- Email: [email protected]
Identification of substrains of BCG vaccine using multiplex PCR
Vaccine 19 (2001) 2146– 2151 www.elsevier.com/locate/vaccine
Identification of substrains of BCG vaccine using multiplex PCR Joanne Bedwell a,*, Satnam K. Kairo a, Marcel A. Behr b, Jane A. Bygraves a a
Di6ision of Bacteriology, National Institute for Biological Standards and Control, Blanche Lane, South Mimms, Potters Bar, Hertfordshire, EN6 3QG, UK b Di6ision of Infectious Diseases, Department of Medicine, McGill Uni6ersity Health Centre, Montreal, Que´bec, Canada H3G 1A4 Received 22 March 2000; received in revised form 2 September 2000; accepted 26 September 2000
Abstract Current methods for determining the identity of substrains of Mycobacterium bo6is BCG (BCG) vaccine are labour intensive, or provide only limited substrain differentiation. In this paper we describe a multiplex PCR that distinguishes between M. tuberculosis (TB) and M. bo6is and the non-pathogenic BCG strain, and also subdivides the BCG vaccine substrains investigated into seven distinct fingerprints based on six target regions in the DNA. This test is specific, rapid, reproducible and portable and is proposed as a novel test for BCG vaccine control. It offers substantial advantages over the methods currently in use. Using this test we have characterised a number of commercial BCG vaccines. © 2001 Elsevier Science Ltd. All rights reserved. Keywords: BCG vaccine; Identity; PCR
1. Introduction The current control methods recommended by the EP [1] and WHO [2] for confirming the identity of BCG vaccines involve microscopic examination of the bacilli in stained smears, demonstrating their acid-fast property, and determining the characteristic appearance of colonies grown on solid medium. Using this methodology it is not possible to differentiate between BCG and other members of the tuberculosis complex many of which are pathogenic. There is a requirement for an assay that could differentiate between BCG vaccine strains and distinguish them from related pathogenic mycobacteria. BCG vaccines although originating from one strain of Mycobacterium bo6is have, due to differing methods of passage and storage, produced many substrains showing phenotypic [3] and genetic heterogeneity [4]. These distinct characteristics have been used as a means of classification. The early BCG substrains, produced prior to 1926 [5], differ from late substrains because the former secrete the MPB70 antigen [6], produce methoxymycolates [7,8] and contain two copies of the * Corresponding author. Tel.: +44-1707-654753; fax: +441707646730. E-mail address: [email protected] (J. Bedwell).
IS986 insertion sequence [9]. Genetic identification techniques have been used on BCG to differentiate substrains including the use of a gene probe based on IS986; however, this method had only limited discriminatory ability and divided the substrains investigated into two groups [9]. Using restriction fragment patterns seven substrains of BCG were separated into six distinct entities [10] and in another study where large restriction fragment (LRF) patterns were used in combination with pulsed field gel electrophoresis, 25 BCG isolates gave between 11 and 15 different LRF patterns dependent on which restriction endonuclease was utilised [4]. Although discriminatory, RF patterns would not be suitable for routine control testing as they are labour intensive and have poor reproducibility and portability. PCR methodology is much more applicable to control testing and a number of methods have been developed to identify mycobacterial strains [11] including multiplex PCR [12 –14]. One PCR technique based on a deletion region from BCG vaccine strains, called the RD1 region, differentiated between the BCG strains and virulent TB and M. bo6is [14]. Using this method it was reported that the deletion of RD1 occurred in 23 of 23 BCG strains tested and the presence of RD1 was confirmed in 129 of 129 other M. tuberculosis complex strains. Another PCR procedure has been based on the
