Identification of sequence elements containing signals for replication and encapsidation of the reovirus M1 genome segment

VIROLOGY

186,377-388

(1992)

Identification of Sequence Elements Containing Signals for Replication and Encapsidation of the Reovirus Ml Genome Segment’ S. ZCU AND E. G. BROWN2 Department

of Microbiology

and Immunology,

Faculty of Medicine,

Received August

University

of Ottawa, 45 1 Smyfh Road, Ottawa, Ontario, Canada K 1H 8M5

12, 199 1; accepted

October 22, 199 1

In reovirus the genetic signals that control genome replication and encapsidation are unknown. Serial passage of reovirus results in the accumulation of deletion mutants that contain fragments of genome segments. The smallest fragments found in deletion mutants will consist of the minimum essential sequences for genome replication and assembly. Tl X T3 reassortants containing the L2 segment from T3 and the M3 segment derived from Tl generate deletions in segment Ml on serial passage. Fragments of Ml segments were produced by serial passage, characterized by PAGE and Northern blotting before amplification by PCR, cloning, and sequencing. Thirteen of the smallest deletion fragments were sequenced. All of the smallest fragments contained sequences from both termini of segment Ml. The smallest fragment was 344 nucleotides long. The consensus sequences consisted of 132-l 35 nucleotides from the 5’ end of the plus strand and 183-l 85 nucleotides from the 3’ end of the plus strand. It is concluded that these regions contain all the signals necessary for the replication and assembly of the Ml genome segment. o 1992 Academic Press.

Inc.

INTRODUCTION

mechanism that ensures that 10 unique RNA segments are assembled together in each nascent particle remains unknown. The terminal regions of all 10 genome segments share GCUA at their 5’ end and UCAUC at their 3’ end (Antczak et al., 1982) and adjacent to these common end-specific structures is a segment-specific stretch of nucleotides that is complementary to a stretch at the opposite end of the segment (Gaillard et al., 1982). Although these short terminal regions are expected to be important for specific functions required in replication and assembly they are probably not sufficient in themselves to signal all the events in replication and assembly. Studies with wound tumor virus (WTV), the type member of the genus phytoreovirus of the reoviridae, suggested that each genome segment must contain at least two operational sequence domains for genome packaging: one that specifies that it is a viral and not a cellular RNA-perhaps the conserved terminal sequences-and a second that specifies that it is a particular RNA genome segment-perhaps the segmentspecific terminal inverted repeat sequences (Anzola et a/., 1987). It was further proposed that the signals required for replication of the WTV genome reside within the terminal domains of the individual segments due to their location and their conservation in deletion mutants (Xu et al., 1989; Dall et al., 1990). Serial passage of viruses at high multiplicity of infection can generate deletion mutants (reviewed by Perrault, 1981). All genome remnants present in deletion mutants that are derived from linear genomes and

Mammalian reovirus is the prototype of orthoreovirus, one of the six genera of the family reoviridae. Reovirus has 10 double-stranded RNA genome segments. For the genome of reovirus to be replicated and assembled it must contain both transcriptase and replicase promoters as well as signals for encapsidation. Encapsidation involves the gathering of genome segments such that one copy of each segment is incorporated into each nascent subviral particle. Thus sorting and exclusion mechanisms are required to control the process of genome assembly. Reovirus replication begins with the transcription of plus strand RNA from each of the 10 minus strands of parental RNA within the uncoated parental subviral particles (reviewed by Joklik, 1974; Zarbl and Milward, 1983; Schiff and Fields, 1990). The 10 full-length capped plus strand copies are assembled together with viral proteins to form the nascent viral core where minus strand synthesis occurs upon the plus strand template (Sukuma and Watanabe, 1972; Acs et al., 1971; Zweerink er al., 1972). Although it is known that each reovirion contains one of each of the 10 genome segments (Spendlove et al., 1970; Millward and Graham, 1970; Kavenoff eta/., 1975) the signals that control the replication of each genome segment and the ’ Sequence data from this article have been deposited with the EMSUGenBank Data Libraries under Accession Nos. M77643M77655. ’ To whom reprint requests should be addressed. 377

0042-6822192

$3.00

CopyrIght 0 1992 by Academic Press, Inc. All rights of reproduction an any form resewed.

378

ZOU AND BROWN

have been characterized conserve one or both termini of the virus (reviewed by Schlesinger, 1988). Reovirus type 3 Dearing normally generates deletion mutations in genome segments Ll and L3 (Ahmed et a/., 1980a,b; Brown et al., 1983). The ts mutant C(447) (Ahmed and Graham, 1977) and specific Tl X T3 reassortants (Brown et al., 1983) can produce deletions in the Ml genome segment and in the latter instance in the L2 genome segment as well. The M 1 genome segment is 2304 nucleotides long containing a single large open reading frame from nucleotide 14 to 2224 leaving 13 and 80 noncoding nucleotides at the 5’and 3’ends, respectively (Wiener et a/., 1989). The M 1 gene codes for a single protein called ~2 that is a minor component of the virus core present as 12 copies per virion. In studies using genetic reassortants, the ~2 protein controls the extent of cytopathic effect and plaque size in L929 cells (Moody and Joklik, 1989) and myocarditis in the mouse (Sherry and Fields, 1989) as well as replication in heart cells in vitro (Matoba et al., 1991). The role of the ~2 protein as a regulator of viral cytopathology may be related to its low level of translation in viva (Roner et a/., 1989) where host components limit the level of ~2 expression. Type 1 (strain Lang) and type 3 (strain Dearing) reassor-tants (Tl X T3), that possess the type 3 L2 segment and type 1 M3 segment, generate M 1 segment deletions on serial passage (Brown et a/., 1983). Since genome segments with deletions can still replicate and be assembled into progeny virus, it was reasoned that the Ml fragments must maintain the signals essential for their replication and assembly and further, that the resultant genome fragments in the smallest deletion mutants will consist of the minimum genetic signals for replication and assembly. Here we present the screening of Ml deletion fragments by Northern blot analysis with terminus-specific probes and the cloning and sequencing of the smallest fragments of Ml genome segments. These results demonstrate the significance of both 5’ and 3’ terminal sequences in the replication and assembly of the reovirus M 1 genome segment. MATERIALS

