- Email: [email protected]
Identification of Sheep Endogenous Beta-Retroviruses with Uterus-Specific Expression in the Pregnant Mongolian Ewe
Journal of Integrative Agriculture
May 2013
2013, 12(5): 884-891
RESEARCH ARTICLE
Identification of Sheep Endogenous Beta-Retroviruses with Uterus-Specific Expression in the Pregnant Mongolian Ewe QI Jing-wei, XU Meng-jie, LIU Shu-ying, ZHANG Yu-fei, LIU Yue, ZHANG Ya-kun and CAO Gui-fang College of Veterinary Medicine, Inner Mongolia Agricultural University, Huhhot 010018, P.R.China
Abstract The sheep genome harbours approximately 20 copies of endogenous beta-retroviruses (enJSRVs), and circumstantial evidence suggests that enJSRVs might play a role in mammalian reproduction, particularly placental morphogenesis. This study was aimed to assess the expression of mRNAs of an enJSRV and its receptor, HYAL2, in the uterus and conceptuses of Mongolian ewes throughout gestation, using real-time reverse transcription polymerase chain reaction and in situ hybridization analysis. The results showed that enJSRV and HYAL2 mRNAs were found to be expressed throughout gestation in the endometrium, chorion, placenta, and conceptus. The enJSRV mRNA was most abundant in the placenta on day 90 of pregnancy, in the endometrium on day 30 and 50, and in the chorion on day 70 and 110. However, HYAL2 mRNA was most abundant in the endometrium on day 30. These differences were all significantly different from each other (P<0.01). In situ hybridization showed that enJSRV and HYAL2 mRNAs were specifically expressed in endometrial luminal epithelium and glandular epithelium, trophoblastic giant binucleated cells (BNCs), endometrial caruncles, placental cotyledons, stroma, trophectoderm, as well as multinucleated syncytia of the placenta and blood vessel endothelial cells. Collectively, little is known about the molecular mechanisms by which trophoblastic differentiation and multinucleated syncytia formation are regulated by enJSRVs. However, the temporal and spatial distributions of enJSRV expression in the uterus and conceptus indicate that differentiation of BNCs and the formation of a multinucleated syncytiotrophoblast involve enJSRV and possibly its cellular receptor, HYAL2. Therefore, enJSRV and HYAL2 appear to play important roles in the female reproductive physiology in this breed of sheep. Key words: enJSRV, HYAL2, expression, real-time reverse transcription polymerase chain reaction, in situ hybridization hybridization, Mongolian ewe
INTRODUCTION Endogenous retroviruses (ERVs) account for a substantial portion of the genetic pool of every animal species (e.g., ~8% of the human genome). Despite their overwhelming abundance in nature, many questions on the basic biology of ERVs remain unanswered (Paces 2002). The biological relevance of ERVs in mammals has been debated intensely. Generally, ERVs are tran-
scriptionally silent and are often defective. However, several of them maintain at least some intact open reading frames that can be expressed and are associated with beneficial effects to the host (Lander et al. 2001). Therefore, the endogenous beta-retroviruses (enJSRVs) of small mammals offer a perfect model for studying the biological relevance of ERVs. Up to now, there have been no reports on expression of enJSRV and its receptor HYAL2 in the uterus or conceptus of Mongolian ewes (Wang 2008; Qi et al. 2012).
Received 17 May, 2012 Accepted 23 October, 2012 QI Jing-wei, E-mail: [email protected]; Correspondence LIU Shu-ying, E-mail: [email protected]
© 2013, CAAS. All rights reserved. Published by Elsevier Ltd. doi:10.1016/S2095-3119(13)60306-8
Identification of Sheep Endogenous Beta-Retroviruses with Uterus-Specific Expression in the Pregnant Mongolian Ewe
The genome of all mammals is colonized by ERVs derived from retroviruses that have invaded the host during evolution, which has led to persistent integration into the host DNA. Repeated retroviral integrations have occurred over many millions of years. Consequently, ERVs are transmitted to descendants, as are the other host genes (Lander et al. 2001; Paces 2002). The function of ERVs is not clear, but some of them might have biological functions in conceptus implantation, cell fusion and placental morphogenesis (Palmarini et al. 2001, 2004; DeMartini et al. 2003; Arnaud et al. 2007). Researchers have studied the expression of ERVs in the genital tract and placenta of the human and mouse for several decades (DeHaven et al. 1998). There are various opinions on their significance in the evolution of mammals (Stoye 2000; Muir 2004). Several ERVs, including ERV-3 and HERV-W, play important roles in the formation of the placental syncytiotrophoblast (Mi et al. 2000; Frendo et al. 2003; Rote et al. 2004). The protein product of the HERV-W envelope (env) gene is a membrane glycoprotein that induces the formation of syncytiotrophoblast upon interaction with the HYAL2 receptor (Blond et al. 2000). Thus, the biological interactions between ERVs and their hosts are dynamic processes and there have been co-adaptive genetic changes that have favoured the host in sheep (Arnaud et al. 2007). However, little is known about the mechanisms that regulate syncytial formation and trophoblastic differentiation during placentation. The aim of our studies was to quantify the expression levels of enJSRV and HYAL2 mRNAs during gestation in the uterus and conceptus of Mongolian ewes and to detect the loci where transcriptional active genes are located, using real-time reverse transcription polymerase chain reaction and in situ hybridization. Increased knowledge of enJSRV and HYAL2 expression loci and the mechanisms underlying enJSRV viral repression will be useful in further studying on the suppression of local immune recognition of the conceptus and in placental morphogenesis.
885
intercaruncular uterus and conceptus were quantified by real-time RT-PCR (Figs. 1-2). Overall, enJSRV and HYAL2 mRNAs were detected in every tissue examined, including the endometrium, chorion, placenta, and conceptus at all times of pregnancy (day 30, 50, 70, 90, 110, and 130). The abundance of enJSRV mRNA was the greatest in the placenta on day 90 (2.5-fold), in the endometrium on day 30 (3.0-fold) and 50 (3.2-fold), as well as in the chorine on day 70 (3.4-fold) and 110 (3.8-fold), whereas HYAL2 mRNA was most abundant in the endometrium on day 30 (1.8-fold). All of these changes from baseline were statistically significant (P<0.01).
In situ hybridization In situ hybridization was used to determine the location of enJSRV and HYAL2 mRNAs. Positive signals for enJSRV and HYAL2 mRNAs were present in the en-
Fig. 1 Relative expression levels of enJSRV mRNA in the endometrium, chorion, placenta, and conceptus. The expression of enJSRV mRNA was most abundant in the placenta on day 90 (2.5-fold), in the endometrium on day 30 (3.0-fold) and 50 (3.2fold), as well as in the chorion on day 70 (3.4-fold) and 110 (3.8fold). All of these changes from the control level were statistically significant (P<0.01). The expression of enJSRV mRNA in the placenta at day 30 of pregnancy was used as a control value. All data are presented as 2-ΔΔCt values with standard errors (SE). The same as below.
RESULTS enJSRV and HYAL2 mRNAs in the uterus and conceptus tissues The contents of enJSRV and HYAL2 mRNAs in the
Fig. 2 Relative expression levels of HYAL2 mRNA in the endometrium, chorion, placenta, and conceptus. HYAL2 mRNA was most abundant in the endometrium on day 30 (1.8-fold; ** P<0.01). The expression of HYAL2 mRNA in placenta at day 30 was taken as the control level.
© 2013, CAAS. All rights reserved. Published by Elsevier Ltd.