0264-410X/01/$ - see front matter © 2001 Elsevier Science Ltd. All rights reserved. PII: S 0 2 6 4 - 4 1 0 X ( 0 0 ) 0 0 3 6 9 - 8
J. Bedwell et al. / Vaccine 19 (2001) 2146–2151
intergenic region separating two genes encoding a mycobacterial two-component system SenX3 – RegX3. This has been used to differentiate BCG strains into three groups based on the PCR product length when run on an agarose gel [11]. As a result of the sequencing of the TB genome [15] it has now been possible to perform comparative genomics of BCG vaccines by whole-genome DNA microarray. Using this method 16 regions (RD1 to 16) were found to have been deleted from BCG strains in relation to the TB strain of H37Rv, some deletions varying between BCG substrains [16]. RD1 was lacking from all BCG vaccines and is presumed to have been lost during the initial attenuation between 1908 and 1921. The deletion of RD2 occurred at the Institut Pasteur between 1927 and 1931. A further deletion, RD14, that is specific to BCG Pasteur occurred between 1938 and 1961. Other deletions that occurred away from the Institut Pasteur are the loss of RD8 in Montre´al between 1937 and 1948 and RD16 in Uruguay or Brazil after 1925. We have exploited the deletion regions RD1, 2, 8, 14 and 16 in association with the SenX3 – RegX3 system to produce a multiplex PCR which has differentiated the BCG vaccine substrains studied into seven distinct fingerprints and confirmed all substrains to be BCG. To perform this PCR as a novel control test, no lengthy or difficult DNA extraction protocol from the vaccines was necessary and detection was easily achieved by agarose gel electrophoresis. This method has proven specific, rapid, reproducible and portable.
2. Materials and methods
2.1. Mycobacterial strains The mycobacterial strains used in this study were M. bo6is BCG Connaught (ATCC35745), Brazil (ATCC35736), Birkhaug (ATCC35731), Pasteur (ATCC35734), Japan (ATCC35737), Russia (ATCC35740) and Glaxo (ATCC35741) (American Type Culture Collection), Moreau, a kind gift from Dr L. Castello-Branco (Fundacao Ataulapho de Paiva, Brazil), Tice (Institut Pasteur, France), TB H37Rv (National Institute for Medical Research, UK), TB 5648 and M bo6is 1546 (Public Health Laboratory Service reference unit, UK).
2.2. DNA extraction All mycobacterial strains were grown on solid 7H11 medium (Difco Laboratories) for 21 days at 37°C. DNA extraction was then performed using a method based on that devised by Anderberg et al. [17]. Approximately 2× 109 colony forming units (c.f.u.) were resus-
2147
pended in 1 ml TE buffer (10 mM Tris and 1 mM EDTA, pH 7.5) with 200 mg/ml proteinase K (Sigma) and 10 mg/ml lysozyme (Sigma) and incubated at 37°C for 1 h with gentle agitation. Cells were then harvested in a microcentrifuge at 12 000× g for 1 min, the supernatant discarded and the cells resuspended in 750 ml lysis solution containing guanidine thiocyanate (Reagent 1 from IsoQuick nucleic acid extraction kit, ORCA Research). This suspension was placed in a 2 ml capacity Ribolyser tube (Hybaid) containing 100 mm glass beads and beaten in a Ribolyser (Hybaid) for 90 s at a 6.5 speed setting. The tube was placed on ice whilst the contents settled. The sample lysate (400 ml) was then transferred to a microcentrifuge tube and the method for rapid DNA extraction (IsoQuick nucleic acid extraction kit, ORCA Research) followed. In brief, an extraction matrix (reagent 2) and an extraction buffer (reagent 3) were added to the lysate and this was vortex mixed and microcentrifuged at 12 000× g for 5 min. This step produced an upper aqueous phase containing the DNA which was transferred to a microcentrifuge tube and sodium acetate (reagent 4) and isopropanol added. The DNA was pelleted by microcentrifugation at 12 000× g for 10 min, washed with 70% ethanol and the pellet resuspended in Rnase-free water (Reagent 5).
