Identification of putative virulence-associated genes of Haemophilus parasuis through suppression subtractive hybridization

Veterinary Microbiology 144 (2010) 377–383

Contents lists available at ScienceDirect

Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic

Identification of putative virulence-associated genes of Haemophilus parasuis through suppression subtractive hybridization Hongzhuan Zhou a,b,d, Bing Yang b, Fuzhou Xu b, Xiaoling Chen b, Jinluo Wang b, P.J. Blackall c, Peijun Zhang b, Yongheng Xia b, Jin Zhang b, Rongcai Ma a,d,* a

College of Life Sciences, Capital Normal University, Beijing 100048, China Institute of Animal Science and Veterinary Medicine, Beijing Academy of Agriculture and Forestry Sciences, Beijing 100097, China Queensland Primary Industries and Fisheries, Animal Research Institute, Yeerongpilly, Qld 4105, Australia d Beijing Agro-Biotechnology Research Center, Beijing Academy of Agriculture and Forestry Sciences, Beijing 100097, China b c

A R T I C L E I N F O

A B S T R A C T

Article history: Received 25 November 2009 Received in revised form 15 January 2010 Accepted 25 January 2010

Haemophilus parasuis is the causative agent of Gla¨sser’s disease. Up to now 15 serovars of H. parasuis have been identified, with significant differences existing in virulence between serovars. In this study, suppression subtractive hybridization (SSH) was used to identify the genetic difference between Nagasaki (H. parasuis serovar 5 reference strain, highly virulent) and SW114 (H. parasuis serovar 3 reference strain, non-virulent). A total of 191 clones were obtained from the SSH library. Using dot hybridization and PCR, 15 clones were identified containing fragments that were present in the Nagasaki genome while absent in the SW114 genome. Among these 15 fragments, three fragments (ssh1, ssh13, ssh15) encode cell surface-associated components; three fragments (ssh2, ssh5, ssh9) are associated with metabolism and stress response; one fragment (ssh8) is involved in assembly of fimbria and one fragment (ssh6) is a phage phi-105 ORF25-like protein. The remaining seven fragments are hypothetical proteins or unknown. Based on PCR analysis of the 15 serovar reference strains, eight fragments (ssh1, ssh2, ssh3, ssh6, ssh8, ssh10, ssh11 and ssh12) were found in three to five of most virulent serovars (1, 5, 10, 12, 13 and 14), zero to two in three moderately virulent serovars (2, 4 and 15), but absent in the low virulent serovar (8) and non-virulent serovars (3, 6, 7, 9 and 11). In vivo transcription fragments ssh1, ssh2, ssh8 and ssh12 were identified in total RNA samples extracted from experimental infected pig lung by RT-PCR. This study has provided some evidence of genetic differences between H. parasuis strains of different virulence. ß 2010 Elsevier B.V. All rights reserved.

Keywords: Haemophilus parasuis Suppression subtractive hybridization (SSH) Virulence

1. Introduction Haemophilus parasuis, is the causative agent of Gla¨sser’s disease (Oliveira and Pijoan, 2004). In recent years H. parasuis has emerged as one of the major causes of nursery

* Corresponding author at: Beijing Agro-Biotechnology Research Center, Beijing Academy of Agriculture and Forestry Sciences, Beijing 100097, China. Tel.: +86 10 62044590. E-mail address: [email protected] (R. Ma). 0378-1135/$ – see front matter ß 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.vetmic.2010.01.023

mortality in the pig industry worldwide (Rubies et al., 1999; Cai et al., 2005). Little is known about the virulenceassociated factors of H. parasuis. The serovar of an isolate has been commonly used as an indicator of virulence. Among the 15 serovars of H. parasuis, serovars 1, 5, 10, 12, 13 and 14 were classified as highly virulent, serovars 2, 4 and 15 as moderately virulent, serovar 8 as mildly virulent while serovars 3, 6, 7, 9 and 11 as non-virulent (Kielstein and Rapp-Gabrielson, 1992). To date, numerous attempts have been made to identify virulence factors or even virulence markers within the virulent serovars. Genetic