AND METHODS

Viruses and cells Reovirus Tl Lang and T3 Dearing were obtained from B. N. Fields. Tl X T3 reassor-tants and their highpassage stocks were produced previously for the genetic analysis of the generation of the phenomenon of defective interference (Brown et a/., 1983). M 1 deletions occurred in specific reassortants containing the L2 genome segment of type 3 and the M3 segment of type 1. Table 1 lists the parental origin of segments for 14 reassortant viruses that generate deletion mutants,

TABLE1 PARENTALORIGINOF~EGMENTSIN Tl (LANG)~ T~(DEARING) REASSORTANTSGENOME SEGMENTS Clone

Ll

EBl EB47 EB68 EB74 EB86 EB96 EB98 EB108 EB126 EB129 EB140 G2 H9 H30

13 13 13 13 13 13 13 1 3 3 3 13 3 3

L2

3 3 3 3 3 3

L3 11 1 11 1 3 13 11 1 3 1 1 11 13 3

Ml

1 1 3

3 3 3 1

3

M2

M3

3 1 3 1 3 1 1 1 3 3 1 1 1 3

1 1 1 1 13 1 1 1 1 1 1 13 13 3

Sl

s2

11 11 11 11 3 11 13 1 1 3 1

3

1 3 1 1 111 3 3

s3 3 11 3 3 3 3 13 3 3 1 3 3 13

s4 1 3 1 1 1 3 1 3 1 3

13 reassortants that generate Ml deletion and 1 that does not, H30. Two independent high-passage (1 O-l 2 passages) stocks were produced for most of these reassortants and are labeled A and B. These stocks were passaged once more before analysis. Viruses were cultivated in L929 cells grown in suspension or stationary culture in Joklik-modified MEM supplemented with fetal bovine serum to 5%. Electrophoresis

of dsRNA

32P-labeled cytoplasmic extracts of dsRNA were prepared by a modification of the method of Sharpe et al. (1978) that included DNase I treatment. Cells in 60-mm dishes were infected with 250 ~1 of virus stock and labeled in the presence of actinomycin-D before lysis in a buffer containing NP40, 0.5%; NaCI, 150 mM; TrisHCI, pH 7.4, 20 mM; and MgCI,, 10 mM when CPE was detectable (2-3 days). The cytoplasmic fraction from each dish was treated with 200 Kunitz units of DNase I (Sigma Chemical Co.) for 1 hr at 37” followed by the addition of SDS to 1% and proteinase K to 100 pg/ml and further incubation at 37” for 1 hr. The samples were ethanol precipitated, dried, and dissolved in 200 ~1 sample buffer before electrophoresis; 10 ~1 aliquots were applied to each sample well. dsRNA was subjected to electrophoresis according to the method of Laemmli (1970) on 25-cm long, 10% acr-ylamide, 0.133% N,N’-methylenebisacrylamide gels. Electrophoresis was at 100 V until the bromphenol blue exited the gel (overnight). Northern

blotting

dsRNA fractionated by SDS-PAGE was electrophoretically transferred to nylon membrane (Zeta-Probe) as

379

REOVIRUS Ml DELETION MUTANTS

described by Bodkin and Knudson (1985). Oligonucleotide probes were synthesized that were complementary to the 18 nucleotides at the 3’ end of the + and sense strands of the M 1 genome segment, M 1 5’- and M 1 5’ +, respectively (Antczak et a/., 1982). Probes were 5’-end-labeled using T-[~*P]ATP and polynucleotide kinase. The hybridization was done for 2 hr at 42’ and was followed by 4 washes at 21’ in 2X SSC for 5 min each and 2 washes at 42” in 2X SSC for 15 min each. Reverse transcription and polymerase chain reaction Cytoplasmic extracts of infected cells were used as a source of dsRNA for amplification by reverse transcription and polymerase chain reaction (PCR). Cytoplasmic extracts (prepared without DNase 1 treatment) were dissolved in 100 mM NaCI; 10 mM Tris-HCI, pH 7.6; 1 mM EDTA; 1% SDS; and 100 pg/ml proteinase K; followed by incubation at 37” for 30 min before phenol/chloroform extraction (twice), chloroform extraction, and ethanol precipitation with 0.1 vol of 2.5 M sodium acetate, pH 5.4, and 2.5 vol of ethanol (Sambrook ef a/., 1989). The dsRNA was denatured in 4.65 ~1of 90% dimethyl sulfoxide, 10% 10 mMTris-HCI, pH 7.4, by heating at 50” for 45 min prior to reverse transcription. The samples were added to a reverse transcription mix (60 pl total vol) containing 100 mM TrisHCI, pH 8.3, 130 mM KCI, 10 mM MgCI,, 25 mn/l dithiothreitol, 1 rnM each dNTP, 100 ng of each primer (Ml 5’- and Ml 5’ +), and 60 units AMV reverse transcriptase, and incubated at 42’ for 1 hr. The cDNA/RNA hybrid products derived from the reverse transcription were directly amplified by PCR using automated thermal cyclers. For each sample, a 100~~1reaction was set up which contained 1 yl of reaction product from the reverse transcription, 100 ng M 1 5’- primer, 100 ng M 1 5’ + primer, 50 mM KCI, 10 mM Tris-HCI, pH 8.4, 1.5 mM MgCI,, 0.01% (w/v) gelatin, 0.2 mM of each dNTP, and 2 units of Taq DNA polymerase. Forty cycles were used for each reaction (94” 30 set; 48” 30 set; 72” 1 min.). Reaction products (dsDNA) were extracted with phenol/chloroform and precipitated with ammonium acetate, ethanol, and glycogen (20 pg) before separation by electrophoresis in 1.6% agarose gels. After ethidium bromide staining, the bands of amplified M 1 deletion fragments were cut out from the gel under long wave uv light and recovered by electroelution and precipitation. The dsDNA was further purified by phenol/chloroform extraction and Sephadex G-50 spun column chromatography, precipitated, and dissolved in water for cloning. Cloning and sequencing fragments of segment Ml The recovered dsDNA of M 1 deletion fragments was first end-repaired using DNA polymerase I Klenow frag-