886
dometrial luminal epithelium (LE) and glandular epithelium (GE), trophoblastic giant binucleate cells (BNC), endometrial caruncles (Car), placental cotyledons (Cot), stroma (S), trophectoderm (Tr), as well as in multinucleated syncytia of the placenta (SP) and blood vessel endothelial cells from all tissues regardless of gestational day. In the negative controls, the tested tissues did not show positive signals when the sections were analyzed with DIG-labelled sense probes, thus confirming the specificity of the tests (Figs. 3-7).
DISCUSSION Both enJSRV and its receptor HYAL2 were expressed dynamically in the Mongolian ewe uterus and conceptus during pregnancy. The abundance of enJSRV mRNA peaked significantly in the placenta on day 90 of pregnancy, in the endometrium on day 30 and 50, and in the chorion on day 70 and 110, whereas HYAL2 mRNA was most abundant in endometrium on day 30. Consistent with these findings, the temporal and cellspecific changes in the expression of enJSRV and HYAL2 occurred in the uterine and placental tissues. The
QI Jing-wei et al.
enJSRV and HYAL2 mRNAs were mainly expressed in the endometrial luminal epithelium and glandular epithelium, trophoblastic giant binucleate cells, endometrial caruncles, placental cotyledons, stroma, trophectoderm, as well as multinucleated syncytia of the placenta and blood vessel endothelial cells regardless of gestational day. The dynamic and differential expression patterns of enJSRV and HYAL2 during pregnancy indicates that they are possibly involved in placental development and uterine remodification. In mammals, enJSRV and HYAL2 coordinate control in promoting placental morphogenesis and regulate normal uterine development during gestation (Arnaud 2008). Black S G et al. (2010) found that enJSRVs form viral particles that are released into the uterine lumen of sheep and enJSRVs-RNAs belonging to only the most recently integrated enJSRV loci were packaged into viral particles and transmitted to the trophectoderm. Their results support the hypothesis that intact enJSRV loci could potentially transduce the conceptus trophectoderm. Moreover, enJSRV and HYAL2 also play a biological role during ontogenesis in the foetus (Armezzani 2011). Our novel results provide powerful support for the hypothesis that enJSRV and its receptor HYAL2 might
Fig. 3 The expression of enJSRV and HYAL2 mRNAs in the endometrium by in situ hybridization. Cross sections of the endometrium from 30, 50 and 130 gestational days (GD) were hybridized with DIG-labeled anti-sense and sense probes. The endometrial luminal epithelium (LE), the glandular epithelium (GE), trophoblastic binucleate cells (BNC), stroma (S), and blood vessel endothelial cells (V) show positive reactivity using anti-sense probe (marked with the abbreviation capital letter). The negative reaction was showed with sense probe.
© 2013, CAAS. All rights reserved. Published by Elsevier Ltd.
Identification of Sheep Endogenous Beta-Retroviruses with Uterus-Specific Expression in the Pregnant Mongolian Ewe
887
Fig. 4 The expression of enJSRV and HYAL2 mRNAs in the chorion by in situ hybridization. Cross sections of the chorion from 30, 50 and 130 GD were hybridized with DIG-labeled anti-sense and sense probes. The trophoblast binucleate cells (BNC), multinucleate syncytial plaque (SP), trophectoderm (Tr) show positive reactivity using anti-sense probe (marked with the abbreviation capital letter).
Fig. 5 The expression of enJSRV and HYAL2 mRNAs in the placenta by in situ hybridization. Cross sections of the placenta from 30, 50 and 130 GD were hybridized with DIG-labeled anti-sense and sense probes. The glandular epithelium (GE), endometrial caruncle (Car), placental cotyledon (Cot), stroma (S) and trophectoderm (Tr) show positive reactivity using anti-sense probe (marked with the abbreviation capital letter).
have beneficial physiological roles for the host. In sheep, uterine development involves differentia-
tion of the endometrial glandular epithelium (GE) from the luminal epithelium (LE), specification and develop-
© 2013, CAAS. All rights reserved. Published by Elsevier Ltd.
888
QI Jing-wei et al.
Fig. 6 The expression of enJSRV and HYAL2 mRNAs in the conceptus of day 30 of pregnancy by in situ hybridization. Many cells of the conceptus show positive reactivity hybridizing with DIG-labeled anti-sense probe and the negative reaction was showed with sense probe.
Fig. 7 The histological structure of the endometrium, chorion, placenta and conceptus (H.E). The structures of endometrial luminal epithelium (LE), the glandular epithelium (GE), trophoblastic binucleate cells (BNC), stroma (S) and blood (V) were special marked with the abbreviation capital letter.
ment of the intercaruncular endometrial stroma and the development of endometrial folds (Stoye et al. 2000; Muir et al. 2004). Uterine histogenesis has been partially described but incompletely characterized in ewes (Mi 2000; Frendo et al. 2003). As in other mammals, the ovine uterus develops as a specialization of the paramesonephric ducts, which give rise to the infundibula, oviducts, uterus, cervix, and anterior vagina (Paces et al. 2002). Paramesonephric duct tachypromote and a bicornuate uteru tachy-produce during day 30 to 50 (Gray et al. 2001). From results of the real-time RT-PCR, enJSRV mRNA was expression peaked exclusively in the endometrium on day 30 and 50. So it is suggested that enJSRV might play a role in promoting paramesonephric duct fusion and in producing a bicornuate uterus. During pregnancy, endometrial glands grow substantially in length and width prior to maximal increases in fetal growth (Lander et al. 2001; Bieniasz et al. 2003). The histotroph produced by endometrial glands is important because ablation or reduction in uterine gland activity in sheep is associated with per-implantation embryonic mortality (Blond et al. 2000; Mura et al. 2004; Dunlap et al. 2005, 2006a, b). Thus, enJSRV appears to promote endometrial adenogenesis that represents a critical period of uterine
morphogenesis. Analysis of the distribution of mRNAs for enJSRV and its receptor HYAL2 in the tissues or cells of the uterus and conceptus suggests that the fusion of placental BNC and LE cells might involve enJSRV- and HYAL2-mediated cell fusion. The interaction of enJSRV and HYAL2 would promote cell fusion of mononuclear trophoblastic cells (MTCs) into BNCs during pregnancy. At the beginning of implantation, BNCs begin to migrate and fuse with LE cells, forming trinucleated cells. Then the BNC continue to fuse with each other and with pre-existing multinucleated syncytia to form multinucleated syncytial plaques (Blond et al. 2000). Interestingly, Dunlap et al. (2006a, b) found that enJSRV mRNA was abundantly expressed in the endometrial LE and GE, in the cotyledonary portion of the placenta, trophoblastic giant BNCs and syncytial plaques. Nevertheless, enJSRV mRNA was not detected in the caruncular portion of the placenta. As the receptor of enJSRV, HYAL2 mRNA was detected in the placenta but not in the endometrium regardless of the gestational stage, which differs from our results. We found that HYAL2 mRNA was expressed specifically in the endometrial LE and GE. Thus, we guess that HYAL2 might also have potential biological roles in promoting
© 2013, CAAS. All rights reserved. Published by Elsevier Ltd.
Identification of Sheep Endogenous Beta-Retroviruses with Uterus-Specific Expression in the Pregnant Mongolian Ewe
placental morphogenesis by combining with enJSRV, though the molecular mechanisms are still unknown. Both in vivo and in vitro loss-of-function studies support the hypothesis that enJSRV has biological roles during ontogeny (Dunlap et al. 2006b). When a morpholino loss-of-function approach in the uterus was used, expression of the envelope protein of enJSRV caused a reduction in trophectoderm outgrowth and formation of the conceptus. The production of interferon tau (IFN-τ) by the early conceptus affects the establishment of pregnancy (Spencer et al. 1998, 2003; Mann et al. 1999; Roberts et al. 1999). Unfortunately, the molecular mechanisms of regulating trophectoderm proliferation and differentiation in mammals are poorly understood. Therefore, the mechanisms of trophoblastic growth and differentiation as well as their role in protecting their host from pathogenic retroviruses (Jaagsiekte sheep retrovirus, JSRV) will be an important aspect of the further research (Hofacre 2009, 2010).
