please cite this article in press as: Nikapitiya C, et al., Identification of potential markers and sensitive tissues for low or high salinity stress in an intertidal mud crab (Macrophthalmus japonicus), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.09.018

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3135_proof ■ 20 September 2014 ■ 7/10

C. Nikapitiya et al. / Fish & Shellfish Immunology xxx (2014) 1e10

7

Fig. 4. qRT-PCR analysis of lipopolysachcharide and b-1,3- glucan binding protein (Mj-LGBP) expression (Gi; A, Hp; B) and peroxinectin (Mj-Prx) expression (Gi; C, Hp; D) in gill (Gi) and hepatopancreas (Hp) of M. japonicus that had been exposed at different salinity levels of 10, 25, 40 psu and sea water (SW) (31 ± 1 psu) at different time points (day 1, 4 and 7). Each bar represents the mean value from 3 individuals with the statistical error (SE) ±. The relative expression level of each transcript was determined using Mj-GAPDH by the 2DDCt method. Relative fold-change in gene expression after different salinity exposure was determined by dividing the average relative expression of each individual at each time point (n ¼ 3) by the average relative expression of SW exposed individuals at their respective time points (n ¼ 3). (relative fold change mRNA expression for particular candidate gene for SW at each time point ¼ 1). Significant salinity with in the days represents by “*”whereas significance of the days for each salinity represents by different letters.

days  salinity interactions were not significantly different for MjPrx expression levels. 4. Discussion Initial up regulated response of stress, immune and metabolism molecules are indicators of various environmental stresses [4,5,10,11,17,21]. Transcriptomic responses have been studied for invertebrates [34,58] including green crab (Carcinus maenas) against salinity stresses using oligo-microarray techniques. Early differential gene expression responses in the gills were reported against hypo-salinity (salinity changes from 32 to 15 or 10 ppt), especially for cell signaling factors, ion transport and mitochondrial proteins related genes in C. maenas but stress proteins related genes remained largely unaffected [58]. In the present study, the selected candidate genes were functionally related with metabolism and immunity in many organisms and transcriptional responses against low salinity has been reported for other crustaceans but not for the mud crab. This is the first attempt to identify levels of expression of these candidate genes between gills and hepatopancreas of M. japonicus to find potential candidate gene markers against salinity stress, exposed to different salinity conditions compared to SW. In M. japonicus tissue distribution (Fig. 2), transcripts of all genes were detected in all tissues examined. This indicates that selected candidate genes possibly have potential physiological roles in multiple tissues in different levels, nevertheless, hepatopancreas showed higher responses (Mj-EcR, Mj-LGBP, Mj-Tryp) against SW (31 ± 1 psu) compared to other tissues (Fig. 2). Decapod crustacean hepatopancreas (known as digestive gland or midgut gland) involved in digestion, absorption, storage of nutrients, metabolism [13], and also plays a major role in immune and stress responses

[20] other than the hemocyte. Thus, hepatopancreas could be an internal responsive organ to find anti-stress responses against salinity stress of euryhaline crustaceans. Gill is involved in many cellular functions for transcriptional regulation of metabolism, maintaining homeostasis for salinity stress and adaptability [2] and plays a significant role in modulation of ion transport [35,37,47,64]. In contrast to hepatopancreas, the gill tissue interacts first with the environmental changes, showed the lowest responses (e.g. MjEcR, Mj-LGBP, Mj-Tryp, Mj-AK) against all the tissues except Mj-Prx (heart and stomach showed relatively lower expression than gill; Fig 2E). Low expression levels in gills compared to other examined tissues in this study indicates the tolerance capability of the gill compared to other tissues. Unchanged stress related gene expressions were reported in C. maenas gills exposed to hypo-salinity, indicating its well adaptability for environmental salinity changes [58]. Since gills are frequently exposed to the changes in environment, they are ideal organs for study comparative genetic analysis of molecular basis of physiological, metabolical and immunological responses against salinity stress. Ecdysteroids are well known to play important role on physiological processes including reproduction and development in nematodes, arthropods and other protostome clades. The most active form of ecdysteroid is 20-hydroxyecdysone (20E) involves triggering the specific regulations of several genes in different tissues and developmental stages through interactions with the ecdysteroid receptor (EcR) [18]. In Fig. 3A, significantly higher expression in gills at day 4 and 7 at 40 psu compared to respective days of SW, and down regulated expression at 10 psu compared to all the time points of SW suggests that Mj-EcR responded differentially to both high and low salinity. The differential response between gills and hepatopancreas confirmed by the expression pattern in hepatopancreas, showed Mj-EcR up regulation at 10 psu