378

H. Zhou et al. / Veterinary Microbiology 144 (2010) 377–383

methods such as differential display reverse transcription polymerase chain reaction (DDRT-PCR) (Hill et al., 2003), microarray analysis (Melnikow et al., 2005), selective capture of transcribed sequences (SCOTS) (Jin et al., 2008) and modified representational difference analysis (Lancashire et al., 2007; Sack and Baltes, 2009) have been used to identify genes which may be responsible for virulence under in vitro or in vivo conditions. In this study we report on the use of suppression subtractive hybridization (SSH), a technique which can prevent undesirable amplification while enrichment of target molecules proceeds through the step of suppression PCR (Diatchenko et al., 1996; Gurskaya et al., 1996), to identify sequences that are present in one genome but absent in another (Straus and Ausubel, 1990; Mahairas et al., 1996). 2. Materials and methods 2.1. Bacterial strains, media and growth conditions The H. parasuis reference strains for serovars 1 (4), 2 (SW140), 3 (SW114), 4 (SW124), 5 (Nagasaki), 6 (131), 7 (174), 8 (C5), 9 (D74), 10 (H367), 11 (H465), 12 (H425), 13 (IA-84-17975), 14 (IA-84-22113), 15 (SD-84-15995) and two Australian field isolates (HS145 and HS197, serovars 1 and 7 respectively) were cultured in tryptic soy agar (TSA) or tryptic soy broth (TSB; Difco Laboratories, Detroit, MI, USA) supplemented with 10 mg/ml nicotinamide adenine dinucleotide (NAD) and 5% bovine serum. Escherichia coli was routinely maintained in LB broth or agar supplemented with 100 mg/ml of ampicillin when containing the relevant plasmid. All bacterial strains were grown at 37 8C. 2.2. Nucleic acids manipulations Bacterial genomic DNA was obtained using DNeasy Blood & Tissue Kit (Qiagen, Germany). Plasmid DNA was prepared using QIAprep Spin Miniprep Kit (Qiagen, Germany). Total RNA was isolated by using TRIzol reagent (Invitrogen, USA). RNA samples were treated with RNasefree DNase I (Promega, USA). Restriction and DNA modification enzymes were purchased from TaKaRa (TaKaRa, Japan). 2.3. Suppression subtractive hybridization (SSH) Bacterial genome subtraction was performed following the user manual of the PCR-Select Bacterial Genome Subtraction Kit (Clontech, USA). Briefly, the tester Nagaskai (H. parasuis serovar 5, highly virulent) and the driver SW114 (H. parasuis serovar 3, non-virulent) genomic DNAs were digested with RsaI. The RsaI-digested tester DNA was subdivided into two portions, each of which was ligated with a different adaptor provided by the subtraction kit. After the ligation of tester DNA and adaptor was formed, two hybridizations were performed. In the first hybridization, an excess of RsaI-digested driver was added to each adaptor-ligated tester sample. The samples were heatdenatured and allowed to anneal. In the second hybridization, the two primary hybridization samples were mixed