ment in a 1~-PI reaction containing 50 mM Tris-HCI, pH 7.6, 10 mM MgCI,, 0.1 mM of each dNTP, and 2 units of Klenow fragment, for 30 min at 2 lo. The reaction was stopped by heating (70” for 5 min) followed by phosphorylation of 5’ termini by supplementing the reaction with 4 ~1of 25% polyethylene glycol8000,5 mM ATP, 5 mM DlT, 1 mg BSA, and 2 units of T4 polynucleotide kinase; reaction was for 0.5 hr at 37” before heating at 70” for 5 min. The dsDNA was blunt-end ligated into the Smal site of dephosphorylated pGEM7Zf(+) by adding 2 ~1 each of 200 ng/pl vector and 1 unit/PI T4 DNA ligase and incubating at 21’ for 4 hr. Escherichia co/i DH5a! were transformed by electroporation with ligation mix and screened by (Ycomplementation. The Ml deletion fragments cloned in pGEM-7Zf(+) were sequenced using the Sequenase kit and protocol (United States Biochemical Corp.). Both strands of DNA were sequenced using the Sp6 and T7 primers. The sequence data were analyzed by the University of Wisconsin Genetics Computer Group Sequence Analysis Software Package and the IBI DNAlProtein Sequence Analysis programs. RESULTS Frequency and size of Ml deletion fragments The dsRNA of serially passaged stocks of reovirus reassortants was analyzed by SDS-PAGE. Two independent high-passage stocks were analyzed for most of the reassonants. Novel bands that did not correspond with the positions of the 10 intact genome segments were observed in all samples except H9 and the low-passage prototype strains, Tl and T3 (Fig. 1). By extrapolating from the known sizes of the intact genome segments (Wiener et al., 1989) the smallest dsRNA fragments were estimated to be 400 base-pairs long. The dsRNA of the same passaged viruses was probed in Northern blot to detect fragments of the Ml genome segment. Probes specific for the termini were used; M 1 5’ - contained 18 nucleotides corresponding to the 5’ end of the - strand, and M 1 5’ + contained 18 nucleotides corresponding to the 5’ end of the + strand. Figure 2 shows the Northern blot data. 32P-labeled dsRNA and unlabeled dsRNA were analyzed in adjacent wells for each high-passage reassortant stock. Most of the deleted fragments detected in Fig. 1 were from the Ml segment as indicated by hybridization with Ml segment-specific probes and all of those that reacted with one end specific probe also hybridized to the other indicating that they contained sequences from both termini (Fig. 2, panels 1 and 2). All of the small fragments of approximately 400 base pairs

380

ZOU AND BROWN

rz L&J a B ,+7.-i mla mla m w Ll/L2/L3-Ml, IM2 -M3

iI:M3’-

of dsRNA from high-passage Tl X T3 reassortants. Double-stranded RNA was labeled with 3zP and extracted from FIG. 1. Electrophoresis infected cells before SDS-PAGE on 10% polyacrylamide gels. Low passage controls of serotype 1 (Lang) and serotype 3 (Dearing) are indicated as Tl and T3. All of the reassortants were passage number 13 except EB96, EB126, H9, and H30 that were passage number 11. Two independent clonal isolates of specific reassortants were subjected to serial passage and are labeled A and B. The deletion fragments that were eventually cloned and sequenced are indicated with arrows.

were derived from the Ml gene except in the EBIA, EB140A and H30 reassortants. Those fragments that did not hybridize with either probe were probably derived from other segments that generated deletions as seen for H30 that generated deletions in segments Ll and L3 but not Ml. M 1 segment fragments were observed in all high-passage stocks containing deletions except H30, which would not be predicted to generate M 1 deletion mutants since it contains both L2 and M3 genome segments derived from T3. The particular passage of H9 shown in Fig. 2 did not contain detectable deletions although this reassortant has generated M 1 deletions previously (unpublished). Different numbers and sizes of deletion fragments were observed in different high-passage reassortants; from 1 to 8 fragment sizes were observed in different reassor-tant stocks. However, the Ml deletion fragments were not uniformly distributed in size but instead clustered into 3 groups of approximately 400, 640, and

1200 nucleotides (Fig. 3). The nonrandom size distribution of Ml deletion fragments implied that the process of deletion is not a totally random process but rather some sequence elements in the Ml segment direct or in some way are predisposed to deletion. The smallest M 1 deletion fragments were approximately 400 base pairs long and were the most prevalent size, suggesting that they represent a minimum allowable size. The smallest size group of deletion fragments were selected for sequence analysis; these have been indicated by arrows in Fig. 1. The smallest fragments were observed for serial passage B of EB140 and both independent serial passages (A and B) of EB 1,47, 86, 98, and G2. Cloning and sequencing fragments

the smallest

Ml deletion

Since all the Ml fragments detected on Northern blots conserved both termini of segment Ml it was

REOVIRUS Ml EBl

EB47

EB66

EB74

T, ~3 A B A B A B A B P n,p nlP n P VP n P nlP n P NP n P n 7, ii

T,

T3

DELETION

EB86

EB96

EB108

EB126

A

A

A

A

B

B

381

MUTANTS

B

G2

EB140

B

Tl

T3

A

B

A

B

EB E8 96 129

H9 I+30

Al

Ml

A2

FIG. 2. Northern blot of dsRNAfrom analysis. 32P-labeled (p) and unlabeled the 32P-labeled M 1 5’ - probe and the same letter prefix contained the same done.

high-passageT1 X T3 Reassortants. The same viruses analyzed in Fig. 1 were subjected to Northern blot (n) dsRNA were transferred to nylon membranes. The panels labeled with number 1 were hybridized with panels labeled number 2 were hybridized with the 32P-labeled M 1 5’ + probe. The panels labeled with the samples. The isotope in the 32P-labeled dsRNA in panel A2 had decayed by the time blot hybridization was

possible to amplify cDNA of these fragments using the polymerase chain reaction. The sizes of dsDNA produced on PCR corresponded to the pattern of M 1 fragments seen on Northern blot analysis (data not shown). The smallest size Ml deletion fragments of 350-450

+ t 610

+ * 4 t

4 +

+ *

+

4 **

t

+ +t++

nucleotides that were amplified by PCR were purified on agarose gels, cloned and sequenced and the sequences were compared to that of the intact Tl Lang Ml segment (Zou and Brown, in press). Thirteen fragments of the Tl Ml segment were derived from nine

4

+ * * ++ ++

t* +* t+

t 1110

860

Number

of

+ + t 1360

* +

+ ++

+* t 1610

+ d-7 1760

2304

Nucleotides

FIG. 3. Size distribution of 55 Ml fragments produced by deletion mutation. The sizes of Ml fragments identified by blot hybridization in Fig. 2 were estimated from their mobility relative to the mobility of the intact genome segments. Each diamond represents a single Ml fragment band.