2.3. Multiplex PCR amplification and analysis A multiplex PCR was performed with 13 primers against six different targets (Table 1). These targets were the SenX3 –RegX3 system (C3 and C5) [11] and the BCG deletion regions including RD1 (ET1-3) [14], primers were designed to the RD2 region and primers to all other deletion regions RD8, 14 and 16 were obtained from supplemental data at http:// molepi.stanford.edu/bcg [16]. The PCR reactions were carried out in a Techne Genius thermal cycler (Techne Cambridge). The PCR was performed in a volume of 50 ml with approximately 100 ng of template DNA and 20 mM Tris –HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTP mix (0.2 mM of each base), 0.1% Triton × 100 (v/v), 0.4 mM of all primers except ET1 and ET3 which were at a concentration of 0.2 mM and 1.5 U Taq DNA polymerase (Perkin-Elmer). The thermal profile was 1 cycle at 94°C (10 min), and 30 cycles at 94°C (1 min), 55°C (1 min) and 72°C (2 min) and 1 cycle 72°C (10 min). The PCR products were then analysed by horizontal electrophoresis on 3% (w/ v) agarose gels containing ethidium bromide, as in Fig. 1. The gels were run for approximately 2 hours at 100 mA in 40 mM Tris –acetate buffer. To determine the portability of the multiplex PCR two other thermal cyclers were used, a DNA engine (MJ Research) and a Techne Progene thermal cycler (Techne Cambridge) whilst all other aspects of the reactions remained the same.
J. Bedwell et al. / Vaccine 19 (2001) 2146–2151
2148
Table 1 Oligonucleotide primers used in the multiplex PCRa Primer name
Primer sequence (5%–3%)
Primer start site
Sequence accession number
ET1 ET2 ET3 RD2l RD2r RD8l RD8r RD14l RD14r RD16l RD16r C3 C5
AAGCGGTTGCCGCCGACCGACC CTGGCTATATTCCTGGGCCCGG GAGGCGATCTGGCGGTTTGGGG CCAGATTCAAATGTCCGACC GTGTCATAGGTGATTGGCTT ACTCCTAGCTTTGCTGTGCGCT GTACTGCGGGATTTGCAGGTTC CAGGGTTGAAGGAATGCGTGTC CTGGTACACCTGGGGAATCTGG ATCGTTCACGGACAGCCGTAGT CTCGATCCAAGGTCAACCACG GCGCGAGAGCCCGAACTGC GCGCAGCAGAAACGTCAGC
2230 11785 11930 10827 11141 16687 17158 32258 32509 12378 12778 1469 1744
U34848 U34848 U34848 U34849 U34849 Z96800 Z96800 Z95890 Z95890 Z77165 Z77165 Y13627 Y13627
a
Left primers are denoted by l and right primers by r. All sequences used for primer design can be found in EMBL.
2.4. Identity test for BCG 6accines Test BCG vaccines were commercial preparations of the Copenhagen, Glaxo, Tice or Japan substrains. Freeze-dried BCG vaccines were reconstituted in 1 ml of sterile water and centrifuged at 12 000×g for 10 min to remove surfactants. The pellets were then resuspended in sterile water at approximately 100 ml for 1 × 107 c.f.u. Five microlitres of any vaccine preparation was added per 50 ml PCR reaction instead of the chromosomal DNA. For the determination of the presence of mixed substrains in vaccine preparations the vaccines were grown on solid 7H11 medium (Difco Laboratories) for 21 days at 37°C and a single colony added to a PCR reaction instead of the chromosomal DNA.