together without denaturing. The entire population of molecules was subjected to amplification of the testerspecific sequences by PCR. The subtracted sample was diluted and used as template in this PCR. PCR Primer 1 (Table 1) alone was used as primer and the conditions of the PCR were 72 8C for 2 min, followed by 25 cycles at 94 8C for 30 s, 66 8C for 30 s and 72 8C for 1 min 30 s. In this amplification, only double stranded DNA with different adaptor sequences on each end was exponentially amplified. Next, this primary PCR product mixture was diluted and used as a template for the secondary PCR. In this secondary PCR, Nested Primer 1 and Nested Primer 2R (Table 1) were used. The PCR was conducted using 15 cycles of denaturation at 94 8C for 30 s, annealing at 68 8C for 30 s and extension at 72 8C for 1 min 30 s. In this secondary amplification, the nested PCR can further reduce background and enrich for tester-specific sequences. The PCR amplified products were cloned into pGEM1T-Easy vector (Promega, USA) and transformed into E. coli TOP10 competent cells according to the manual of the Advantage PCR Cloning Kit (Clontech, USA). Positive clones were screened on LB medium supplemented with X-gal, IPTG and ampicillin. 2.4. Analysis of SSH library by dot hybridization and PCR The dot hybridization procedure was used as previously described (Lancashire et al., 2007) for rapid screening of the SSH library for Nagasaki-specific cloned DNA fragments. The probes were prepared by using 6 mg of RsaIdigested Nagaskai and SW114 genomic DNA, which was separately labeled using digoxigenin (DIG)-High Prime (Roche, Germany). Plasmid DNA of all clones from the SSH library was transferred to a positively charged Nylon membrane (Amersham Pharmacia, USA). Duplicate blots were separately hybridized with Nagasaki or SW114 genomic DNA probes for 16 h at 68 8C. Washing and detection were carried out in accordance with the manufacturer’s instructions (DIG DNA Labeling and Detection Kit, Roche, Germany). Plasmids which showed stronger signals with the Nagaskai DNA than with SW114 DNA were sequenced. Sequence analysis was carried out by using the BLAST algorithm from the National Center for Biotechnology Information at the National Library of Medicine (http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi). According to the above gene sequence, PCR primers (Table 1) were designed to amplify the gene fragments from all 15 serovars of H. parasuis reference strains and the two Australian field isolates. PCR was conducted by initial denaturation at 95 8C for 5 min, followed by 30 cycles at 94 8C for 30 s, 49–54 8C for 30 s and 72 8C for 20–60 s, with a final extension at 72 8C for 10 min (Table 1). PCR products were used to confirm the presence of identified genes in different serovars. 2.5. Dot blot hybridization Fragments ssh1, ssh2, ssh8 and ssh12 were labeled with digoxigenin (DIG)-High Prime (Roche, Germany) and used as probes. About 1 mg genomic DNA of all 15 serovars of H. parasuis reference strains and the two Australian field

H. Zhou et al. / Veterinary Microbiology 144 (2010) 377–383

379

Table 1 Primers and main PCR conditions used in this study. Primers

Sequences (50 –30 )

Annealing temperature (8C)/extension time (s)

PCR Primer 1 Nested Primer 1 Nested Primer 2R SSH1U SSH1L SSH2U SSH2L SSH3U SSH3L SSH4U SSH4L SSH5U SSH5L SSH6U SSH6L SSH7U SSH7L SSH8U SSH8L SSH9U SSH9L SSH10U SSH10L SSH11U SSH11L SSH12U SSH12L SSH13U SSH13L SSH14U SSH14L SSH15U SSH15L 16SU 16SL

CTAATACGACTCACTATAGGGC TCGAGCGGCCGCCCGGGCAGGT AGCGTGGTCGCGGCCGAGGT ATGGTTTGGTTGTAATGGAGTATC AACAACGCCAGCTAGGCTTGTACT TGCCAATACGACCAAACGAGATAA GTACTTTCAGAGCCATTTACACTG TTTGAAGTGGAGTTTGCTGAGCAC ACTTCGGTTGCCATACCTATTGAG CAAACTGTGGCTTCACGCTTTCAT GCGAGAGTTACTTAAAACGATTAC AGCCCATTTTGGTTTCCTTCTATT CAGGAAGCCATTGTGGAAGTGAGT ATTCCGCATCTTGATTACTCATCC TGCTTTTAAATGGTAATGCGTATG TCGCCTATTGCTTGATCGTCCTAT TCTATGTTCATTCGGTCTAATAAC GCAAATTGCAGATAATTAGTCCCT AGCAAAAGAGTGTCAATGTTCAGT ATGACAACTTCTTTTCGAGCTACT CCGAATTTTGTCATCGAGATGACT GCTTTTTGTTCCTATCTCCAGGTC GAAGCAGCATCAACACCCGTGTAG ATATTTTTGGCATTTTTGATACAG TGAGTTGGCTTTCGTGCTCGTAGA CGTTGATGGCGAGATACATCCTTC TTATTACTTGCGTTTGTGCTACC AAAAAAGATTCTGATGGAGAGGTC TTTCAGGACGAGGGCCTACTAAAC TAGTTTGGCTAACTATTCCTAAGT AGAAGCCTGTGGATGATATACTTG CTGGTGCTGCTGGTTCTATCGGTTC TCAACCATTGGAACGTGTTTATAAG AGGGGTAGAATTCCACGTGTAGCG TTCCCGAAGGCACACTCTCATCTC