Please cite this article in press as: Nikapitiya C, et al., Identification of potential markers and sensitive tissues for low or high salinity stress in an intertidal mud crab (Macrophthalmus japonicus), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.09.018

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3135_proof ■ 20 September 2014 ■ 8/10

8

C. Nikapitiya et al. / Fish & Shellfish Immunology xxx (2014) 1e10

in all the time points while at 25 and 40 psu, Mj-EcR up regulation was shown only at day 4 and 7 (Fig. 3B). Down regulated Mj-EcR in gill at low salinity (10 psu) is consistent with the previously reported slow growth at low salinity (3 ppt) cultivation in shrimp [30] may suggest that other than the optimum salinity (20‰), much low or high salinity would adversely affect the shrimp growth. This could be due to the alteration of activation of molting cycle, and elevated expression at high salinity may correlate with speedy development rate at high salinity conditions in crustaceans. It has been reported that the alteration of intertidal copepod, Tigriopus japonicus ecdysone receptor mRNA expression (significantly decreased after 12 h exposure (at 22 ppt) and sharp increased from 6 h to 12 h (at 42 ppt)) would affect the endocrine system and thereby reproduction in adult T. japonicus [41]. This further suggests that the effect of oxidative stress would affect the transcriptional regulation of ecdysone receptor of the animal [19] [63]. reported that ecdysteroid may increase at high salinity and activate the EcR and retinoid -X- receptor (RXR) and consequently regulating the target genes for coordination of muscular atrophy, metabolic shifts, cuticle separation and molting at the end [22,51]. The present study also showed the higher EcR responses at high salinity. On the other hand, molting appears to be a defense mechanism in decapods [3] and innate immune response of ecdysteroid regulated protein (16 kDa) has been reported in hepatopancreas of virus-resistant shrimp Litopenaeus vannamei [66]. Shrimp ecdysteroid regulated protein showed up regulated expression at low salinity (2 psu) short term (24 h) and down regulated expression at low salinity (2 psu) long term in hepatopancreas [12], which was similar to Mj-EcR expression trend in the hepatopancreas to some extent. They suggest that the up regulation of ecdysteroid regulated protein was the result of innate immune protection under short term hyposmotic stress conditions and down regulation was due to the results of immune depression under long term hyposmotic stress conditions. Ecdysteroid hormone is reported to be stimulated and regulate trypsin mRNA transcription and protein synthesis in crustaceans [26,53], however, it is express conclusively whether Mj-EcR transcription correlates with differential transcriptional response against salinity stress in the present study. Trypsin is an alkaline proteolytic enzyme belongs to the serine protease family and acts as a digestive enzyme in many organisms including crustaceans which involved in hydrolysis of lysine and arginine [24]. Trypsin in fiddler crab (Uca pugilator) constitutes for approx. 33% of the total hepatopancreatic protein [8] and also is involved in the activation of crustaceans' prophenoloxidase system [27,57] [12]. reported that trypsin mRNA expression was not altered in hepatopancreas of shrimp L. vannamei after short-term exposure (24 h) at low salinity (2 psu) implying stress recovery of the shrimp, but changed down regulated expression after long-term (56 days) exposure at low salinity, explained as immune depression under long-term hyposmotic stress condition. In this study, Mj-Tryp was up regulated against salinity variations at the onset of salinity stress. Gill shows up regulated Mj-Tryp response at all the salinity from day 4 exhibiting high magnitude of the expression levels at 40 psu from day 4 onwards. In contrast, hepatopancreas showed early induction of the gene from day 1 onwards for all the salinities showing high magnitude of expression at 10 psu from day 4 onwards and 40 psu at day 7. Hence Mj-Tryp could be considered as early responsive gene and potential candidate for developing gene markers to find variations in the environmental salinity. Environmental stress caused energetic demand for almost all the cellular functions and up regulation of the Arginine kinase (AK) could be an indicator of metabolic stress [15]. AK is widely distributed in invertebrates including crustaceans [65]. It plays an