2.5. DNA sequencing
BCG substrains examined gave a 196 base pair product with primers ET1 to 3, indicating deletion of the RD1 region, whereas the TB and M. bo6is strains gave a 146 base pair product indicating the presence of RD1. RD2 was present in BCG Moreau, Russia, Japan, and Birkhaug and gave a product of 315 base pairs. RD8 was present in Moreau, Russia, Japan, Tice, Glaxo, Pasteur and Birkhaug and gave a product of 472 base pairs. RD14 was present in Moreau, Russia, Japan, Connaught, Tice, Glaxo and Birkhaug and gave a product of 252 base pairs. RD16 was present in Russia, Japan, Connaught, Tice, Glaxo, Pasteur and Birkhaug and gave a product of 401 base pairs in all substrains examined except Japan that gave a product of 379 base pairs. The primers for the SenX3 –RegX3 region gave three different sized products with the BCG substrains examined. Japan, Glaxo and Birkhaug gave a product of 353 base pairs, whereas Russia, Moreau, Tice, Pas-
Sequences for the RD16 region were determined for Russia, Glaxo, Pasteur, Birkhaug, Connaught, Japan strains and the commercial Japan preparation. To prepare the RD16 region DNA for sequencing PCR was performed in the same manner as for the multiplex but only the specific primers for the RD16 region were added to the reaction mix. Sequencing reactions were performed with Big Dye terminators (PE Biosystems), and the products were separated and detected with an Applied Biosystems Prism 377 automated sequencer. The sequences were assembled with the sequence analysis package of Staden [18].
3. Results The primer sets were designed to the deletion regions so that the amplification products would be different sizes when separated on an agarose gel (Fig. 1). All
Fig. 1. Fingerprints of isolated DNA of BCG substrains, TB and M. bo6is in the multiplex PCR. Lane 1, BCG Moreau; lane 2, BCG Russia; lane 3, BCG Connaught; lane 4, BCG Tice; lane 5, BCG Glaxo; lane 6, BCG Pasteur; lane 7, BCG Japan; lane 8, BCG Birkhaug; lane 9, TB H37Rv; lane 10 TB 5648; lane 11, M bo6is 1546. The bands are sized against a 50 base pair ladder.
J. Bedwell et al. / Vaccine 19 (2001) 2146–2151
Fig. 2. Fingerprints of BCG substrains in the multiplex PCR produced in three types of thermal cycler. Lanes marked 1, BCG Pasteur; lanes marked 2, BCG Glaxo, lanes marked 3, BCG Tice; lanes marked 4, BCG Connaught; lanes marked 5, BCG Birkhaug; lanes marked 6, BCG Russia; lanes marked 7, BCG Moreau. The bands are sized against a 50 base pair ladder.
teur, gave a product of 276 base pairs and Connaught a product of 199 base pairs which was indistinguishable from the product for the deletion of the RD1 region. Using these primer sets resolved the BCG substrains into seven distinct patterns. The smaller RD16 in substrain Japan gave this pattern a further subdivision (Fig. 1, lane 7). All seven patterns were identical irrespective of PCR thermal cycler used (Fig. 2). When using the multiplex PCR as a control test with the five commercial BCG vaccines, fingerprints were obtained by performing PCR reactions directly on the vaccines without prior DNA extraction (Fig. 3). The Glaxo strains and the Tice gave the expected fingerprints. The Copenhagen strain gave a fingerprint that appeared to be a combination of the Glaxo and Tice due to the presence of two SenX3 – RegX3 bands one of 276 base pairs and one of 353 base pairs. The presence of both types of fingerprint independently was confirmed by analysing single colonies of vaccine in specific SenX3 –RegX3 and multiplex PCR. The Japan strain gave the expected fingerprint but showed two RD16
Fig. 3. Fingerprints of commercial BCG vaccines in the multiplex PCR. Lane 1, BCG Japan; lanes 2 and 3, BCG Glaxo; lane 4, BCG Copenhagen; lane 5, BCG Tice. The bands are sized against a 50 base pair ladder.