66/90 68/90

– –

51/45

563

50/30

456

52/20

209

51/20

287

51/30

405

49/30

471

50/20

233

49/20

292

50/60

877

54/20

283

49/20

237

51/20

259

51/20

247

49/30

451

54/20

273

–/30

368

isolates was spotted onto a positively charged membrane (Amersham Pharmacia, USA) for dot blot hybridization. 2.6. Experimental infection, RNA isolation and RT-PCR Animal experiments were carried out according to the International Guiding Principles for Biomedical Research Involving Animals-1985. Strain Nagasaki was inoculated into three 30-day-old H. parasuis free piglets by intraperitoneal injection at a dose of 1  109 colony-forming units (cfu). Pigs were humanely killed at 7 days post-infection and samples of lung were collected. Total RNA was isolated from infected tissues and treated with RNase-free DNase I for RT-PCR. After reverse transcription, the following cycles were performed 3 min at 95 8C and 28 amplification cycles (45 s 95 8C, 45 s 53 8C, 45 s 72 8C), SSH1U and SSH1L, SSH2U and SSH2L, SSH8U and SSH8L, SSH12U and SSH12L listed in Table 1 were used as primers respectively. The 16S rRNA of H. parasuis from the same sample was used as a control and the PCR was conducted as mentioned above using primers 16SU and 16SL (Table 1). Meanwhile, RNA without reverse transcriptase was diluted 1:100 with double distilled water and 5 ml served as template for control PCR. The RT-PCR was performed in triplicate.

Fragment size (bp)

3. Results 3.1. Identification of Nagasaki-specific genes A total of 191 clones were obtained after random insertion of PCR products into pGEM1T-Easy vector. The plasmid DNA extracted from these clones was used for rapid screening by dot hybridization. By comparing the dot blot results, 23 plasmids showed a stronger signal with the Nagasaki DNA than with the SW114 DNA (Fig. 1). The plasmids were sequenced to generate PCR primers for further PCR analysis. In the end, 15 subtracted genomic regions unique to strain Nagasaki were confirmed as positive clones. The GenBank

Fig. 1. Comparison on hybridization signal of 23 plasmids probed with Nagasaki and SW114 DNA by dot hybridization. (A) Nagasaki genomic DNA probe; (B) SW114 genomic DNA probe.

H. Zhou et al. / Veterinary Microbiology 144 (2010) 377–383

380

accession numbers and predicted function or property are provided in Table 2. 3.2. Presence of Nagasaki-specific fragments in other serovars Using the primers listed in Table 1, the presence of 15 Nagasaki-specific fragments was investigated in all 15 serovars of H. parasuis reference strains and the two Australian field isolates by PCR (Table 3). PCR results showed that eight Nagasaki-specific fragments – ssh1, ssh2, ssh3, ssh6, ssh8, ssh10, ssh11 and ssh12 – were present in three to five of most virulent serovars (1, 5, 10, 12, 13 and 14), in zero to two of the three moderately virulent serovars (2, 4 and 15) but were absent in the low virulent serovar (8) and the non-virulent serovars (3, 6, 7, 9 and 11) (Fig. 2). The fragments 1, 2, 8 and 12 which presented in most virulent serovars, but were absent in both serovar 1 isolates were selected for future study as described below. Fig. 2. Presence of fragments ssh1, ssh2, ssh3, ssh6, ssh8, ssh10, ssh11 and ssh12 in H. parasuis reference strains and field isolates by PCR. Lanes 1–17 represent strains 4, HS145, SW140, SW114, SW124, Nagasaki, 131, 174, HS197, C5, D74, H367, H465, H425, IA-84-17975, IA-84-22113 and SD84-15995 respectively; , negative control; +, plasmid DNA contain target fragments as positive control.