important role in modulation of energy production and utilization in animals [9,55]. Several energy requiring metabolic pathways related genes were up regulated in magur (Clarias batrachus) and euryhyaline crab (Chasmagnathus granulate) during hyperosmotic stress (Schein et al., 2004, [43,48]. In this study, Mj-AK expression in gills was not induced compared to SW throughout the experiment period when compared with Mj-AK expression levels of each day SW, and expressions were slightly down except in 40 psu at day 7 (Fig. 3C). However, expression was compared among days in each salinity, and day 4 and 7 showed higher expression than the day 1 in all the salinities suggesting that M. japonicus gill is metabolically active against salinity stress. In blue crab (Callinectes sapidus), AK showed up regulated expression in response to low salinity (10 psu) in posterior gills but not the anterior gills, suggesting posterior gill of blue crab is metabolically active [49]. Q3 Higher expression of Mj-AK at all salinity conditions in hepatopancreas indicates that this organ also metabolically active against variations of the salinity and metabolic functions have been increased to adapt to the salinity variations at the onset of salinity stress. Relatively higher Mj-AK expression at 10, 25 and 40 psu at day 1 and 4 could be indicative of induction of metabolic related genes at early exposed period (Fig. 3). These metabolic responses may also affect ultimate crab survival for a long time, comparatively to 10 and 40 psu (Fig. 1). Slow growth [30,44], low survival rate [30] and high susceptibility to pathogens [61,62] are reported to be long term low salinity cultivation problems in the shrimp industry. In accordance with this M. japonicus exposed to 10 psu started to die from day 6 (94.7% survival) and no survivors were remained at day 12 indicating the low survival rate at low salinity (Fig. 1). Induced and decreased trend of Mj-AK expression with the time further indicates that metabolic activation is an extra energy demanding process for adaptability or for survival, resulting death of crab first at 10 psu followed by 40 psu compared to 25 psu and SW and it may insufficient for the survival. When the previously reported evidences for other crustaceans are considered [1,23,65], Mj-AK could be an indicator of metabolic stress caused by environmental stress, especially for both high and low salinity compared to SW in hepatopancreas. Further research is needed to investigate the role of AK in different salinity responses in crab as well as the potential molecule marker for the salinity stress or susceptibility of the health status of the animal due to the stress. Expression of immune related genes such as prophenoloxidase (proPO), peroxinectin (Prx), intergrin b and serine proteinase was reported to be effected by changes of environmental factors such as temperature, pH, salinity and ammonia levels in crustaceans [29,32,60]. White shrimp showed higher expression of lipopolysaccharide and b-1,3- glucan binding protein (LGBP), Prx, and intergrin b at low salinity levels such as 2.5 and 5‰ compared to those at 15, 25 and 35‰ [31] at long term exposure and suggesting that the innate immune system has induced to combat long term detrimental consequences from low salinity. In this study, two components of proPO system, LGBP and Prx, were transcriptionally analyzed in tissue specific manner in SW and after exposing to different salinity levels in gill and hepatopancreas (Fig. 4). LGBP is one of the pattern recognition receptors (PRR) which involved in the recognition and binding of invading microorganism to the host and activate downstream immune signaling pathways. Prx, a cell adhesion molecule for cellular immune response, has functions of degranulation, encapsulation enhancement, opsonin and peroxidase activity [54]. Compared to Mj-LGBP expression at SW at day 1 all the salinities showed up regulation trend at all the time points except at 25 psu at day 1 showing the induction ability of this gene in gill against variation of the salinity. Further, at the 40 psu at day 7, the expression reached the maximum when compared to same day

Please cite this article in press as: Nikapitiya C, et al., Identification of potential markers and sensitive tissues for low or high salinity stress in an intertidal mud crab (Macrophthalmus japonicus), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.09.018

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3135_proof ■ 20 September 2014 ■ 9/10