382

ZOU AND BROWN TABLE 2

TERMINAL REGIONSOFTHE M 1 SEGMENTFOUND IN DELETEDFRAGMENTS Fragment

No. bases

5' ende

lAl-8 183-3 47A3-2 47A2-4 47B5-2 47B4-3 4784-5 98Al O-l 98Al O-4 98811-l 14068-l 9 G2A9-1 G2Bl l-2

390 392 378 367 370 411 377 373 393 367 401 344 403

162-163 176-177 161-162 150 146-147 177-178 152-l 54 188-190 171 132-135 147 140 173-174

3' ende 227-228 215-216 216-217 217 223-224 233-234 223-225 183-185 222 232-235 254 204 229-230

a The 5’ and 3’ end sequences of each fragment are coterminal with the intact Ml segment for the sizes indicated; where there was ambiguity as to the origin of nucleotides surrounding the joining region, the terminal regions are shown as ranges.

(Table 400 base pairs were not obtained from EB86A and B, only DNA that resulted from mispriming events (see below). Comparison of the sequence of M 1 fragments with the intact Ml segment showed that (1) the smallest fragment was 344 nucleotides in length; (2) all fragments conserved the 3’and S’ends of the Ml segment; (3) the consensus sequence from the 5’ end was 132-135 nucleotides long; (4) the consensus sequence from the 3’ end was 183-l 85 nucleotides long; and (5) all the fragments could have been the result of single internal deletion events (Table 2). Several clones with the same breakpoints were sequenced from specific high-passage stocks: 1B3-3, 1B3-11, and 1B4-2; 47A3-2 and 47A2-9; 47A2-4 and 47A3-10; 98Bl l-l and 98B12-2; G2A9-1 and G2A9-18; and G2Bl l-2 and G2Bll-17 (Fig. 4). Mutations were observed in some of the fragments; the G2 clones showed the most variation with 4 and 5 nucleotide mismatches in G2Bl l-l 7 and G2A918. None of the fragments derived from different stocks had the same sequence. Products of the PCR reaction that were the result of mispriming events were also cloned and sequenced. A 154 nucleotide-long product containing the 3’ end of the M 1 gene was cloned from the PCR products of the unpassaged Tl control. This was presumably the product of mispriming by the M 1 5’ + primer on 11 nucleotides of the minus strand of the M 1 segment that were complementary to the 3’ end of the primer (data not shown). DNA molecules that contained both primers at their termini flanking sequences that were totally unreserially

passaged

2). M 1-specific

stocks

DNA

of

reassortant

fragments

of

viruses

approximately

lated to the Ml gene were obtained from several stocks; a 432-nucleotide product was obtained from EB86A and B, G2A and B, and EB1B; a 232-nucleotide product was obtained from 86A and B; and a 153-nucleotide product was obtained from G2B and EB86A (data not shown). None of these 3 PCR products contained regions of homology with each other or the M 1 genome segment. Comparison of the sequence at the joining sites and their location in the Ml segment Alignment of the Ml deletion mutants according to the site of deletion (where the terminal regions are joined) did not indicate a common sequence motif on either side of the junction of the terminal regions (data not shown). It was not possible to unambiguously assign the deletion site since 9 out of 13 deletion fragments had 1 to 3 repeated nucleotides at the junction of the terminal sequences that could have been derived from either the 5’ or 3’ ends of the M 1 sequence (Fig. 4). These short regions of homology at the junctions of the terminal regions may have been involved in directing the formation of deletion mutants. Scrutiny of the sequences upstream and downstream of the junctions of the terminal regions showed no sequence element of significance. When the ends of the 5’ and 3 sequences at the joining sites are mapped to the sequence of the M 1 gene it is seen that the break points for the 3’ end are more tightly clustered than the break points for the 5’ ends (Fig. 5). Only 2 of the deletion fragments (47A3-2 and 47B43) maintained the original reading frame at the joining site to produce proteins of 94 and 105 amino acids that consisted of the amino and carboxy terminal portions of the ~2 protein. All of the other deletion fragments would be predicted to terminate translation, at or near the breaking/joining site to produce proteins of 43-70 amino acids. These protein products would not be expected to play a role in replication or assembly even if the intact ~2 protein played an unknown role since they consist of small fractions of the intact protein. Predicted secondary structure involving the termini of the Ml segment The method of Zucker was applied for predicting the most stable secondary structure of a hypothetical 320 nucleotide-long fragment (M 1Hyp) composed of the 5’ and 3’ consensus sequences of the Ml deletion mutants. Ml Hyp could form an extensively base-paired structure with a predicted free energy of -103.6 kcaI/ mol (Fig. 6A). It is interesting to note that the noncoding 3’ end forms a hair-pin structure that is flanked by sequences that are complementary to 11 nucleotides

Tlnl lAl-8 183-3 183-11 184-2 47A3-2 47A2-9 47A2-4 47A3-10 4785-2 4784-3 4784-5 98110-l 98110-4 98811-l 98812-2 14088-19 G2A9-1 GZAP-18 GZBll-2 62811-17

TlM 1/11-a 183-3 183-11 184-2 47A3-2 47112-9 47A2-4 47A3-10 4705-2 4784-3 4784-5 98AlO-l 98AlO-4 98811-1 98812-2 14088-19 G2A9-1 G2A9-18 GZBll-2 GZBll-17

TlMl 111-8 183-3 183-11 104-2 47A3-2 47A2-9 47A2-4 47A3-10 4785-2 4784-3 4704-5 98110-l 98*10-4 98811-l 98812-2 14088-19 GZlip-1 6219-18 GZBll-2 G2811-17

_.._____._

__._____..

_____..__.

40 t

30

l

.-G---.-..

__._...._.

. . ..___...

_.._......

____._-___

____._-.

A.

ACAUCGCAG" "CCUGCCWG

50 t

70 t

l

_____.___.

_...___-__

___..._.__

_.....----

_-__------

.._._._...

____.__.--

___..__.--

.._.__....

___....__.

_..---_.._

.._____...

GCCUAWGGA C"tC"AGAA"

60

GUGGAWCAC GWCMWGA

l

80

90 t

. . . ..-___.

__..-...__

_____.....

CGWUGGAG"

100 . 1

110

120 * 130 *

_.__-.....

. . .._.__._

. ..__._.-.

_.........

-.-.____..

_.___.....

. . ..--.---

.--_......