3.3. Dot blot hybridization Fragments ssh1, ssh2, ssh8 and ssh12 showed a positive signal when hybridized with the genomic DNA of serovars 5, 10, 12, 13, 14 and 15 reference strains (Fig. 3). This result further confirmed that these fragments were present in these reference strains which, along with serovar 1, are regarded as highly virulent.

Table 2 Genes of H. parasuis identified via SSH. Class

Fragment (Accession No.)

Genes/region name Organism

Predicted function or property

%Identity, E-value Accession No.

Cell surface

ssh1 (GS504184) ssh13 (GS504196) ssh15 (GS504198)

fhuA Haemophilus parasuis wbgY Haemophilus parasuis capD Haemophilus parasuis

Truncated outer membrane ferric hydroxamate receptor Putative glycosyltransferase/ lipopolysaccharide biosynthesis protein Polysaccharide biosynthesis protein CapD

99%, 0 CP001321 100%, 2E122 CP001321 99%, 2E135 CP001321

Metabolism and stress response

ssh2 (GS504185) ssh5 (GS504188) ssh9 (GS504192)

hsdR Haemophilus parasuis – Haemophilus parasuis – Haemophilus parasuis

Type I site-specific restriction-modification system, R (restriction) subunit Superfamily II DNA/RNA helicase, SNF2 family, ATP-dependent Methyltransferase type 11

97%, 0 CP001321 99%, 0 CP001321 100%, 0 CP001321

Phage

ssh6 (GS504189)

– Haemophilus parasuis

Phage phi-105 ORF25-like protein

99%, 0 DQ127973

Fimbria

ssh8 (GS504191)

fimB Haemophilus parasuis

Fimbrial assembly chaperone

99%, 4E144 CP001321

Hypothetical protein

ssh4 (GS504187) ssh7 (GS504190) ssh12 (GS504195)

– Haemophilus ducreyi 35000HP – Haemophilus parasuis OrfG Haemophilus parasuis

Conserved hypothetical protein

Hypothetical protein

68%,4E18 AE017143 98%, 3E113 ABKM01000030 98%, 1E124 CP001321

ssh3 (GS504186) ssh10 (GS504193) ssh11 (GS504194) ssh14 (GS504197)

Unknown

No homology to known genes

Unknown

– Haemophilus parasuis Unknown

Unknown No homology to known genes

97%, 4E132 DQ127926 Unknown

Unknown

No homology to known genes

Unknown

Unknown

Hypothetical protein

+ + + + + + +  + + + +   + + + + + + +  + + + + + +  +         +      +               +    + +    +      +    +     +      +

            +  +

+ +  + + +  + + +  + +  +

+ +  + + +  + +  + +  + +

+ + + + + + + + + + + +   +

15(SD-8415995) 11(H465) 10(H367) 9(D74) 8(C5) 7(HS197) 7(174)

381

Fig. 3. Presence of fragments ssh1, ssh2, ssh8 and ssh12 in H. parasuis reference strains and field isolates by dot blot hybridization. 1–17 represent strains 4, HS145, SW140, SW114, SW124, Nagasaki, 131, 174, HS197, C5, D74, H367, H465, H425, IA-84-17975, IA-84-22113 and SD84-15995 respectively.

Fig. 4. In vivo transcription of fragments ssh1, ssh2, ssh8 and ssh12 in experimental H. parasuis-infected pig lungs by RT-PCR. 1, ssh1; 2, ssh2; 3, ssh8; 4, ssh12; 5, H. parasuis 16S rRNA. (A) Samples with reverse transcriptase; (B) samples without reverse transcriptase; (C) positive control.

            +  + + + + + + + + + + + + + + + +                ssh1 ssh2 ssh3 ssh4 ssh5 ssh6 ssh7 ssh8 ssh9 ssh10 ssh11 ssh12 ssh13 ssh14 ssh15

              

        +      +

     +   +      +

              

6(131) 5(Nagasaki)

3.4. Identification of in vivo transcription

4(SW124) 3(SW114) 2(SW140) 1(HS145) 1(4)

Serovar (strain) Fragment /clone

Table 3 Presence of Nagasaki-specific fragments in other serovar reference strains and Australian field isolates.