2149
products one of 401 base pairs and the other 379 base pairs. When analysing single colonies from the Japan vaccine in a specific PCR both sizes of RD16 region were obtained independently and in the multiplex PCR two types of fingerprints were obtained, one identical to the BCG Japan and one identical to BCG Birkhaug. To investigate the size difference in the BCG Japan RD16 product, the nucleotide sequence of this region was determined for the Japan substrain and five other BCG substrains and in the commercial preparation of Japan substrain. All RD16 regions sequenced had the same sequence as the TB genome in the region examined, except for Japan which had 22 base pairs missing between positions 12669 and 12690 of the published sequence Z77165 [15]. This BCG Japan sequence will appear in the EMBL database under the accession number AJ276503. Additionally, in the commercial preparation of BCG Japan two differently sized products were observed in a PCR with the specific RD16 primers and these were identified as the standard TB sequence and the shorter BCG Japan sequence.
4. Discussion The current EP [1] and WHO [2] requirements for identity testing BCG vaccines have no specificity for BCG. Whether grown on solid media or stained for acid fastness BCG will be indistinguishable from pathogenic mycobacteria from the tuberculosis complex. Supporting test methods are used to determine absence of virulence in these preparations; nevertheless, a rapid and specific test to identify BCG vaccines and differentiate into substrains would considerably improve the control and standardisation of these products. BCG substrains can be distinguished from each other by certain phenotypic and biochemical criteria, however, the best means of differentiation is at the genomic level. A range of differences between substrains have been identified due to the sequencing of the TB genome [15] and utilisation of advanced DNA microarray technology and are based on regions deleted from all, or certain, substrains of BCG vaccine [16]. We have exploited this information in association with two published PCR methods for distinguishing between BCG and virulent strains of the tuberculosis complex [11,14] to produce a novel multiplex PCR identity test for BCG vaccines. DNA from a range of BCG vaccine substrains was studied in the multiplex PCR and gave seven easily distinguishable fingerprints on agarose gel electrophoresis (Fig. 1). All fingerprints were reproducible in different experiments and also in different PCR thermal cyclers (Fig. 2). This suggests that this method would yield consistent data between different experiments in the same laboratory, but should also be portable be-
2150
J. Bedwell et al. / Vaccine 19 (2001) 2146–2151
tween laboratories, which is critical for a control test. To allow this portability to extend to other control laboratories, a standardised mix of primers, or total PCR reaction mix, could be prepared and freeze dried as examined by Klatser et al. [19] who found this mix to be stable when detecting mycobacteria in clinical samples. The multiplex PCR was easily developed to assay BCG directly from vaccine samples without the need to extract DNA. A simple wash step was performed to remove any detergents that might be in the preparations that could interfere in the PCR reaction. A 10 minute 940C incubation step at the beginning of the multiplex PCR was sufficient to liberate enough DNA to obtain clear fingerprints (Fig. 3). The PCR fingerprints produced directly from DNA samples were consistent with predictions based on published genetic information on BCG substrains with a few exceptions. The expected size of the PCR product due to deletion of the RD1 region from BCG strains from nucleotide sequence data was 196 base pairs not the published 200 base pairs [14]. To confirm this in all agarose gels, this band always ran slightly in front of the 200 base pair marker. The ATCC strain of Japan had an RD16 region which was 22 base pairs shorter than all other substrains examined and which was readily visible on 3% agarose gels, but also confirmed by sequencing. BCG Glaxo gave a different sized product for SenX3 – RegX3 operon either in the multiplex, or specific primer PCR to that reported by Magdalena et al. [11]. In our study using either DNA produced from BCG Glaxo (ATCC35741) or amplifying from either of two commercial preparation of BCG Glaxo vaccine directly, gave a band of 353 base pairs. However, all these Glaxo strains were obtained from a different source to that previously reported providing the likely explanation for the difference. In agreement with Behr and Small [5], the ATCC Brazil strain had an unexpected genotype and gave an identical pattern to the ATCC Connaught strain (presence of RD14 and 16 and absence of RD2 and 8 and a SenX3 – RegX3 product of 199 base pairs). However, when using BCG Moreau from Brazil, the expected pattern of PCR products was obtained (presence of RD2, 8 and 14 and absence of RD16 and SenX3 – RegX3 product of 276 base pairs). This has been considered to be the actual genotype of BCG Moreau suggested by its history [5] and previous molecular studies [6,9]. The considerable ability of this multiplex PCR to discriminate between BCG substrains was proven using commercial preparations. Resultant fingerprints were not always as expected from the substrain suggested in a preparation. Interestingly, when screening the commercial Japan preparation two PCR products were observed corresponding to the RD16 region. When these products were sequenced the longer