._......-_

___.._____

. .._._____

____..__..

AGACGCUGGG CCUGAUGCW AUGACGUUUC AUAUCMGA"

140 * 150 *

__._..____

__________

.._______.

._________

______....

.._...._..

CAUGACUAUG "0WGGA"CA

______..__

--__-----. .._______

. .._._._._

..-_______

._____.._.

_____..___

_..._____.

_________.

._._._____

._.___....

______.___

_....._.._

_........_

__________ ____....__

2050 *

.--___._..

.-._._____

. .._....__

.-._......

.--___._..

------.-..

._._______

..-_._....

_._.--.---

____--._.-

._._--._._

. .._.--_--

_.._.-._-_

_...------

____.-._..

._._.-

2240 *

l

2060

.--______.

_---.-..-.

.--_...._.

--._....--

.-.__.____

.-._____..

---_._.._.

“GUGACACC”

CCAAGGCUP”

__________

2250 t

l

2070

______-.__

.___..-.-.

____._.._.

__..._-._.

__..__-__.

______-___

.___._-._-

GCCCCUAGG”

GAUCMGCW

_____...._

o-.-

l

2260

l

2080

___.______

_______-__

.___----__

___--.-._.

__.._._._.

___._.--__

__------__

CAAUGGGGW

MUCACWAC ____.__._.

__.___.-._

”

2270

l

2090

_-______._

_-_____...

_-___._..-

_._._..---

.._._..---

_-________

______-.-.

ACGCGGCGGG

CAMAAG”” .~--~~~~~-

_-____.---

.

2280

l

2100

__________

________._

__________

___.___-.-

___.____._

___.______

________-_

CUMGACUAC

AGWCACGA __________

________..

l

22%

l

2110 2120

__________

_.___.__._

_.________

_._______.

_.________

__._._____

__________

C”ACGCGC””

.

2300

UUUGCAU~UCACAWGAC ___.______

.-.---.~..

____

._._

.___

._._

____

__._

____

CAUC

t

2304

____._____

. . ..--...-

. ..-cm....

“.-.

..-____...

..-___....

. ..___-.__

_____.....

_____---__

_-_-----__

_-___._...

_-.--.-...

________.-

______._.-

-....---A.

__________

__._

_.._

.

2130 CGCGAAG”A” . .._____--

--.......-

*

2140 GAGAUGAGCC . ..____._.

..-_____._

l

2150 “C”CWCCtt ____.__._.

l

2160

. . . . . . . . . .

CCAUAGCAC” __________

-..--“----

t

2170 CGACGGGGGO _._.-.__.-

.-“98

t

2180 CUGCAUACM __________

-----e-B

*

2190 “GCGAGACUA ----“-----

l

2200 GCWUCCGA” _--___...-

_____._.__

--g . . . . . .._..

l

2210

.

170 AWUUAGAUG

180

190

CUGACWGGC _---------

----.-b

. . ..--a

t

2220

GAUAUGAGGC "CGCGACGW

FIG. 4. Sequence of Ml fragments. Twenty clones of M 1 fragments are shown; several clones were obtained from the same high-passage stock and thus have the same breakage/joining point. The sequence of the Tl Ml genome segment is indicated at the top of each column; only sequence differences are indicated for fragments; identical nucleotides are indicated with a dash. Where there was uncertainty as to the origin of nucleotides around the break point these nucleotides have been shown in lower case symbols. The M 1 fragments are named according to the reassortant of origin followed by a clone number. The deleted portlons of fragments are indicated by solid lines.

..-___._..

______._.. __.___..__ . .._..._.. __________ ---.----___-___-----..--.t---- __________ ____

ACAUCCWAG

ACGGUAUCUC

______..._

GUGAUCCGUG

2230 t

. . . . . ..CGG

__________

_____..__. __..._.___ _....._._. _.....-... .._._._-___-_._.----. . . . . .._.. ._...-___.._._.._._.. ..._.._._._________ .___._____ _...______ --“IJB

____.--..-

l

160 GWACAGUA"

____._.___ __________ ________.. _________. _______.__ _-____.___ __________ __._..__._ ._.._...___.____.._. . . . . . . . ..- ____._...-_.__...... . .._______ ..__._.._. ____._____ __________ _____.._._ ______.__. ._..._.... ._._..-... .______-__ _-----.--- ----____--.. .. . .._.. ._...-__...-..___.-.---____.... . . .._..._ __...___._

. . . . . . .

. .

_____..___

*

_..._--.--

20

l

G"CA"GGC""

10

Gc"A""CtCG

AUC...."'

384

ZOU AND BROWN 1 GCUAUUCGCGGUCAUGGCUUACAUCGCAGUUCCUGCGGUGGUGGAUUCACGUUCMGUGAGGCUAUUGGACUGCUAGAAUCGUUUGGAGUAGACGCUGGG JAUGUUAGAUGGAUAUGAGGCUGGCGACGI UAUCGAUGCAC 9 T

Lb-IT

[y

-.--b7i3-21

iyit

[

IIII

t

I

I

2041 2141 GAGAUGAGGCUCUCGUGCGGCCAUAGCACUGGACGGGGGGCUGCAUACAAUGCGAGACUAGCUUUCCGAUCUGACUUGGCGUGAUCCGUGACAUGCGUAG 2241 UGUGACACCUGCCCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC FIG. 5. Location of break-points in the M 1 segment. The terminal regions of the M 1 segment are shown with arrows linking the specific regions that were joined in fragments that had been sequenced. Where the exact location of the break point is uncertain multiple arrows on the same line indicate the possible break points.