12(H425)

13(IA-8417975)

14(IA-8422113)

H. Zhou et al. / Veterinary Microbiology 144 (2010) 377–383

In vivo transcription of fragments ssh1, ssh2, ssh8 and ssh12 were identified in total RNA samples extracted from all three experimentally infected pig lungs by RT-PCR (see Fig. 4 which for the purpose of illustration has been produced by using a composite sample of all three lungs). The RT-PCR products from all three lungs were confirmed by nucleotide sequencing. 4. Discussion Suppression subtractive hybridization was used in this study to identify the molecular difference between the reference strain of serovar 5 (Nagasaki) which is regarded as highly virulent and the reference strain of serovar 3 (SW 114) which is regarded as non-virulent (Kielstein and Rapp-Gabrielson, 1992). PCR data obtained for the various fragments showed certain difference between field isolates and the reference isolates belonging to the same serovar. The fragments ssh 9 and ssh15 are present in the H. parasuis reference strain of serovar 1 (4) but not in the field isolate of serovar 1 (HS145). Fragment ssh5 is present in the Australian field isolate of serovar 7 (HS197) but absent in the reference strain for serovar 7 (174). This may be caused by strain specific features. To date, none of the studies looking for potential virulence genes have examined multiple strains of a serovar in order to assess strain variation. Sack and

382

H. Zhou et al. / Veterinary Microbiology 144 (2010) 377–383

Baltes (2009) did examine 26 field isolates for five genes that were associated with the serovar 5 reference strain. The five fragments were present in some of the field isolates but Sack and Baltes (2009) did not report the serovar of the field isolates, making it impossible to identify if the variable presence reported by them was associated with variation within a serovar or variation across serovars. The Kielstein and Rapp-Gabrielson serotyping scheme shows a strong linkage to virulence. As an example, the virulence of an Australian isolate of serovar 4 in the study of Turni and Blackall (2007) was very similar to that shown by the serovar 4 reference strain SW124 by Kielstein and Rapp-Gabrielson (1992). This correlation suggests that possibly some cell surface antigens may be important virulence factors. In this study, indeed, some DNA fragments associated with cell surface antigens were identified. Fragment ssh1 corresponds to the fhuA gene, a gene encodes the truncated outer membrane ferric hydroxamate receptor. The FhuA protein is one of the targets of the pig humoral immune response and is immunogenic and capable of stimulating anti-FhuA antibodies during the course of natural infection (Del Rı´o et al., 2006). Another two fragments, ssh13 and ssh15, also encode cell surface-associated proteins. Fragment ssh13 (wbgY) encodes a glycosyltransferase/lipopolysaccharide biosynthesis protein and fragment ssh15 (capD) encodes a polysaccharide biosynthesis protein. These fragments are located near to each other based on the genomic sequence of H. parasuis strain SH0165 (published in GenBank – CP001321) (Yue et al., 2009). These fragments, based on the predicted functions, were associated with the Gramnegative bacterial capsule. Cell surface glycoconjugates are known to play a critical role in interaction between bacteria and surrounding environment (Whitfield, 2006). High-molecular-weight capsular polysaccharides are well established virulence factors, often acting by protecting the cell from opsonophagocytosis and complementmediated killing (Rick and Silver, 1996; Jann and Jann, 1997). Fragments ssh2, ssh6 and ssh10 were first identified by DNA microarray from H. parasuis grown under in vitro growth conditions mimicking in vivo environments (Melnikow et al., 2005). The HsdR subunit encoded by ssh2 is a component of type I site-specific restrictionmodification system (Jin et al., 2008). This system not only protects the bacterium from foreign DNA invasion by cleaving DNA at specific recognition sites, but also directly controls the expression of microbial virulence factors of Helicobacter pylori (Bjo¨rkholm et al., 2002). Fragment ssh6 encodes the phage phi-105 ORF25-like protein. Although fragment ssh10 was also identified in a previous study (Melnikow et al., 2005), the function is unknown. Fragment ssh8 (fimB) encodes fimbrial assembly chaperone which was first identified by Munch et al. (1992). We studied the in vivo transcription of four (ssh1, ssh2, ssh8 and ssh12) of the eight fragments that were commonly present in the virulent serovars. We selected these four fragments for a variety of reasons. Three of the four selected fragments have been examined in other