C. Nikapitiya et al. / Fish & Shellfish Immunology xxx (2014) 1e10

control suggesting that this gene was highly inducible for high salinity stress. In contrast, opposite trend of expression was observed in hepatopancreas when gene was induced at day 1 and 4 at all salinities in different magnitudes compared to SW at day 1 and 7, then the expression trend was decreasing from day 4 onwards. It is well known that high stresses are easily vulnerable to diseases. Hence, up regulation of Mj-LGBP mRNA at different salinity conditions implies that immune molecule in the defense system of crab is activating during the salinity variations in the environment and ready to react against any disrupting physiological state. Early induction of Mj-LGBP in the hepatopancreas further confirms that gill is more tolerable tissue than the hepatopancres. However, reason for high induction of Mj-LGBP in gills exposed to SW at day 4 and 7 compared to day 1 is uncertain. Consistent with the previous report [31], Mj-Prx induced differentially between two tissues showing differential responses against salinity changes (Fig. 4D). Hepatopancreas showed clear transcript induction at 10 psu from day 4 onwards and at 25 psu from day 1 onwards with the increased trend showing peak at day 7 whereas 40 psu showed induction only at day 7. Interestingly, gill showed contrast regulation pattern that Mj-Prx induction was initiated for all the salinities slightly from day 1 then transcription was up regulated clearly at day 4 in 25 and 40 psu, with the peak at high salinity at day 7, whereas the transcription was down regulated at low salinity with the time (Table 2). The results suggest that Mj-Prx could be a responsive gene for salinity adaptation in the gill. Further, Prx was up regulated in both gill and hepatopancreas, suggesting this gene shows physiological responses against salinity apart from the immune function. In conclusion, all the candidate genes showed differential responses though all not showed statistically significant difference between gill and hepatopancreas against varying degree of salinity. Hepatopancreas tissue was identified as suitable tissue for studying transcriptional responses against environmental salinity changes, specifically Mj-EcR, Mj-Tryp, Mj-AK and Mj-LGBP were identified as potential marker genes from hepatopancreas for salinity variation, by identifying high levels of expression at early time points. Especially Mj-EcR, Mj-Tryp, Mj-AK and Mj-LGBP were shown to be induced at low salinity variation at day 1 and 4, compared to SW whereas Mj-Tryp, Mj-AK and Mj-LGBP were shown to be induced at day 1 at all the salinity conditions. In the gills, Mj-EcR, Mj-Tryp and Mj-AK showed late responses to high salinity compared to respective time points of SW at day 4 and 7, whereas Mj-Prx considered as early responsive gene. Additionally the most of the candidate genes expressed highly at day 4 indicating that day 4 could be a crucial point where crab's physiological changes occur in low or high salinity to the M. japonicus. In overall, the candidate genes used in this study could be considered as potential gene markers for high or low salinity stress. Future studies could validate biochemical and physiological responses of these genes in protein levels in order to uncover physiological significance in response to salinity tolerance.

[25]

Acknowledgments

[26]

This study was supported by the National Research Foundation of Korea, which was funded by the Korean Government [NRF-2013R1A2A2A-01004914].

[27]

References [1] Abe H, Hirai S, Okada S. Metabolic responses and arginine kinase expression under hypoxic stress of the kuruma prawn Marsupenaeus japonicus. Comp Biochem Physiol Part A 2007;146:40e6. [2] Barman HK, Patra SK, Das V, Mohapatra SD, Jayasankar P, Mohapatra C, et al. Identification and characterization of differentially expressed transcripts in

[3] [4] [5]

[6]

[7]

[8] [9] [10]

[11]

[12]

[13] [14]

[15]

[16]

[17] [18]

[19]

[20]

[21]

[22]

[23]

[24]

[28]

[29] [30]