product was identical to the RD16 products from all substrains of BCG other than Japan and the smaller identical to the ATCC Japan substrain as it had the same 22 base pairs missing. This suggested that the commercial preparation could be based on a mixed culture, a finding confirmed by subsequent studies. Specific PCR amplification of the RD16 region from single colonies of Japan vaccine resulted in a single product but products of both sizes were obtained from different colonies. The full multiplex PCR on single colonies gave fingerprints of substrains Japan and Birkhaug suggesting that these substrains became inadvertently mixed at sometime. However, there is no indication of this from the literature [20]. The Copenhagen commercial preparation of BCG vaccine also gave an unexpected fingerprint as it gave two SenX3 –RegX3 products of different size from the same preparation. When investigated to determine if it contained mixed substrains, separate fingerprints identical to either Glaxo or Tice were obtained from multiplex PCR with single colonies. The novel approach described here may prove suitable for identification of BCG in clinical samples as well as vaccines. Although considered non-pathogenic, in certain circumstances BCG can cause disease in humans when given to an immunosuppressed individual [21]. Also BCG is being used as an immunostimulatory agent to prevent relapses of urinary bladder carcinoma and this may produce local, regional or systemic infection [22]. The multiplex PCR could be used to determine whether mycobacterial infection occurred due to introduction of BCG vaccine and whether the PCR banding of the disease resembles that of the original vaccination. Such a clinical study has been performed using the multiplex PCR based on the deletion region RD1 [14] for specific identification of BCG isolates from a variety of clinical situations including both immunosuppressed children and adults undergoing therapy for bladder cancer. This study found that the assay was a rapid, simple and effective method for the discrimination of the BCG vaccine strain from other members of the M. tuberculosis complex [23]. This suggests that our novel PCR could be effective on similar samples but would also supply information on the substrain of BCG causing the infection, which could be compared to that used for the vaccination. Once standardised within a control laboratory the novel multiplex PCR could be very effective for determining the identity of BCG vaccines. Many vaccine substrains will give a distinctive fingerprint based on BCG deletion and variable regions, and this test may identify polymorphism in these regions or the presence of mixed strains. The identity can then be assured for all new lots of vaccine, particularly when changing master seed lots.
J. Bedwell et al. / Vaccine 19 (2001) 2146–2151
References [1] European Pharmacopoeia Commission. Freeze-dried BCG vaccine. In: European Pharmacopoeia, 3rd edn. Strasbourg: Council of Europe, 1997:442–443. [2] Donikian R, Gheorghiu M, Jablokova TB. Requirements for dried BCG vaccine. WHO Tech Rep Ser 1987;745:60–92. [3] Anonymous. Phenotypes of BCG-vaccines seed lot strains: results of an international cooperative study. International Union against Tuberculosis. Tubercle 1978;59:139–142. [4] Zhang Y, Wallace RJ, Jr, Mazurek GH. Genetic differences between BCG substrains. Tuberc Lung Dis 1995;76:43–50. [5] Behr MA, Small PM. A historical and molecular phylogeny of BCG strains. Vaccine 1999;17:915–22. [6] Harboe M, Nagai S. MPB70, a unique antigen of Mycobacterium bo6is BCG. Am Rev Respir Dis 1984;129:444–52. [7] Minnikin DE, Parlett JH, Magnusson M, Ridell M, Lind A. Mycolic acid patterns of representatives of Mycobacterium bo6is BCG. J Gen Microbiol 1984;130:2733–6. [8] Behr MA, Schroeder BG, Brinkman JN, Slayden RA, Barry CE III. Point mutation in mma3 gene is responsible for impaired methoxymycolic acid production in BCG strains obtained after 1927. J Bacteriol (in press). [9] Fomukong NG, Dale JW, Osborn TW, Grange JM. Use of gene probes based on the insertion sequence IS986 to differentiate between BCG vaccine strains. J Appl Bacteriol 1992;72:126– 33. [10] Collins DM, de Lisle GW. BCG identification by DNA restriction fragment patterns. J Gen Microbiol 1987;133:1431– 4. [11] Magdalena J, Supply P, Locht C. Specific differentiation between Mycobacterium bo6is BCG and virulent strains of the Mycobacterium tuberculosis complex. J Clin Microbiol 1998;36:2471– 6. [12] Del Portillo P, Thomas MC, Martinez E, et al. Multiprimer PCR
.