from the 5’ end adjacent to the common 5’ tetrameric sequence. The existence of the latter structure would appear to depend on the existence of the former long hair-pin structure. In this structure the first nucleotide of the initiation site, AUG, is base-paired to the first nucleotide of the UGA termination site. The sequestering of the translation initiator and terminator in a juxtaposed secondary structure could be relevant to controlling Ml gene expression. The terminal secondary structure was predicted to be the same as this for several of the Ml deletion fragments detected in this study, 47B4-3, 1B3-3, and G2A9-1 (data not shown). It was not possible to compute the most stable structure of the entire Ml segment since it exceeds the maximum size that could be computed, but a series of sequences that possessed the terminal regions as well as sequences from the interior of the M 1 segment that together encompassed all of the M 1 genome segment were analyzed by the method of Zucker. The association of the terminal noncoding regions was the same for all these predicted secondary structures indicating that at least when analyzed in portions the most stable secondary structures maintain the association of the termini (Fig. 6). DISCUSSION Deletion mutation in reovirus can involve the Ll, L2, L3, and Ml genome segments. The genome fragments in deletion mutants can still replicate and be

assembled into progeny virus and therefore have maintained the signals essential for their replication and encapsidation, even though replication of the deletion mutant requires helper virus. Ml deletion fragments were identified in high-passage stocks of reovirus reassortants by Northern blot analysis. Since all the fragments of Ml that were detected contained both termini they were amplified by PCR of cDNA using endspecific primers. The smallest fragments were cloned and sequenced. The results from 13 fragments showed that the minimal length of the Ml deletion fragments was 344 nucleotides, and 132-l 35 nucleotides from the 5’ end of the Ml genome segment and 183-l 85 nucleotides from the 3’ end were conserved in all 13 M 1 deletion fragments. Therefore, it can be deduced that these two terminal regions contain the minimum of sequence elements essential for replication and encapsidation of this segment. It is not known what part of this sequence harbors specific signals for the recognition events in replication and encapsidation. In addition to specific sequence signals, the deleted fragment might also have a limit in length and 344 nucleotides could be the minimum length essential for the replication and/or encapsidation. Some of the sequence may function as spacers required to separate binding sites that form specific secondary or tertiary structures or multicomponent complexes. It is possible that protein-RNA or RNA-RNA intermediates are formed in replication and that spatial and steric parameters must be satisfied.

REOVIRUS Ml

DELETION

MUTANTS

385

M~HYP

A

D FIG. 6. Optimal folding of the plus sense strand of hypothetical Ml fragments. (A) The most stable secondary structure of a hypothetical M 1 fragment that is 320 nucleotides long consisting of 135 nucleotides derived from the 5’ end and 185 nucleotides derived from the 3’ end; this structure would have a free energy of -103.6 kcal/mol. The initiation (AUG) and termination (UGA) codons are shown. The lowest free-energy predicted structures are also shown for four molecules that encompass the entire M 1 segment: (B), a 1 140-nucleotide RNA consisting of 570 nucleotides from both ends of the M 1 segment, free energy of -3 12.6 kcal/mol; (C), a 1170nucleotide RNA consisting of 870 nucleotides from the 3’end plus 300 nucleotides from the 5’end, free energy of -320.0 kcal/mol; (D), a 1200-nucleotide RNA consisting of 300 nucleotides from each end plus nucleotides 871 to 1470, free energy of -359.3 kcal/mol; (E), a 1 134nucleotide RNA consisting of 300 nucleotides from the 5 end and 834 nucleotides derived from the 3’end, free energy of -323.8 kcallmol. A secondary structure motif was predicted to be common to all the different RNA molecules and is indicated in (A) as the structure bounded by the wavy line and brackets and is bracketed in (6) to (E).

Each reovirus segment must maintain a dsRNA-dependent transcriptase promoter at the 3’ end of the minus strand and a ssRNA-dependent replicase promoter at the 3’ end of the plus strand as well as those sequences necessary for assembly. Assembly requires signals for encapsidation and sorting/exclusion since only one of each segment is assembled into each virion. In assembly, segments are recognized as

being reoviral as well as being a specific genome segment. The sorting and excluding signals may be identical or separate depending on the mechanism of achieving each function. The terminal tetramer at the 5’ end and the terminal pentamer at the 3’ end common to all the 10 segments could be the signals recognized as identifying the viral genome (Antczak et a/., 1982). The segment-specific identifier will be elsewhere since it

386

ZOU AND BROWN

will differ between segments. Antczak et a/. (1982) sequenced the termini of all of the reovirus genome segments and analyzed the sequences for structures that would link or network all of the segments together but such structures could not be found. It is possible that assembly signals involve terminal or interterminal secondary structures formed in conjunction with proteins. Secondary structure predictions of the consensus sequences present in Ml deletion fragments produce an extensively base-paired structure with a free energy of -103.6 kcal/mol; the noncoding regions at the termini produce a panhandle hairpin structure that anneals the first nucleotide of the initiation and termination codons. It is possible that once initiation occurs on such a template that is normally inaccessible to ribosomes that translational termination would open up the basepaired terminal structure to make the initiation site accessible for reinitiation. Such a gene may be shut off under certain conditions but may ensure continued expression once turned on. Ml RNA is poorly translated in viva but is efficiently translated in vitro (Roner et al., 1989) indicating that if this is due to secondary structure then host factors are involved. Roner et al. (1989) showed that modifications of the 5’ end of the Sl mRNA that allowed the formation of terminal secondary structures resulted in decreased translatability. There is direct evidence for the association of the termini of influenza A and B virus (Stoekle et al., 1987; Hsu et a/., 1987) and in WTV (Dal1 et al., 1990). It is possible that host and viral factors operate in replication and assembly of reovirus. There is no direct evidence that the Ml deletion fragments are defective interfering RNAs; however, they are defective and have a replicative advantage relative to wild type since they are amplified on culturing and thus replicate at the expense of wild-type virus. Mutations were observed in the primer binding region of 2 clones, in the 5’end of 98Al O-4 and the 3’end of G2Bl l-l 7; it is possible that the substitutions in the primer region represent errors in primer synthesis. To assess substitution in the 18-nucleotide terminal regions direct RNA sequencing is required. Some of the point mutations outside of the primer-binding sites may have been created during the PCR step but many of them were probably produced during viral replication since the mutations were nonrandomly distributed among the 20 Ml fragments that were sequenced; most clones, 11 of 20, did not have substitutions; 1 substitution was seen in 4 of 20; 2 substitutions in 2 of 20; 1 of 20 had each of 3, 4, and 5 substitutions. PCR was done at low dNTP concentration (0.2 mn/l) to avoid misincorporation due to mass-action effects. In other sequence analyses of mumps PCR products (performed in our laboratory) we have obtained a l/1500