CONCLUSION In conclusion, these studies indicate that enJSRV and its receptor HYAL2 are dynamically and differentially expressed in the Mongolian ewe uterus and in the conceptus throughout pregnancy. This suggests that they can play its roles as regulators or assistors of uterine development and endometrial growth during gestation. The spatial differences in enJSRV and HYAL2 expression in the endometrial luminal epithelium and glandular epithelium, trophoblastic giant binucleate cells, endometrial caruncles, placental cotyledons, stroma, trophectoderm, as well as multinucleated syncytia of the placenta and blood vessel endothelial cells, suggest that they regulate endometrial differentiation via coordinated control of the epithelium and/or stroma. Epithelial-stromal interactions are crucial for the development of a number of epitheliomesenchymal tissues and organs, such as the endometrium, chorion, placenta and conceptus.
MATERIALS AND METHODS Animals and experimental design The Animal Center of Inner Mongolia Agricultural
889
University, China, provided 36 cycling Mongolian ewes that were subjected to synchronized oestrus and mated. They were all bred under the same nutritional conditions. At mating, the ewes were assigned randomly to be euthanized and to have the conceptus (embryo/foetus and associated extra-embryonic membranes) removed on pregnancy day, day 30, 50, 70, 90, 110 and 130 (n=6 ewes per time point). The endometrium, chorion, placenta, and conceptus were collected at post-mortem examination, snap frozen in liquid nitrogen and stored at -80°C for RNA extraction. Total RNA was isolated from tissues according to the manufacturer’s recommendations (RNA Extraction Kit, TaKaRa, Dalian, China). The integrity of RNA was examined by electrophoresis in a denaturing 1.0% agarose gel and the RNA was quantified at 260 nm in a microspectrophotometer at an OD260/OD280 ratio of 1.8 to 2.0 for all samples and then stored at -80°C. All tissues were also fixed in fresh 4% paraformaldehyde for 10 h, dehydrated through a graded series of alcohol to xylene, embedded in paraffin wax and sectioned at 5 μm for in situ hybridization.
Primer design and synthesis Primers and probes used were designed on the basis of published enJSRV-gag, HYAL2 and β-actin gene sequences and synthesized by TaKaRa Biotechnology Co., Ltd. (Dalian, China). Information on target genes is shown in Table.
RT-PCR and preparation of probes Synthesis of DNA was carried out in 50 mL reaction volumes as follows: 0.5 μL PrimeScript RTase (for one step), 1 μL RNase inhibitor (40 U μL-1), 1 μL TaKaRa Ex Taq DNA polymerase (5 U μL-1), 2 μL dNTP mixture (10 mmol L-1 each), 5 μL 10× one step RT-PCR buffer, 1 μL one step enhancer solution, 1 μL F primer (20 mmol L-1), 1 μL R primer (20 mmol L-1), total RNA and RNase-free H2O. Conditions were 50°C for 30 min, 94°C for 2 min and 45 cycles of 94°C for 30 s, 30 s annealing (enJSRV 55°C, HYAL2 60°C and β-actin 58°C) and a final extension of 72°C for 1 min. RNase-free H2O was used instead of template RNA as control in the RTPCR Kits. The PCR products were purified using Gel Extraction Kits (TaKaRa, Dalian, China) according to the manufacturer’s instructions. A portion of the purified PCR products was separated in a 1.5% agarose gel and visualized by ethidium bromide staining using an imaging system. The density and OD260/ OD280 ratios were analyzed with an ultraviolet microspectrophotometer to identify the relative expression quantity of the target gene. Total RNA of all samples was used in RT-PCR experiments. The RT-PCR products were sequenced and analyzed using the NCBI BLAST tool. At the same time, the enJSRV and HYAL2 plasmids were cloned using
© 2013, CAAS. All rights reserved. Published by Elsevier Ltd.
890
QI Jing-wei et al.
Table Sequences of primers and probes used for real-time RT-PCR Gene enJSRV
HYAL2
β-actin
Sequence (5´ Sense Antisense Probe Sense Antisense Probe Sense Antisense Probe
3´)
TGGCGAAGTATAATTGCTATGGG TCTTTAACAATGCTACGAATAAGGC FAM-TGATAAGCACAACTGTCAGAACCGC GCTGGCTTCCTCCACTCAC GTGAAGACGTAGACTGGGAGTG FAM-TTCGTGTCCAGGAGGCTCTTCGC CACGGCATTGTCACCAACTG CTCAAACATGATCTGGGTCATCTTC FAM-TGGCACCACACCTTCTACAACGAGC
standard methods and linearized with Sal I and BamH I restriction enzymes for anti-sense and sense probes, respectively. Sp6 and T7 polymerase were used to transcribe the probes respectively using the Digoxigenin RNA Labelling Kit (Roche, Mannheim, Germany; catalogue #11 175 025 910). An anti-digoxigenin AP Fab fragment (Roche, 11 093 274 910) was used to detect the probe.
In situ hybridization Sections (5 mm) were dewaxed through xylene, dehydrated and digested with protease K in 0.1 mol L -1 phosphatebuffered saline (PBS, pH 7.4) for 1-2 min. Glycine was added to inhibit digestion and the sections were washed twice with 0.1 mol L-1 (PBS) and 4% paraformaldehyde in PBS. An aliquot of 20 μL pre-hybridization mixture (5× SSC buffer, 5× Denhardt’s solution, 50% deionized formamide, 1% SDS, 200 μg mL-1 Salmon sperm DNA) was added and pre-hybridized for 1 h at 42°C. The pre-hybridization mixture was removed and replaced with the hybridization mixture (5× SSC, 5× Denhardt’s solution, 50% deionized formamide, 1% SDS, 250 μg mL-1 Salmon sperm DNA, 10% dextran sulphate plus digoxigenin, DIG-labelled anti-sense or sense cRNA probes) for 18 h at 42°C. The section was then washed with SSC, closed fluid, anti-digoxigenin AP fluid, malefic acid buffer solution, coloured buffer solution, NBT/BCIP coloured solution, RNase-free H 2O, counterstained with eosin, dehydrated through a graded series of alcohol to xylene and protected with a cover slip.
Real-time RT-PCR First strand and cDNA synthesis was performed according to the protocol of the TaKaRa Reverse Transcription System using oligo(dT)16 primers. Quantification of mRNA levels of the genes was achieved using Premix Ex Taq™ Kits (TaKaRa) using β-actin as the housekeeping gene. PCR amplification was run using an IQ™5 Multicolor RealTime PCR Detection System (Bio-Rad, Hercules, CSA, USA) and carried out in 25 mL reaction volumes containing 2 mL cDNA, 12.5 mL SYBR Premix Ex Taq (TaKaRa), 0.5 mL forward primer (2 mmol L-1), 0.5 mL reverse primer (2 mmol L-1),
GenBank accession no.
Annealing temp. (°C)
Product size (bp)
EF680306
55
92
NM_001009754
60
111
58
159
U39357
2 mL TaqMan probes (0.2 mmol L-1) and 8.5 mL RNase-free H2O to make a total volume of 25 mL. The primers and probes used were synthesized by TaKaRa Biotechnology Co., Ltd., and are shown in Table. All PCR reactions were run in duplicate and were performed for 45 cycles, including a negative control consisting of PCR-grade water. Data analysis was performed using a relative standard curve and based on the ratio of the fluorescent change observed with the target gene to the fluorescent change observed with the β-actin housekeeping gene. The 2-ΔΔCt method was used to analyze the data (Livak 2001). Statistical analysis of differences between pairs of matching groups was carried out by one-way analysis of SPSS and was based on at least two repetitions.