studies – ssh1 as fhuA by Del Rı´o et al. (2006), ssh2 as hsdR by Melnikow et al. (2005) and ssh8 as fimB by Munch et al. (1992). The other fragments were not included in the expression work because they were absent in more than one virulent serovar (ssh3, ssh10, ssh 11) or were present in more than one moderately virulent serovar (ssh6). We found a total of 7 fragments (ssh3, 4, 6, 7, 10, 11 and 14) which were present in the Nagasaki strain but which could not be located in the genome of H. parasuis strain SH0165, a field isolate of serovar 5 from Chinese pigs (Yue et al., 2009). There are several possible explanations for this finding. Firstly, the absence of the fragments from the sequenced strain SH0165 could be another example of strain variation. Secondly, we noted some gaps in the genome of H. parasuis strain SH0165 (CP001321). As an example, Del Rı´o et al. (2006) reported the presence of the complete Fhu region in H. parasuis Nagasaki, the serovar 5 reference strain. We also sequenced this region (data are not shown). Hence, we expected to be able to locate the fhuC, fhuD, fhuB and fhuA (i.e. ssh1) in H. parasuis strain SH0165. However, it is possible only to locate fhuC and fhuA in strain SH0165, with a gap in the gene map between fhuC and fhuA. In a prior similar study looking for virulence-associated factors in H. parasuis, Sack and Baltes (2009) identified five potential factors. This prior study identified a putative haemolysin operon (hhdBA), a putative iron transporter (cirA) and two putative phage-related genes (Sack and Baltes, 2009). Our study using the same virulent strain (Nagasaki) has identified entirely different potential virulence factors. Both Sack and Baltes (2009) and the current study have found that the potential virulence factors identified were not universally present in the virulent serovars as recognized by Kielstein and RappGabrielson (1992) but were absent from the non-virulent serovars. The presence of these potential virulence factors in most but not all of the well characterized, virulent serovar reference strains (especially virulent serovar 1) indicates that further studies and data are needed before a full understanding of the virulence and pathogenesis of H. parasuis is possible. Acknowledgements This work was supported by grants from National Natural Science Foundation (30600448), Beijing Nova of Science and Technology (2004B23) and the National Program for High Technology Research and Development of China (863 Program, 2006AA10A206). References Bjo¨rkholm, B.M., Guruge, J.L., Oh, J.D., Syder, A.J., Salama, N., Guillemin, K., Falkow, S., Nilsson, C., Falk, P.G., Engstrand, L., Gordon, J.I., 2002. Colonization of germ-free transgenic mice with genotyped Helicobacter pylori strains from a case–control study of gastric cancer reveals a correlation between host responses and HsdS components of type I restriction-modification systems. J. Biol. Chem. 277, 34191– 34197. Cai, X., Chen, H., Blackall, P.J., Yin, Z., Wang, L., Liu, Z., Jin, M., 2005. Serological characterization of Haemophilus parasuis isolates from China. Vet. Microbiol. 111, 231–236.