rate of nucleotide mismatch when duplicate clones were sequenced (Brown et a/., 1991). On this basis we would have expected 5 mutations due to PCR out of the 24 mutations observed. The small Ml fragments detected by Northern blot of both passaged stocks of EB86 were not amplified by PCR. This may have been due to extensive or specific substitutions in the primer binding region that inhibited primer-dependent reverse transcription or DNA amplification. All deletion mutants of viruses with linear genomes that have been characterized contain at least one termini of the standard virus (Schlesinger, 1988). It may be a general feature of all viruses with segmented RNA genomes that both terminal sequences play critical roles in genome transcription, replication, and packaging (Nuss and Summers, 1984). Conserved common 5’ and 3’ terminal nucleotides and adjacent segmentspecific nucleotide sequences were found in influenza A and B virus (Stoeckle et al., 1987) and in wound tumor virus (Nuss and Summers, 1984; Anzola et a/., 1987; Nuss and Dali, 1990). In influenza A, the 22 5’ terminal and the 26 3’terminal bases of segment 8 viral RNA were sufficient to provide the signals for RNA transcription, RNA replication, and packaging of RNA into influenza virus particles (Luytjes et al., 1989); the 15 nucleotide 3’ terminus contains the promoter for transcription (Parvin et a/., 1989). In Sindbis virus, 162 nucleotides at the 5’ terminus and 19 nucleotides at the 3’terminus are required for replication and packaging of the* genomes (Levis et al., 1986). The 3’ 134 nucleotides of brome mosaic virus RNA are sufficient to serve as template for the viral replicase (Miller et al., 1986). The smallest deletion mutant described for influenza virus contained 83-84 nucleotides from the 5’ end and 95-96 nucleotides from the 3’ end of the plus strand of segment 8 (Jennings et al., 1983). Deletion mutants of other dsRNA viruses have all conserved their terminal regions. The fragments of 2 deletion mutants of WlV possessed consensus sequences of 319 nucleotides from the 5’ end and 205 nucleotides from the 3’ end. Sequence analysis of a deletion mutant of yeast ScV “killer” dsRNA segment M, termed S-dsRNA (suppressive), showed that it contains 232 nucleotides from the 5’ end and 550 nucleotides from the 3’ end (Theile et a/., 1984). The smallest dsRNA fragment described to date is a 315-nucleotide fragment of the polyhedrin gene of cytoplasmic polyhedrosis virus (CPV), a reovirus which infects insects, consisting of 12 1 nucleotides from the 5’ end and 191 nucleotides from the 3’ end (reported by Nuss, 1988). The similarity in size of the regions seen to be conserved in CPV and reovirus suggest that this may be the location of replication and encapsidation signals in all members of the Reoviridae.

REOVIRUS Ml

DELETION

With the identification of the sequence elements sufficient for replication and encapsidation of the M 1 segment, it becomes possible to design plasmid vectors for the introduction of foreign genes into reovirus via cloned DNA intermediates. This will further the analysis of structure-function relationships in reovirus genes through the application of in vitro mutagenesis for the purposes of reverse genetics. Recently, reovirus has been produced by transfection with ssRNA and/or dsRNA together with their in vitro-translated products in the presence of helper virus (Roner et a/., 1990). Our future work includes the production of a packaging and selection system for the introduction of genome segments into reovirus. The defined consensus terminal sequences can then be altered by in vitro mutagenesis to identify those elements that control specific aspects of replication and assembly.

MUTANTS

387

specific binding of wound tumor virus transcripts by a host factor: Involvement of both terminal nucleotide domains. Virology 179, 599-608. GAILLARD, R. K., LI, 1. K.-K., KEENE,J. D., and JOKLIK,W. K. (1982). The sequences at the termini of four genes of the three reovirus serotypes. Virology 121, 320-326. Hsu, M.-T., PARVIN, 1. D., GUPTA, S., KRYSTAL, M., and PALESE, P. (1987). Genomic RNAs of influenza viruses are held in a circular conformation in virions and in infected cells by a terminal panhandle. Proc. Natl. Acad. Sci. USA 84, 8140-8144. JENNINGS,P. A., FINCH, I. T., WINTER, G., and ROBERTSON,J. S. (1983). Does the higher order structure of the influenza virus ribonucleoprotein guide sequence rearrangements in influenza viral RNA. Cell 34, 619-627. JOKLIK,W. K. (1974). Reproduction of the reoviridae. In “Comprehensive Virology” (H. Fraenkel-Conrat and R. R. Wagner, Eds.), Vol. 2, pp. 231-334 Plenum, NY. KAVENOFF, R., TALCOVE, D., and MUDD, J. A. (1975). Genome-sized RNA from reovirus particles. Proc. Nat/. Acad. Sci. USA 72,43174321. LEVIS, R., WEISS, B. G., TSIANG, M.. HUANG, H., and SCHLESINGER,S. (1986). Deletion mapping of Sindbis virus DI RNAs derived from cDNAs defines the sequences essential for replication and packaging. Cell 44, 137-l 45. LUYTJES,W., KRYSTAL, M., ENAMI, M., PARVIN, J. D., and PALESE, P. (1989). Amplification, expression, and packaging of a foreign gene by influenza virus. Cell 59, 1 107-l 1 13. MATOBA, Y., SHERRY,B., FIELDS, B. N.. and SMITH, T. W. (1991). Identification of the viral genes responsible for growth of strains of reovirus in cultured mouse heart cells. /. C/in. Invest. 87, 1628-l 633. MILLER, W. A.. BUJARSKI,1. J.. DREHER,T. W., and HALL, T. C. (1986). Minus-strand initiation by brome mosaic virus replicase within the 3’ tRNA-like structure of native and modified RNA templates. 1. Mol. Biol. 187, 537. MILLWARD, S., and GRAHAM, A. F. (1970). Structural studies on reovirus: discontinuities in the genome. Proc. Nat/. Acad. Sci. USA 85,422-429. MOODY, M. D., and JOKLIK, W. K. (1989). The function of reovirus proteins during the reovirus multiplication cycle: Analysis using monoreassortants. Virology 173, 437-446. Nuss, D. L. (1988). Deletion mutants of double-stranded RNA genetic elements found in plants and fungi. In “RNA Genetics” (E. Domingo, J. J. Holland, and P. Alquist, Eds.), Vol. 2, pp. 187-210. CRC Press, Boca Raton, FL. Nuss, D. L., and SUMMERS, D. (1984). Variant dsRNAs associated with transmission-defective isolates of wound tumor virus represent terminally conserved remnants of genome segments. Virology 133, 276-288. Nuss, D. L., and DALL, D. J. (1990). Structural and functional properties of plant reovirus genomes. Adv. virus Res. 38, 272-276. PARVIN, 1. D., PALESE, P., HONDA, A., ISHIHAMA. A., and KRYSTAL.M. (1989). Promoter analysis of influenza virus RNA polymerase. J. Viral. 63, 5142-5152. PERRAULT, I. (1981). Origin and replication of defective interfering particles. Cur. Topics in Micro and Immunol. 93, 15 l-207. RONER, M. R.. GAILLARD, R. K.. and JOKLIK.W. K. (1989). Control of reovirus messenger RNA translation efficiency by the regions upstream of initiation codons. Virology 168, 292-301. RONER. M. R., SUTPHIN, L. A., and JOKLIK.W. K. (1990). Reovirus RNA is infectious. Virology 179, 845-852. SUKUMA. S.. and WATANABE, Y. (1972). Reovirus replicase-directed synthesis of double stranded ribonucleic acid. J. Viral. 10, 628638. SAMBROOK, J.. FRITSCH, E. F., and MANIATIS, T. (1989). “Molecular