Acknowledgements This research was funded by the National Natural Science Foundation of China (30960271 and 31160493) and the doctor fund project of Ministry of Education of China (20111515110008).
References Armezzani A, Arnaud F, Caporale M, Meo D G, lannuzzi L, Murqia C, Palmarini M. 2011. The signal peptide of a recently integrated endogenous sheep betaretrovirus envelope plays a major role in eluding gag-mediated late restriction. Journal of General Virology, 85, 71187128. Arnaud F, Caporale M, Varela M, Biek R, Chessa B, Alberti A, Golder M, Mura M, Zhang Y P, Li Y, et al. 2007. A paradigm for virus-host coevolution: sequential counter-adaptations between endogenous and exogenous retroviruses. Plos Pathogens, 3, 1716-1729. Arnaud F, Varela M, Spencer T E, Palmarini M. 2008. Coevolution of endogenous betaretroviruses of sheep and their host. Cellular and Molecular Life Sciences, 65, 3422-3432. Bieniasz P D. 2003. Restriction factors: a defense against retroviral infection. Trends in Microbiology, 11, 286291. Black S G, Arnaud F, Burghardt R C, Satterfield M C, Fleming T A, Long C R, Hanna C, Murphy L, Biek R, Palmarini M, et al . 2010. Viral particles of endogenous
© 2013, CAAS. All rights reserved. Published by Elsevier Ltd.
Identification of Sheep Endogenous Beta-Retroviruses with Uterus-Specific Expression in the Pregnant Mongolian Ewe
betaretroviruses are released in the sheep uterus and infect the conceptus trophectoderm in a transspecies embryo transfer model. Journal of General Virology, 84, 9078-9085. Blond J L, Lavillette D, Cheynet V, Bouton O, Oriol G, Sylvie C F, Mandrand B, Mallet F, Cosset F L. 2000. An envelope glycoprotein of the human endogenous retrovirus HERV-W is expressed in the human placenta and fuses cells expressing the type D mammalian retrovirus receptor. Journal of General Virology, 74, 3321-3329. DeHaven J E, Schwartz D A, Dahm M W, Hazard E S, Trifiletti R, Lacy E R, Norris J S. 1998. Novel retroviral sequences are expressed in the epididymis and uterus of Syrian hamsters. Journal of General Virology, 79, 2687-2694. DeMartini J C, Carlson J O, Leroux C, Spencer T, Palmarini M. 2003. Endogenous retroviruses related to Jaagsiekte sheep retrovirus. Current Topics in Microbiology and Immunology, 275, 117-137. Dunlap K A, Palmarini M, Adelson D L, Spencer T E. 2005. Sheep endogenous betaretroviruses (enJSRVs) and the hyaluronidase 2 (HYAL2) receptor in the ovine uterus and conceptus. Biology of Reproduction, 73, 271-279. Dunlap K A, Palmarini M, Spencer T E. 2006a. Ovine endogenous betaretroviruses (enJSRVs) and placental morphogenesis. Placenta, 27, 135-140. Dunlap K A, Palmarini M, Varela M, Burghardt R C, Hayashi K, Farmer J L, Spencer T E. 2006b. Endogenous retroviruses regulate periimplantation placental growth and differentiation. Proceedings of the National Academy of Sciences of the United States of America, 103, 14390-14395. Frendo J L, Olivier D, Cheynet V, Blond J L, Bouton O, Vidaud M, Rabreau M, Brion E D, Mallet F. 2003. Direct involvement of HERV-W Env glycoprotein in human trophoblast cell fusion and differentiation. Molecular and Cellular Biology, 23, 3566-3574. Gray C A, Bartol F F, Tarleton B J, Wiley A A, Johnson G A, Bazer F W, Spencer T E. 2001. Developmental biology of uterine glands. Biology of Reproduction, 65, 13111323. Hofacre A, Fan H. 2010. Jaagsiekte sheep retrovirus biology and oncogenesis. Viruses, 2, 2618-2648. Hofacre A, Nitta T, Fan H. 2009. Jaagsiekte sheep retrovirus encodes a regulatory factor, Rej, required for synthesis of Gag protein. Journal of General Virology, 83, 1248312498. Lander E S, Linton L M, Birren B, Nusbaum C, Zody M C, Baldwin J, Devon K, Dewar K, Doyle M. 2001. Initial sequencing and analysis of the human genome. Nature, 409, 860-921. Livak K J, Schmittgen T D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and
891
the 2-ΔΔCt method. Mechanisms and Methods Toxicol, 25, 402-408. Mann G E, Lamming G E. 1999. The influence of progesterone during early pregnancy in cattle. Reproduction in Domestic Animals, 34, 269-274. Mi S, Lee X, Li X, Veldman G M, Finnerty H, Racie L, LaVallie E, Tang X Y, Edouard P, Howes S, et al. 2000. Syncytin is a captive retroviral envelope protein involved in human placental morphogenesis. Nature, 403, 785-789. Muir A, Lever A, Moffett A. 2004. Expression and functions of human endogenous retroviruses in the placenta:an update. Placenta, 25, S16-S25. Mura M, Caporale P M, Spencer T E, Nagashima K, Rein A, Palmarini M. 2004. Late viral interference induced by transdominant Gag of an endogenous retrovirus. Proceedings of the National Academy of Sciences of the United States of America, 101, 11117-11122. Paces J, Pavlícek A, Paces V. 2002. Database of human endogenous retroviruses. Nucleic Acids Research, 30, 205-206. Palmarini M, Gray A, Carpenter K, Fan H, Bazer F W, Spencer T E. 2001. Expression of endpgenous bataretroviruses in the ovine uterus: effects of neonatal age,estrous cycle, pregnancy and progersterone. Journal of General Virology, 75, 11319-11327. Palmarini M, Mura M, Spencer T E. 2004. Endogenous betaretroviruses of sheep: teaching new lessons in retroviral interference and adaptation. Journal of General Virology, 85, 1-13. Qi J W, Wu X L, Liu S Y, Cao G F. 2012. Expression of enJSRV and Hyal-2 mRNA in immune organs of fetuses and lambs. Virologica Sinica, 27, 83-92. Rote N S, Chakrabarti S, Stetzer B P. 2004. The role of human endogenous retroviruses in trophoblast differentiation and placental development. Placenta, 25, 673-683. Roberts R M, Ealy A D, Alexenko A P, Alexenko, Han C S, Ezashi T. 1999. Trophoblast interferons. Placenta, 20, 259-264. Spencer T E, Mura M, Gray C A, Griebel P J, Palmarini M. 2003. Receptor usage and fetal expression of ovine endogenous beta-retroviruses: implications for coevolution of endogenous and exogenous retrovirus. Journal of General Virology, 77, 749-753. Spencer T E, Ott T L, Bazer F W. 1998. Tau-Interferon: pregnancy recognition signal in ruminants. Proceedings of the Society for Experimental Biology and Medicine, 213, 215-229. Stoye J P, Coffin J M. 2000. A provirus put to work. Nature, 403, 715-717. Wang Y, Liu S Y, Li J Y, Han M, Wang Z L. 2008. Cloning and sequence analysis of complete genome from the inner mongolia strain of the endogenous betaretroviruses (enJSRV). Virologica Sinica, 23, 1524. (Managing editor ZHANG Juan)
© 2013, CAAS. All rights reserved. Published by Elsevier Ltd.