9

the gills of freshwater prawn (Macrobrachium rosenbergii) under salt stress. SciWorld Journ 2012;2012:1e11. Castro K, Factor R, Angell T, Langders T. The conceptual approach to lobster shell disease revisited. J Crustac Biol 2006;26:646e60. Chaney ML, Gracey AY. Mass mortality in Pacific oysters is associated with a specific gene expression signature. Mol Ecol 2011;20:2942e54. Chapman RW, Mancia A, Beal M, Veloso A, Rathburn C, Blair A, et al. The transcriptomic responses of the American oyster, Crassostrea virginica, to environmental conditions. Mol Ecol 2011;20(7):1431e49. Chung KF, Lin HC. Osmoregulation and NaþKþATPase expression in osmoregulatory organs of Scylla paramamosain. Comp Biochem Physiol Part A, Mol Integr Physiol 2006;144(1):48e57. de la Vega E, Hall MR, Wilson KJ, Reverter A, Woods RG, Degnan BM. Stressinduced gene expression profiling in the black tiger shrimp Penaeus monodon. Physiol Genomics 2007;31:126e38. Eisen AZ, Jeffrey JJ. An extractable collagenase from crustacean hepatopancreas. Biochim Biophys Acta 1969;191:517e26. Ellington WR. Evolution and physiological roles of phosphagen systems. Annu Rev Physiol 2001;63:289e325. Feder ME, Hofmann GE. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu Rev Physiol 1999;61:243e82. Fleury E, Moal J, Boulo V, Daniel JY, Mazurais D, Henaut A, et al. Microarraybased identification of gonad transcripts differentially expressed between lines of Pacific Oyster selected to be resistant or susceptible to summer mortality. Mar Biotech 2010:326e39. Gao W, Tan B, Mai K, Chi S, Liu H, Dong X, et al. Profiling of differentially expressed genes in hepatopancreas of white shrimp (Litopenaeus vannamei) exposed to long-term low salinity stress. Aquaculture 2012;364-365: 186e91. Gibson R, Barker PL. The decapod hepatopancreas. Oceanogr Mar Biol An Annu Rev 1979;17:285e346. Genard B, Pernet F, Lemarchand K, Boudry P, Moraga D, Tremblay R. Physiological and biochemical changes associated with massive mortality events occurring in larvae of American oyster (Crassostrea virginica). Aquat Living Resour 2011;24:267e360. Genard B, Miner P, Nicolas JL, Moraga D, Boudry P, Pernet F, et al. Integrative study of physiological changes associated with bacterial infection in Pacific oyster larvae. Plos One 2013;8(5):e64534. 1e15. Henry RP, Thomason KL, Towle DW. Quantitative changes in branchial carbonic anhydrase activity and expression in the euryhaline green crab, Carcinus maenas, in response to low salinity exposure. J Exp Zool A 2006;305(10): 842e50. Hochachka PW, Somero GN. Biochemical adaptation: mechanism and process in physiological evolution. 2nd ed. New York: Oxford University Press; 2002. p. 466. Hopkins PM. Crustacean ecdysteroids and their receptors. In: Smagghe G, editor. Ecdysone: structures and functions. Netherlands: Springer Verlag; 2009. p. 73e97. Hwang DS, Lee JS, Lee KW, Rhee JS, Han J, Lee J, et al. Cloning and expression of ecdysone receptor (EcR) from the intertidal copepod, Tigriopus japonicus. Comp Biochem Physiol Part C 2010;151:303e12. Jiang H, Li F, Huang B, Zhang J, Zhang C, Li S, et al. Comparative proteomic profiles of the hepatopancreas in Fenneropenaeus chinensis response to hypoxic stress. Proteomics 2009;9(12):3353e67. Joly AL, Wettstein G, Mignot G, Ghiringhelli F, Garrido C. Dual role of heat shock proteins as regulators of apoptosis and innate immunity. J Innate Immun 2010;2:238e47. Kim HW, Chang E, Mykles D. Three calpains and ecdysone receptor in the land crab Gecarcinus lateralis: sequences, expression and effects of elevated ecdysteroid induced by eyestalk ablation. J Exp Biol 2005;208:3177e97. Kinsey ST, Lee BC. The effects of rapid salinity change on in vivo arginine kinase flux in the juvenile blue crab Callinectes sapidus. Comp Biochem Physiol B 2003;135:521e31. Kishimura H, Tokuda Y, Yabe M, Klomklao S, Benjakul S, Ando S. Trypsin from the pyloric ceca of jacopever (Sebastes schlegelii) and elkhorn sculpin (Alcichthys alcicornis): isolation and characterization. Food Chem 2007;100: 1490e5. Kitaura J, Wada K, Nishida M. Molecular phylogeny of grapsoid and ocypodoid crabs with special reference to the genera Metaplax and Macrophthalmus. J Crust Biol 2002;22(3):682e93. Klein B, Le Moullac G, Sellos D, van Wormhoudt A. Molecular cloning and sequencing of trypsin cDNAs from Penaeus vannamei (Crustacea, Decapoda): use in assessing gene expression during the moult cycle. Int J Biochem Cell Biol 1996;28:551e63. Lai CY, Cheng W, Kuo CM. Molecular cloning and characterization of prophenoloxidase from haemocytes of the white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol 2005;18(5):417e30. Larsen PF, Nielsen EE, Koed A, Thomsen DS, Olsvik PA, Loeschcke V. Interpopulation differences in expression of candidate genes for salinity tolerance in winter migrating anadromous brown trout (Salmo trutta L.). BMC Genet 2008;9:12. Le Moullac G, Haffner P. Environmental factors affecting immune responses in Crustacean. Aquaculture 2000;191:121e31. Li E, Chen L, Zeng C, Chen X, Yu N, Lai Q, et al. Growth, body composition, respiration and ambient ammonia nitrogen tolerance of the juvenile white