ACKNOWLEDGMENTS This work was supported by the Natural Sciences and Engineering Research Council of Canada Grant OGP0041771. Helpful criticism was provided by K. E. Wright and K. Dimock.

REFERENCES AC% G., SCHONBERG, M., CHRISTMAN, J., LEVIN, D. H., and SILVERSTEIN,S. C. (1971). Mechanism of reovirus double-stranded ribonucleic acid synthesis in vivo and in vitro. f. Viral. 8, 684-689. AHMED, R., and GRAHAM. A. F. (1977). Persistent infections in L cells with temperature-sensitive mutants of reovirus. 1. Viral. 23, 250262. AHMED, R., CHAKRABORTY,P. R., and FIELDS, 6. N. (1980a). Genetic variation during lytic virus infection: high passage stocks of reovirus contain temperature-sensitive mutants. f. Viral. 34, 285287. AHMED, R., CHAKRABORTY.P. R., GRAHAM, A. F., RAMIG, R. F., and FIELDS, 6. N. (1980b). Genetic variation during persistent reovirus infection: Presence of extragenically suppressed temperaturesensitive lesions in wild-type virus isolated from persistently infected cells. J. Viral. 34, 383-389. ANTCZAK, J. B., CHMELO, R., PICKUP, D. J., and JOKLIK,W. K. (1982). Sequences at both termini of the ten genes of reovirus serotype 3 (strain Dearing). Virology 121, 307-319. ANZOLA, J. V., Xu, Z., ASAMIZU, T., and Nuss, D. L. (1987). Segmentspecific inverted repeats found adjacent to conserved terminal sequences in wound tumor virus genome and defective interfering RNAs. Proc. Nat/. Acad. Sci. USA 84, 8301-8305. BODKIN, D. K., and KNUDSON, D. L. (1985). Assessment of sequence relatedness of double-stranded RNA genes by RNA-RNA blot hybridization. 1. Viral. Methods 10, 45-52. BROWN, E. G., FURESZ,J., DIMOCK, K., YAROSH,W., and CONTRERAS,G. (1991). Nucleotide sequence analysis of Urabe mumps vaccine strain that caused meningitis in vaccine recipients. Vaccine, in press. BROWN, E. G., NIBERT. M. L.. and FIELDS, B. N. (1983). The L2 gene of reovirus serotype 3 controls the capacity to interfere, accumulate deletions and establish persistent infection. In “Double-Stranded RNA Viruses” (R. W. Compans and D. H. L. Bishop, Eds.), pp. 275-287. Elsevier, Amsterdam/New York. DALL, D. J., ANZOLA, J. V., Xu, Z., and Nuss, D. L. (1990). Structure-

.

388

ZOU AND BROWN

Cloning: A Laboratory Manual” 2nd ed., pp. 176-l 81. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. SCHIFF, L. A., and FIELDS, B. N. (1990). Reovirus and their replication. ln “Virology” (B. N. Fields, D. M. Knipe, eta/., Eds.), 2nd ed., pp. 1289-l 292. Raven Press, New York. SCHLESINGER,S. (1988). The generation and amplification of defective interfering RNAs. ln “RNA Genetics” (E. Domingo, J. J. Holland, and P. Alquist, Eds.), Vol. 2, pp. 167-l 85. CRC Press, Boca Raton, FL. SHARPE,A. H., RAMIG, R. F., MUSTOE, T. A., and FIELDS, B. N. (1978). A genetic map of reovirus. I. Correlation of genome RNAs between serotypes 1, 2, and 3. Virology 84, 63-74. SHERRY,B., and FIELDS, B. N. (1989). The reovirus Ml gene, encoding a viral core protein, is associated with the myocarditic phenotype of a reovirus variant. 1. viral. 63, 4850-4856. SPENDLOVE, R. S., McLAIN, M. E., and LENNET~E, E. H. (1970). Enhancement of reovirus infectivity by extracellular removal or alteration of the virus capsid by proteolytic enzymes. 1. Gen. Viral. 8, 83-94. STOECKLE,M. Y., SHAW, M. W., and CHOPPIN, P. W. (1987). Segmentspecific and common nucleotide sequences in the noncoding regions of influenza B virus genome RNAs. Proc. Nat/. Acad. Sci. USA 84, 2703-2707.

THEILE, D. J., HANNIG, E. M., and LEIBOWITZ.J. (1984). Genome structure and expression of a defective interfering mutant of the killer virus of yeast. Vkology 137, 20-31. WIENER, J. R., BARTLEIT, J. A., and JOKLIK, W. K. (1989). The sequences of reovirus serotype 3 genome segments Ml and M3 encoding the minor protein p2 and the major nonstructural protein rNS, respectively. Virology 169, 293-304. Xu, Z., ANZOLA, J. V., NALIN, C. M., and Nuss, II. L. (1989). The ?-terminal sequence of a wound tumor virus transcript can influence conformational and functional properties associated with the 5’-terminus. virology 170, 51 1-522. ZARBL, H., and MILLWARD, S. (1983). The reovirus multiplication cycle. ln “The Reoviridae” (W. K. Joklik. Ed.), pp. 107-l 97. Plenum, New York. Zou, S., and BROWN, E. G. (1992). Nucleotide sequence comparison of the Ml genome segment of reovirus type 1 Lang and type 3 Dearing. Virus Research (in press). ZUCKER, M., and STIEGLER, P. (1981). Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information. Nucleic Acids Res. 9, 133-148. ZWEERINK,H. J., ITO, Y., and MATSUHISA, T. (1972). Synthesis of reovirus double-stranded RNA within virion-like particles. Virology 50, 349-358.