May 2013
2013, 12(5): 884-891
RESEARCH ARTICLE
Identification of Sheep Endogenous Beta-Retroviruses with Uterus-Specific Expression in the Pregnant Mongolian Ewe QI Jing-wei, XU Meng-jie, LIU Shu-ying, ZHANG Yu-fei, LIU Yue, ZHANG Ya-kun and CAO Gui-fang College of Veterinary Medicine, Inner Mongolia Agricultural University, Huhhot 010018, P.R.China
Abstract The sheep genome harbours approximately 20 copies of endogenous beta-retroviruses (enJSRVs), and circumstantial evidence suggests that enJSRVs might play a role in mammalian reproduction, particularly placental morphogenesis. This study was aimed to assess the expression of mRNAs of an enJSRV and its receptor, HYAL2, in the uterus and conceptuses of Mongolian ewes throughout gestation, using real-time reverse transcription polymerase chain reaction and in situ hybridization analysis. The results showed that enJSRV and HYAL2 mRNAs were found to be expressed throughout gestation in the endometrium, chorion, placenta, and conceptus. The enJSRV mRNA was most abundant in the placenta on day 90 of pregnancy, in the endometrium on day 30 and 50, and in the chorion on day 70 and 110. However, HYAL2 mRNA was most abundant in the endometrium on day 30. These differences were all significantly different from each other (P<0.01). In situ hybridization showed that enJSRV and HYAL2 mRNAs were specifically expressed in endometrial luminal epithelium and glandular epithelium, trophoblastic giant binucleated cells (BNCs), endometrial caruncles, placental cotyledons, stroma, trophectoderm, as well as multinucleated syncytia of the placenta and blood vessel endothelial cells. Collectively, little is known about the molecular mechanisms by which trophoblastic differentiation and multinucleated syncytia formation are regulated by enJSRVs. However, the temporal and spatial distributions of enJSRV expression in the uterus and conceptus indicate that differentiation of BNCs and the formation of a multinucleated syncytiotrophoblast involve enJSRV and possibly its cellular receptor, HYAL2. Therefore, enJSRV and HYAL2 appear to play important roles in the female reproductive physiology in this breed of sheep. Key words: enJSRV, HYAL2, expression, real-time reverse transcription polymerase chain reaction, in situ hybridization hybridization, Mongolian ewe
INTRODUCTION Endogenous retroviruses (ERVs) account for a substantial portion of the genetic pool of every animal species (e.g., ~8% of the human genome). Despite their overwhelming abundance in nature, many questions on the basic biology of ERVs remain unanswered (Paces 2002). The biological relevance of ERVs in mammals has been debated intensely. Generally, ERVs are tran-
scriptionally silent and are often defective. However, several of them maintain at least some intact open reading frames that can be expressed and are associated with beneficial effects to the host (Lander et al. 2001). Therefore, the endogenous beta-retroviruses (enJSRVs) of small mammals offer a perfect model for studying the biological relevance of ERVs. Up to now, there have been no reports on expression of enJSRV and its receptor HYAL2 in the uterus or conceptus of Mongolian ewes (Wang 2008; Qi et al. 2012).
Received 17 May, 2012 Accepted 23 October, 2012 QI Jing-wei, E-mail: [email protected]; Correspondence LIU Shu-ying, E-mail: [email protected]
© 2013, CAAS. All rights reserved. Published by Elsevier Ltd. doi:10.1016/S2095-3119(13)60306-8
Identification of Sheep Endogenous Beta-Retroviruses with Uterus-Specific Expression in the Pregnant Mongolian Ewe
The genome of all mammals is colonized by ERVs derived from retroviruses that have invaded the host during evolution, which has led to persistent integration into the host DNA. Repeated retroviral integrations have occurred over many millions of years. Consequently, ERVs are transmitted to descendants, as are the other host genes (Lander et al. 2001; Paces 2002). The function of ERVs is not clear, but some of them might have biological functions in conceptus implantation, cell fusion and placental morphogenesis (Palmarini et al. 2001, 2004; DeMartini et al. 2003; Arnaud et al. 2007). Researchers have studied the expression of ERVs in the genital tract and placenta of the human and mouse for several decades (DeHaven et al. 1998). There are various opinions on their significance in the evolution of mammals (Stoye 2000; Muir 2004). Several ERVs, including ERV-3 and HERV-W, play important roles in the formation of the placental syncytiotrophoblast (Mi et al. 2000; Frendo et al. 2003; Rote et al. 2004). The protein product of the HERV-W envelope (env) gene is a membrane glycoprotein that induces the formation of syncytiotrophoblast upon interaction with the HYAL2 receptor (Blond et al. 2000). Thus, the biological interactions between ERVs and their hosts are dynamic processes and there have been co-adaptive genetic changes that have favoured the host in sheep (Arnaud et al. 2007). However, little is known about the mechanisms that regulate syncytial formation and trophoblastic differentiation during placentation. The aim of our studies was to quantify the expression levels of enJSRV and HYAL2 mRNAs during gestation in the uterus and conceptus of Mongolian ewes and to detect the loci where transcriptional active genes are located, using real-time reverse transcription polymerase chain reaction and in situ hybridization. Increased knowledge of enJSRV and HYAL2 expression loci and the mechanisms underlying enJSRV viral repression will be useful in further studying on the suppression of local immune recognition of the conceptus and in placental morphogenesis.
885
intercaruncular uterus and conceptus were quantified by real-time RT-PCR (Figs. 1-2). Overall, enJSRV and HYAL2 mRNAs were detected in every tissue examined, including the endometrium, chorion, placenta, and conceptus at all times of pregnancy (day 30, 50, 70, 90, 110, and 130). The abundance of enJSRV mRNA was the greatest in the placenta on day 90 (2.5-fold), in the endometrium on day 30 (3.0-fold) and 50 (3.2-fold), as well as in the chorine on day 70 (3.4-fold) and 110 (3.8-fold), whereas HYAL2 mRNA was most abundant in the endometrium on day 30 (1.8-fold). All of these changes from baseline were statistically significant (P<0.01).
In situ hybridization In situ hybridization was used to determine the location of enJSRV and HYAL2 mRNAs. Positive signals for enJSRV and HYAL2 mRNAs were present in the en-
Fig. 1 Relative expression levels of enJSRV mRNA in the endometrium, chorion, placenta, and conceptus. The expression of enJSRV mRNA was most abundant in the placenta on day 90 (2.5-fold), in the endometrium on day 30 (3.0-fold) and 50 (3.2fold), as well as in the chorion on day 70 (3.4-fold) and 110 (3.8fold). All of these changes from the control level were statistically significant (P<0.01). The expression of enJSRV mRNA in the placenta at day 30 of pregnancy was used as a control value. All data are presented as 2-ΔΔCt values with standard errors (SE). The same as below.
RESULTS enJSRV and HYAL2 mRNAs in the uterus and conceptus tissues The contents of enJSRV and HYAL2 mRNAs in the
Fig. 2 Relative expression levels of HYAL2 mRNA in the endometrium, chorion, placenta, and conceptus. HYAL2 mRNA was most abundant in the endometrium on day 30 (1.8-fold; ** P<0.01). The expression of HYAL2 mRNA in placenta at day 30 was taken as the control level.
© 2013, CAAS. All rights reserved. Published by Elsevier Ltd.