Please cite this article in press as: Nikapitiya C, et al., Identification of potential markers and sensitive tissues for low or high salinity stress in an intertidal mud crab (Macrophthalmus japonicus), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.09.018

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45

YFSIM3135_proof ■ 20 September 2014 ■ 10/10

10

[31]

[32]

[33] [34] [35]

[36]

[37] [38]

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48]

C. Nikapitiya et al. / Fish & Shellfish Immunology xxx (2014) 1e10 shrimp, Litopenaeus vannamei, at different salinities. Aquaculture 2007;265: 385e90. Lin YC, Chen JC, Li CC, Morni WZW, Suhaili ASNA, Kuo YH, et al. Modulation of the innate immune system in white shrimp Litopenaeus vannamei following long-term low salinity exposure. Fish Shellfish Immunol 2012;33:324e31. Liu CH, Cheng W, Kuo CM, Chen JC. Molecular cloning and characterization of a cell adhesion molecule, peroxinectin from the white shrimp Litopenaeus vannamei. Fish Shellfish Immunol 2004;17:13e26. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real time quantitative PCR and the 2-DDCT method. Methods 2001;25:402e8. Lockwood BL, Somero GN. Transcriptome responses to salinity stress in invasive and native blue mussels (genus Mytilus). Mol Ecol 2011;20:517e29. Lu XJ, Chen J, Huang ZA, Shi YH, Wang F. Proteomic analysis on the alteration of protein expression in gills of ayu (Plecoglossus altivelis) associated with salinity change. Comp Biochem Physiol D 2010;5:185e9. Lv J, Liu P, Wang Y, Gao B, Chen P, Li J. Transcriptome analysis of Portunus trituberculatus in response to salinity stress provides insights into the molecular basis of osmoregulation. PLOS ONE 2013;8(12):e82155. 1-15. Marshall WS. Naþ, Cl, Ca2þ and Zn2þ transport by fish gills: retrospective review and prospective synthesis. J Exp Zool 2002;293:264e83. Otani S, Kozuki Y, Yamanaka R, Sasaoka H, Ishiyama T, Okitsu Y, et al. The role of crabs (Macrophthalmus japonicus) burrows on organic carbon cycle in estuarine tidal flat, Japan. Estuar Coast Shelf Sci 2010;86:434e40. Pandit A, Rai V, Bal S, Sinha S, Kumar V, Chauhan M, et al. Combining QTL mapping and transcriptome profiling of bulked RILs for identification of functional polymorphism for salt tolerance genes in rice (Oriza sativa L.). Mol Genet Genom 2010;284:121e36. Park K, Kwak IS. Expression of stress response HSP70 gene in Asian Paddle crabs, Charybdis japonica, exposure to endocrine disrupting chemicals, Bisphenol A (BPA) and 4-Nonylphenol (NP). Ocean Sci J 2013;48(2):207e14. Raisuddin S, Kwok KWH, Leung KMY, Schlenk D, Lee JS. The copepod Tigriopus: a promising marine model organism for ecotoxicology and environmental genomics. Aquat Toxicol 2007;83:161e73. Romano N, Zeng CS. Osmoregulation in decapod crustaceans: implications to aquaculture productivity, methods for potential improvement and interactions with elevated ammonia exposure. Aquaculture 2012;334:12e23. Saha N, Jyrwa LM, Das M, Biswas K. Influence of increased environmental water salinity on gluconeogenesis in the air-breathing walking catfish, Clarias batrachus. Fish Physiol Biochem 2011;37:681e92. Samocha TM, Lawrence AL, Poose D. Growth and survival of juvenile Penaeus vannamei in low salinity water in a semi-closed recirculating system. Isr J Aqua Bamidgeh 1998;50(2):55e9. Scavia D, Field JC, Boesch DF, Buddemeier RW, Burkett V, Cayan DR, et al. Climate change impacts on U.S. coastal and marine ecosystems. Estuaries 2002;25(2):149e64. Scott GR, Claiborne JB, Edwards SL, Schulte PM, Wood CM. Gene expression after freshwater transfer in gills and opercular epithelia of killifish: insight into divergent mechanisms of ion transport. J Exp Biol 2005;208(14): 2719e29. Scott GR, Schulte PM. Intraspecific variation in gene expression after seawater transfer in gills of the euryhaline killifish Fundulus heteroclitus. Comp Biochem Physiol A 2005;141:176e82. Schein V, Chitt ALF, Etges R, Kucharski LC, Wormhoudt AV, Da Silva RSM. Effect of hyper or hypo-osmotic conditions on neutral amino acid uptake and oxidation in tissues of the crab Chasmagnathus granulata. Comp Biochem Physiol B 2005;140:561e7.