H. Zhou et al. / Veterinary Microbiology 144 (2010) 377–383 Del Rı´o, M.L., Navas, J., Martı´n, A.J., Gutie´rrez, C.B., Rodrı´guez-Barbosa, J.I., Rodrı´guez Ferri, E.F., 2006. Molecular characterization of Haemophilus parasuis ferric hydroxamate uptake (fhu) genes and constitutive expression of the FhuA receptor. Vet. Res. 37, 49–59. Diatchenko, L., Lau, Y.F., Campbell, A.P., Chenchik, A., Moqadam, F., Huang, B., Lukyanov, S., Lukyanov, K., Gurskaya, N., Sverdlov, E.D., Siebert, P.D., 1996. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc. Natl. Acad. Sci. 93, 6025–6030. Gurskaya, N.G., Diatchenko, L., Chenchik, A., Siebert, P.D., Khaspekov, G.L., Lukyanov, K.A., Vagner, L.L., Ermolaeva, O.D., Lukyanov, S.A., Sverdlov, E.D., 1996. Equalizing cDNA subtraction based on selective suppression of polymerase chain reaction: cloning of Jurkat cell transcripts induced by phytohemagglutinin and phorbol 12-myristate 13-acetate. Anal. Biochem. 240, 90–97. Hill, C.E., Metcalf, D.S., MacInnes, J.I., 2003. A search for virulence genes of Haemophilus parasuis using differential display RT-PCR. Vet. Microbiol. 96, 189–202. Jann, K., Jann, B., 1997. In: Sussman, M. (Ed.), Escherichia coli: Mechanisms of Virulence. Cambridge Univ., pp. 113–143. Jin, H., Wan, Y., Zhou, R., Li, L., Luo, R., Zhang, S., Hu, J., Langford, P.R., Chen, H., 2008. Identification of gene transcribed by Haemophilus parasuis in necrotic porcine lung through the selective capture of transcribed sequences (SCOTS). Environ. Microbiol. 10, 3326–3336. Kielstein, P., Rapp-Gabrielson, V.J., 1992. Designation of 15 serovars of Haemophilus parasuis on the basis of immunodiffusion using heatstable antigen extracts. J. Clin. Microbiol. 30, 862–865. Lancashire, J.F., Turni, C., Blackall, P.J., Jennings, M.P., 2007. Rapid and efficient screening of a representational difference analysis library using reverse Southern hybridisation: identification of genetic differences between Haemophilus parasuis isolates. J. Microbiol. Methods 68, 326–330.

383

Mahairas, G.G., Sabo, P.J., Hickey, M.J., Singh, D.C., Stover, C.K., 1996. Molecular analysis of genetic differences between Mycobacterium bovis BCG and virulent M. bovis. J. Bacteriol. 178, 1274–1282. Melnikow, E., Dornan, S., Sargent, C., Duszenko, M., Evans, G., Gunkel, N., Selzer, P.M., Ullrich, H.J., 2005. Microarray analysis of Haemophilus parasuis gene expression under in vitro growth conditions mimicking the in vivo environment. Vet. Microbiol. 110, 255– 263. Munch, S., Grund, S., Kruger, M., 1992. Fimbriae and membranes on Haemophilus parasuis. Zentralbl. Veterinarmed. B 39, 59–64. Oliveira, S., Pijoan, C., 2004. Haemophilus parasuis: new trends on diagnosis, epidemiology and control. Vet. Microbiol. 99, 1–12. Rick, P.D., Silver, R.P., 1996. In: Neidhardt, F.C. (Ed.), Escherichia coli and Salmonella: Cellullar and Molecular Biology. ASM Press, Washington, DC, pp. 104–122. Rubies, X., Kielstein, P., Costs, L.I., Riera, P., Artigas, C., Espuna, E., 1999. Prevalence of Haemophilus parasuis serovars isolated in Spain from 1993 to 1997. Vet. Microbiol. 66, 245–248. Sack, M., Baltes, N., 2009. Identification of novel potential virulenceassociated factors in Haemophilus parasuis. Vet. Microbiol. 136, 382–386. Straus, D., Ausubel, F.M., 1990. Genomic subtraction for cloning DNA corresponding to deletion mutations. Proc. Natl. Acad. Sci. 87, 1889– 1893. Turni, C., Blackall, P.J., 2007. Comparison of sampling sites and detection methods for Haemophilus parasuis. Aust. Vet. J. 85, 177– 184. Whitfield, C., 2006. Biosynthesis and assembly of capsular polysaccharides in Escherichia coli. Annu. Rev. Biochem. 75, 39–68. Yue, M., Yang, F., Yang, J., Bei, W., Cai, X., Chen, L., Dong, J., Zhou, R., Jin, M., Jin, Q., Chen, H., 2009. Complete genome sequence of Haemophilus parasuis SH0165. J. Bacteriol. 191 (4), 1359–1360.