886
dometrial luminal epithelium (LE) and glandular epithelium (GE), trophoblastic giant binucleate cells (BNC), endometrial caruncles (Car), placental cotyledons (Cot), stroma (S), trophectoderm (Tr), as well as in multinucleated syncytia of the placenta (SP) and blood vessel endothelial cells from all tissues regardless of gestational day. In the negative controls, the tested tissues did not show positive signals when the sections were analyzed with DIG-labelled sense probes, thus confirming the specificity of the tests (Figs. 3-7).
DISCUSSION Both enJSRV and its receptor HYAL2 were expressed dynamically in the Mongolian ewe uterus and conceptus during pregnancy. The abundance of enJSRV mRNA peaked significantly in the placenta on day 90 of pregnancy, in the endometrium on day 30 and 50, and in the chorion on day 70 and 110, whereas HYAL2 mRNA was most abundant in endometrium on day 30. Consistent with these findings, the temporal and cellspecific changes in the expression of enJSRV and HYAL2 occurred in the uterine and placental tissues. The
QI Jing-wei et al.
enJSRV and HYAL2 mRNAs were mainly expressed in the endometrial luminal epithelium and glandular epithelium, trophoblastic giant binucleate cells, endometrial caruncles, placental cotyledons, stroma, trophectoderm, as well as multinucleated syncytia of the placenta and blood vessel endothelial cells regardless of gestational day. The dynamic and differential expression patterns of enJSRV and HYAL2 during pregnancy indicates that they are possibly involved in placental development and uterine remodification. In mammals, enJSRV and HYAL2 coordinate control in promoting placental morphogenesis and regulate normal uterine development during gestation (Arnaud 2008). Black S G et al. (2010) found that enJSRVs form viral particles that are released into the uterine lumen of sheep and enJSRVs-RNAs belonging to only the most recently integrated enJSRV loci were packaged into viral particles and transmitted to the trophectoderm. Their results support the hypothesis that intact enJSRV loci could potentially transduce the conceptus trophectoderm. Moreover, enJSRV and HYAL2 also play a biological role during ontogenesis in the foetus (Armezzani 2011). Our novel results provide powerful support for the hypothesis that enJSRV and its receptor HYAL2 might
Fig. 3 The expression of enJSRV and HYAL2 mRNAs in the endometrium by in situ hybridization. Cross sections of the endometrium from 30, 50 and 130 gestational days (GD) were hybridized with DIG-labeled anti-sense and sense probes. The endometrial luminal epithelium (LE), the glandular epithelium (GE), trophoblastic binucleate cells (BNC), stroma (S), and blood vessel endothelial cells (V) show positive reactivity using anti-sense probe (marked with the abbreviation capital letter). The negative reaction was showed with sense probe.
© 2013, CAAS. All rights reserved. Published by Elsevier Ltd.
Identification of Sheep Endogenous Beta-Retroviruses with Uterus-Specific Expression in the Pregnant Mongolian Ewe
887
Fig. 4 The expression of enJSRV and HYAL2 mRNAs in the chorion by in situ hybridization. Cross sections of the chorion from 30, 50 and 130 GD were hybridized with DIG-labeled anti-sense and sense probes. The trophoblast binucleate cells (BNC), multinucleate syncytial plaque (SP), trophectoderm (Tr) show positive reactivity using anti-sense probe (marked with the abbreviation capital letter).
Fig. 5 The expression of enJSRV and HYAL2 mRNAs in the placenta by in situ hybridization. Cross sections of the placenta from 30, 50 and 130 GD were hybridized with DIG-labeled anti-sense and sense probes. The glandular epithelium (GE), endometrial caruncle (Car), placental cotyledon (Cot), stroma (S) and trophectoderm (Tr) show positive reactivity using anti-sense probe (marked with the abbreviation capital letter).
have beneficial physiological roles for the host. In sheep, uterine development involves differentia-
tion of the endometrial glandular epithelium (GE) from the luminal epithelium (LE), specification and develop-
© 2013, CAAS. All rights reserved. Published by Elsevier Ltd.
888
QI Jing-wei et al.
Fig. 6 The expression of enJSRV and HYAL2 mRNAs in the conceptus of day 30 of pregnancy by in situ hybridization. Many cells of the conceptus show positive reactivity hybridizing with DIG-labeled anti-sense probe and the negative reaction was showed with sense probe.
Fig. 7 The histological structure of the endometrium, chorion, placenta and conceptus (H.E). The structures of endometrial luminal epithelium (LE), the glandular epithelium (GE), trophoblastic binucleate cells (BNC), stroma (S) and blood (V) were special marked with the abbreviation capital letter.
ment of the intercaruncular endometrial stroma and the development of endometrial folds (Stoye et al. 2000; Muir et al. 2004). Uterine histogenesis has been partially described but incompletely characterized in ewes (Mi 2000; Frendo et al. 2003). As in other mammals, the ovine uterus develops as a specialization of the paramesonephric ducts, which give rise to the infundibula, oviducts, uterus, cervix, and anterior vagina (Paces et al. 2002). Paramesonephric duct tachypromote and a bicornuate uteru tachy-produce during day 30 to 50 (Gray et al. 2001). From results of the real-time RT-PCR, enJSRV mRNA was expression peaked exclusively in the endometrium on day 30 and 50. So it is suggested that enJSRV might play a role in promoting paramesonephric duct fusion and in producing a bicornuate uterus. During pregnancy, endometrial glands grow substantially in length and width prior to maximal increases in fetal growth (Lander et al. 2001; Bieniasz et al. 2003). The histotroph produced by endometrial glands is important because ablation or reduction in uterine gland activity in sheep is associated with per-implantation embryonic mortality (Blond et al. 2000; Mura et al. 2004; Dunlap et al. 2005, 2006a, b). Thus, enJSRV appears to promote endometrial adenogenesis that represents a critical period of uterine
morphogenesis. Analysis of the distribution of mRNAs for enJSRV and its receptor HYAL2 in the tissues or cells of the uterus and conceptus suggests that the fusion of placental BNC and LE cells might involve enJSRV- and HYAL2-mediated cell fusion. The interaction of enJSRV and HYAL2 would promote cell fusion of mononuclear trophoblastic cells (MTCs) into BNCs during pregnancy. At the beginning of implantation, BNCs begin to migrate and fuse with LE cells, forming trinucleated cells. Then the BNC continue to fuse with each other and with pre-existing multinucleated syncytia to form multinucleated syncytial plaques (Blond et al. 2000). Interestingly, Dunlap et al. (2006a, b) found that enJSRV mRNA was abundantly expressed in the endometrial LE and GE, in the cotyledonary portion of the placenta, trophoblastic giant BNCs and syncytial plaques. Nevertheless, enJSRV mRNA was not detected in the caruncular portion of the placenta. As the receptor of enJSRV, HYAL2 mRNA was detected in the placenta but not in the endometrium regardless of the gestational stage, which differs from our results. We found that HYAL2 mRNA was expressed specifically in the endometrial LE and GE. Thus, we guess that HYAL2 might also have potential biological roles in promoting
© 2013, CAAS. All rights reserved. Published by Elsevier Ltd.
Identification of Sheep Endogenous Beta-Retroviruses with Uterus-Specific Expression in the Pregnant Mongolian Ewe
placental morphogenesis by combining with enJSRV, though the molecular mechanisms are still unknown. Both in vivo and in vitro loss-of-function studies support the hypothesis that enJSRV has biological roles during ontogeny (Dunlap et al. 2006b). When a morpholino loss-of-function approach in the uterus was used, expression of the envelope protein of enJSRV caused a reduction in trophectoderm outgrowth and formation of the conceptus. The production of interferon tau (IFN-τ) by the early conceptus affects the establishment of pregnancy (Spencer et al. 1998, 2003; Mann et al. 1999; Roberts et al. 1999). Unfortunately, the molecular mechanisms of regulating trophectoderm proliferation and differentiation in mammals are poorly understood. Therefore, the mechanisms of trophoblastic growth and differentiation as well as their role in protecting their host from pathogenic retroviruses (Jaagsiekte sheep retrovirus, JSRV) will be an important aspect of the further research (Hofacre 2009, 2010).