[49] Serrano L, Halanaych KM, Henry RP. Salinity-stimulated changes in expression and activity of two carbonic anhydrase isoforms in the blue crab Callinectes sapidus. J Exp Biol 2007;210:2320e32. [50] Shaterian J, Georges F, Hussain A, Waterer D, De Jong H, Tanino KK. Root to shoot communication and abscisic acid in calreticulin (CR) gene expression and salt-stress tolerance in grafted diploid potato clones. Environ Exp Bot 2005;53(3):323e32. [51] Shechter A, Tom M, Yudkovski Y, Weil S, Chang S, Chang E, et al. Search for hepatopancreatic ecdysteroid-responsive genes during the crayfish molt cycle: from a single gene to multigenicity. J Exp Biol 2007;210:3525e37. [52] Silver N, Best S, Jiang J, Thein SL. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol Biol 2006;7:33. [53] Skinner DM. Amino acid incorporation into protein during the molt cycle of the land crab Gecarcinus lateralis. J Exp Biol 1965;160:225e33. [54] Sritunyalucksana K, Soderhall K. The proPO and clotting system in crustaceans. Aquaculture 2000;191:53e69. [55] Strong SJ, Ellington WR. Isolation and sequence analysis of the gene for arginine kinase from the chelicerate arthropod, Limulus polyphemus: insights into catalytically important residues. Biochim Biophys Acta 1995;1246: 197e200. [56] Teranishi KS, Stillman JH. A cDNA microarray analysis of the response to heat stress in hepatopancreas tissue of the porcelain crab Petrolisthes cinctipes. Comp Biochem Physiol D 2007;2:53e62. [57] Thomas-Guyon H, Gagnaire B, Bado-Nilles A, Bouilly K, Lapegue S, Renault T. Detection of phenoloxidase activity in early stages of the Pacific oyster Crassostrea gigas (Thunberg). Dev Comp Immunol 2009;33(5):653e9. [58] Towle DW, Henry RP, Terwilliger NB. Microarray-detected changes in gene expression in gills of green crabs (Carcinus maenas) upon dilution of environmental salinity. Comp Biochem Physiol D 2011;6:115e25. [59] Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002;3. RESEARCH0034. [60] Vaseeharan B, Lin YC, Ko CF, Chen JC. Cloning and characterization of a serine proteinase from the haemocytes of mud crab Scylla serrata. Fish Shellfish Immunol 2006;21:20e31. [61] Wang LU, Chen JC. The immune response of white shrimp Litopenaeus vannamei and its susceptibility to Vibrio alginolyticus at different salinities levels. Fish Shellfish Immunol 2005;18:269e78. [62] Wang FI, Chen JC. Effect of salinity on the immune response of tiger shrimp Penaeus monodon and its susceptibility to Photobacterium damselae sub sp. damselae. Fish Shellfish Immunol 2006;20:671e81. [63] Wang YH, LeBlanc GA. Interactions of methyl farnesoate and related compounds with a crustacean retinoid X receptor. Mol Cell Endocrinol 2009;309: 109e16. [64] Xu Q, Liu Y. Gene expression profiles of the swimming crab Portunus trituberculatus exposed to salinity stress. Mar Biol 2011;158(10):2161e72. [65] Yao CL, Ji PF, Kong P, Wang ZY, Xiang JH. Arginine kinase from Litopenaeus vannamei: cloning, expression and catalytic Properties. Fish Shellfish Immunol 2009;26:553e8. [66] Zhao ZY, Yin ZX, Weng SP, Guan HJ, Li SD, Xing K, et al. Profiling of differentially expressed genes in hepatopancreas of white spot syndrome virusresistant shrimp (Litopenaeus vannamei) by suppression subtractive hybridization. Fish Shellfish Immunol 2007;22:520e34.

Please cite this article in press as: Nikapitiya C, et al., Identification of potential markers and sensitive tissues for low or high salinity stress in an intertidal mud crab (Macrophthalmus japonicus), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.09.018

46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90