CONCLUSION In conclusion, these studies indicate that enJSRV and its receptor HYAL2 are dynamically and differentially expressed in the Mongolian ewe uterus and in the conceptus throughout pregnancy. This suggests that they can play its roles as regulators or assistors of uterine development and endometrial growth during gestation. The spatial differences in enJSRV and HYAL2 expression in the endometrial luminal epithelium and glandular epithelium, trophoblastic giant binucleate cells, endometrial caruncles, placental cotyledons, stroma, trophectoderm, as well as multinucleated syncytia of the placenta and blood vessel endothelial cells, suggest that they regulate endometrial differentiation via coordinated control of the epithelium and/or stroma. Epithelial-stromal interactions are crucial for the development of a number of epitheliomesenchymal tissues and organs, such as the endometrium, chorion, placenta and conceptus.
MATERIALS AND METHODS Animals and experimental design The Animal Center of Inner Mongolia Agricultural
889
University, China, provided 36 cycling Mongolian ewes that were subjected to synchronized oestrus and mated. They were all bred under the same nutritional conditions. At mating, the ewes were assigned randomly to be euthanized and to have the conceptus (embryo/foetus and associated extra-embryonic membranes) removed on pregnancy day, day 30, 50, 70, 90, 110 and 130 (n=6 ewes per time point). The endometrium, chorion, placenta, and conceptus were collected at post-mortem examination, snap frozen in liquid nitrogen and stored at -80°C for RNA extraction. Total RNA was isolated from tissues according to the manufacturer’s recommendations (RNA Extraction Kit, TaKaRa, Dalian, China). The integrity of RNA was examined by electrophoresis in a denaturing 1.0% agarose gel and the RNA was quantified at 260 nm in a microspectrophotometer at an OD260/OD280 ratio of 1.8 to 2.0 for all samples and then stored at -80°C. All tissues were also fixed in fresh 4% paraformaldehyde for 10 h, dehydrated through a graded series of alcohol to xylene, embedded in paraffin wax and sectioned at 5 μm for in situ hybridization.
Primer design and synthesis Primers and probes used were designed on the basis of published enJSRV-gag, HYAL2 and β-actin gene sequences and synthesized by TaKaRa Biotechnology Co., Ltd. (Dalian, China). Information on target genes is shown in Table.
RT-PCR and preparation of probes Synthesis of DNA was carried out in 50 mL reaction volumes as follows: 0.5 μL PrimeScript RTase (for one step), 1 μL RNase inhibitor (40 U μL-1), 1 μL TaKaRa Ex Taq DNA polymerase (5 U μL-1), 2 μL dNTP mixture (10 mmol L-1 each), 5 μL 10× one step RT-PCR buffer, 1 μL one step enhancer solution, 1 μL F primer (20 mmol L-1), 1 μL R primer (20 mmol L-1), total RNA and RNase-free H2O. Conditions were 50°C for 30 min, 94°C for 2 min and 45 cycles of 94°C for 30 s, 30 s annealing (enJSRV 55°C, HYAL2 60°C and β-actin 58°C) and a final extension of 72°C for 1 min. RNase-free H2O was used instead of template RNA as control in the RTPCR Kits. The PCR products were purified using Gel Extraction Kits (TaKaRa, Dalian, China) according to the manufacturer’s instructions. A portion of the purified PCR products was separated in a 1.5% agarose gel and visualized by ethidium bromide staining using an imaging system. The density and OD260/ OD280 ratios were analyzed with an ultraviolet microspectrophotometer to identify the relative expression quantity of the target gene. Total RNA of all samples was used in RT-PCR experiments. The RT-PCR products were sequenced and analyzed using the NCBI BLAST tool. At the same time, the enJSRV and HYAL2 plasmids were cloned using
© 2013, CAAS. All rights reserved. Published by Elsevier Ltd.
890
QI Jing-wei et al.
Table Sequences of primers and probes used for real-time RT-PCR Gene enJSRV
HYAL2
β-actin
Sequence (5´ Sense Antisense Probe Sense Antisense Probe Sense Antisense Probe
3´)
TGGCGAAGTATAATTGCTATGGG TCTTTAACAATGCTACGAATAAGGC FAM-TGATAAGCACAACTGTCAGAACCGC GCTGGCTTCCTCCACTCAC GTGAAGACGTAGACTGGGAGTG FAM-TTCGTGTCCAGGAGGCTCTTCGC CACGGCATTGTCACCAACTG CTCAAACATGATCTGGGTCATCTTC FAM-TGGCACCACACCTTCTACAACGAGC
standard methods and linearized with Sal I and BamH I restriction enzymes for anti-sense and sense probes, respectively. Sp6 and T7 polymerase were used to transcribe the probes respectively using the Digoxigenin RNA Labelling Kit (Roche, Mannheim, Germany; catalogue #11 175 025 910). An anti-digoxigenin AP Fab fragment (Roche, 11 093 274 910) was used to detect the probe.
In situ hybridization Sections (5 mm) were dewaxed through xylene, dehydrated and digested with protease K in 0.1 mol L -1 phosphatebuffered saline (PBS, pH 7.4) for 1-2 min. Glycine was added to inhibit digestion and the sections were washed twice with 0.1 mol L-1 (PBS) and 4% paraformaldehyde in PBS. An aliquot of 20 μL pre-hybridization mixture (5× SSC buffer, 5× Denhardt’s solution, 50% deionized formamide, 1% SDS, 200 μg mL-1 Salmon sperm DNA) was added and pre-hybridized for 1 h at 42°C. The pre-hybridization mixture was removed and replaced with the hybridization mixture (5× SSC, 5× Denhardt’s solution, 50% deionized formamide, 1% SDS, 250 μg mL-1 Salmon sperm DNA, 10% dextran sulphate plus digoxigenin, DIG-labelled anti-sense or sense cRNA probes) for 18 h at 42°C. The section was then washed with SSC, closed fluid, anti-digoxigenin AP fluid, malefic acid buffer solution, coloured buffer solution, NBT/BCIP coloured solution, RNase-free H 2O, counterstained with eosin, dehydrated through a graded series of alcohol to xylene and protected with a cover slip.
Real-time RT-PCR First strand and cDNA synthesis was performed according to the protocol of the TaKaRa Reverse Transcription System using oligo(dT)16 primers. Quantification of mRNA levels of the genes was achieved using Premix Ex Taq™ Kits (TaKaRa) using β-actin as the housekeeping gene. PCR amplification was run using an IQ™5 Multicolor RealTime PCR Detection System (Bio-Rad, Hercules, CSA, USA) and carried out in 25 mL reaction volumes containing 2 mL cDNA, 12.5 mL SYBR Premix Ex Taq (TaKaRa), 0.5 mL forward primer (2 mmol L-1), 0.5 mL reverse primer (2 mmol L-1),
GenBank accession no.
Annealing temp. (°C)
Product size (bp)
EF680306
55
92
NM_001009754
60
111
58
159
U39357
2 mL TaqMan probes (0.2 mmol L-1) and 8.5 mL RNase-free H2O to make a total volume of 25 mL. The primers and probes used were synthesized by TaKaRa Biotechnology Co., Ltd., and are shown in Table. All PCR reactions were run in duplicate and were performed for 45 cycles, including a negative control consisting of PCR-grade water. Data analysis was performed using a relative standard curve and based on the ratio of the fluorescent change observed with the target gene to the fluorescent change observed with the β-actin housekeeping gene. The 2-ΔΔCt method was used to analyze the data (Livak 2001). Statistical analysis of differences between pairs of matching groups was carried out by one-way analysis of SPSS and was based on at least two repetitions.
Acknowledgements This research was funded by the National Natural Science Foundation of China (30960271 and 31160493) and the doctor fund project of Ministry of Education of China (20111515110008).
References Armezzani A, Arnaud F, Caporale M, Meo D G, lannuzzi L, Murqia C, Palmarini M. 2011. The signal peptide of a recently integrated endogenous sheep betaretrovirus envelope plays a major role in eluding gag-mediated late restriction. Journal of General Virology, 85, 71187128. Arnaud F, Caporale M, Varela M, Biek R, Chessa B, Alberti A, Golder M, Mura M, Zhang Y P, Li Y, et al. 2007. A paradigm for virus-host coevolution: sequential counter-adaptations between endogenous and exogenous retroviruses. Plos Pathogens, 3, 1716-1729. Arnaud F, Varela M, Spencer T E, Palmarini M. 2008. Coevolution of endogenous betaretroviruses of sheep and their host. Cellular and Molecular Life Sciences, 65, 3422-3432. Bieniasz P D. 2003. Restriction factors: a defense against retroviral infection. Trends in Microbiology, 11, 286291. Black S G, Arnaud F, Burghardt R C, Satterfield M C, Fleming T A, Long C R, Hanna C, Murphy L, Biek R, Palmarini M, et al . 2010. Viral particles of endogenous
© 2013, CAAS. All rights reserved. Published by Elsevier Ltd.
Identification of Sheep Endogenous Beta-Retroviruses with Uterus-Specific Expression in the Pregnant Mongolian Ewe
betaretroviruses are released in the sheep uterus and infect the conceptus trophectoderm in a transspecies embryo transfer model. Journal of General Virology, 84, 9078-9085. Blond J L, Lavillette D, Cheynet V, Bouton O, Oriol G, Sylvie C F, Mandrand B, Mallet F, Cosset F L. 2000. An envelope glycoprotein of the human endogenous retrovirus HERV-W is expressed in the human placenta and fuses cells expressing the type D mammalian retrovirus receptor. Journal of General Virology, 74, 3321-3329. DeHaven J E, Schwartz D A, Dahm M W, Hazard E S, Trifiletti R, Lacy E R, Norris J S. 1998. Novel retroviral sequences are expressed in the epididymis and uterus of Syrian hamsters. Journal of General Virology, 79, 2687-2694. DeMartini J C, Carlson J O, Leroux C, Spencer T, Palmarini M. 2003. Endogenous retroviruses related to Jaagsiekte sheep retrovirus. Current Topics in Microbiology and Immunology, 275, 117-137. Dunlap K A, Palmarini M, Adelson D L, Spencer T E. 2005. Sheep endogenous betaretroviruses (enJSRVs) and the hyaluronidase 2 (HYAL2) receptor in the ovine uterus and conceptus. Biology of Reproduction, 73, 271-279. Dunlap K A, Palmarini M, Spencer T E. 2006a. Ovine endogenous betaretroviruses (enJSRVs) and placental morphogenesis. Placenta, 27, 135-140. Dunlap K A, Palmarini M, Varela M, Burghardt R C, Hayashi K, Farmer J L, Spencer T E. 2006b. Endogenous retroviruses regulate periimplantation placental growth and differentiation. Proceedings of the National Academy of Sciences of the United States of America, 103, 14390-14395. Frendo J L, Olivier D, Cheynet V, Blond J L, Bouton O, Vidaud M, Rabreau M, Brion E D, Mallet F. 2003. Direct involvement of HERV-W Env glycoprotein in human trophoblast cell fusion and differentiation. Molecular and Cellular Biology, 23, 3566-3574. Gray C A, Bartol F F, Tarleton B J, Wiley A A, Johnson G A, Bazer F W, Spencer T E. 2001. Developmental biology of uterine glands. Biology of Reproduction, 65, 13111323. Hofacre A, Fan H. 2010. Jaagsiekte sheep retrovirus biology and oncogenesis. Viruses, 2, 2618-2648. Hofacre A, Nitta T, Fan H. 2009. Jaagsiekte sheep retrovirus encodes a regulatory factor, Rej, required for synthesis of Gag protein. Journal of General Virology, 83, 1248312498. Lander E S, Linton L M, Birren B, Nusbaum C, Zody M C, Baldwin J, Devon K, Dewar K, Doyle M. 2001. Initial sequencing and analysis of the human genome. Nature, 409, 860-921. Livak K J, Schmittgen T D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and
891
the 2-ΔΔCt method. Mechanisms and Methods Toxicol, 25, 402-408. Mann G E, Lamming G E. 1999. The influence of progesterone during early pregnancy in cattle. Reproduction in Domestic Animals, 34, 269-274. Mi S, Lee X, Li X, Veldman G M, Finnerty H, Racie L, LaVallie E, Tang X Y, Edouard P, Howes S, et al. 2000. Syncytin is a captive retroviral envelope protein involved in human placental morphogenesis. Nature, 403, 785-789. Muir A, Lever A, Moffett A. 2004. Expression and functions of human endogenous retroviruses in the placenta:an update. Placenta, 25, S16-S25. Mura M, Caporale P M, Spencer T E, Nagashima K, Rein A, Palmarini M. 2004. Late viral interference induced by transdominant Gag of an endogenous retrovirus. Proceedings of the National Academy of Sciences of the United States of America, 101, 11117-11122. Paces J, Pavlícek A, Paces V. 2002. Database of human endogenous retroviruses. Nucleic Acids Research, 30, 205-206. Palmarini M, Gray A, Carpenter K, Fan H, Bazer F W, Spencer T E. 2001. Expression of endpgenous bataretroviruses in the ovine uterus: effects of neonatal age,estrous cycle, pregnancy and progersterone. Journal of General Virology, 75, 11319-11327. Palmarini M, Mura M, Spencer T E. 2004. Endogenous betaretroviruses of sheep: teaching new lessons in retroviral interference and adaptation. Journal of General Virology, 85, 1-13. Qi J W, Wu X L, Liu S Y, Cao G F. 2012. Expression of enJSRV and Hyal-2 mRNA in immune organs of fetuses and lambs. Virologica Sinica, 27, 83-92. Rote N S, Chakrabarti S, Stetzer B P. 2004. The role of human endogenous retroviruses in trophoblast differentiation and placental development. Placenta, 25, 673-683. Roberts R M, Ealy A D, Alexenko A P, Alexenko, Han C S, Ezashi T. 1999. Trophoblast interferons. Placenta, 20, 259-264. Spencer T E, Mura M, Gray C A, Griebel P J, Palmarini M. 2003. Receptor usage and fetal expression of ovine endogenous beta-retroviruses: implications for coevolution of endogenous and exogenous retrovirus. Journal of General Virology, 77, 749-753. Spencer T E, Ott T L, Bazer F W. 1998. Tau-Interferon: pregnancy recognition signal in ruminants. Proceedings of the Society for Experimental Biology and Medicine, 213, 215-229. Stoye J P, Coffin J M. 2000. A provirus put to work. Nature, 403, 715-717. Wang Y, Liu S Y, Li J Y, Han M, Wang Z L. 2008. Cloning and sequence analysis of complete genome from the inner mongolia strain of the endogenous betaretroviruses (enJSRV). Virologica Sinica, 23, 1524. (Managing editor ZHANG Juan)
© 2013, CAAS. All rights reserved. Published by Elsevier Ltd.