[13]
[14] [15]
[16]
[17]
[18] [19]
[20]
[21]
[22] [23]
2151
system for differential identification of mycobacteria in clinical samples. J Clin Microbiol 1996;34:324– 8. Herrera EA, Perez O, Segovia M. Differentiation between Mycobacterium tuberculosis and Mycobacterium bo6is by a multiplex-polymerase chain reaction. J Appl Bacteriol 1996;80:596– 604. Talbot EA, Williams DL, Frothingham R. PCR identification of Mycobacterium bo6is BCG. J Clin Microbiol 1997;35:566–9. Cole ST, Brosch R, Parkhill J, et al. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 1998;393:537– 44. Behr MA, Wilson MA, Gill WP, et al. Comparative genomics of BCG vaccines by whole-genome DNA microarray. Science 1999;284:1520– 3. Anderberg RJ, Strachan JA, Cangelosi GA. Purification of DNA from Mycobacterium species without sonication or phenol. Biotechniques 1995;18:217– 9. Staden R. The Staden sequence analysis package. Mol Biotechnol 1996;5:233– 41. Klatser PR, Kuijper S, van Ingen CW, Kolk AH. Stabilized, freeze-dried PCR mix for detection of mycobacteria. J Clin Microbiol 1998;36:1798– 800. Guld J. Requirements for BCG vaccine, and reference batches of BCG vaccine: the present situation. WHO Expert Comm Biol Stand 1962;590:1– 3. Abramowsky C, Gonzalez B, Sorensen RU. Disseminated bacillus Calmette– Guerin infections in patients with primary immunodeficiencies. Am J Clin Pathol 1993;100:52– 6. Nicol D. BCG in bladder cancer — a warning. Aust NZ J Med 1995;25:275– 7 (Editorial). Kearns AM, Magee JG, Gennery A, et al. Rapid identification of Mycobacterium bo6is BCG by the detection of the RD1 deletion using a multiplex PCR technique. Int J Tuberc Lung Dis 1999;3:635– 8.
Identification of substrains of BCG vaccine using multiplex PCR Joanne Bedwell a,*, Satnam K. Kairo a, Marcel A. Behr b, Jane A. Bygraves a a
Di6ision of Bacteriology, National Institute for Biological Standards and Control, Blanche Lane, South Mimms, Potters Bar, Hertfordshire, EN6 3QG, UK b Di6ision of Infectious Diseases, Department of Medicine, McGill Uni6ersity Health Centre, Montreal, Que´bec, Canada H3G 1A4 Received 22 March 2000; received in revised form 2 September 2000; accepted 26 September 2000
Abstract Current methods for determining the identity of substrains of Mycobacterium bo6is BCG (BCG) vaccine are labour intensive, or provide only limited substrain differentiation. In this paper we describe a multiplex PCR that distinguishes between M. tuberculosis (TB) and M. bo6is and the non-pathogenic BCG strain, and also subdivides the BCG vaccine substrains investigated into seven distinct fingerprints based on six target regions in the DNA. This test is specific, rapid, reproducible and portable and is proposed as a novel test for BCG vaccine control. It offers substantial advantages over the methods currently in use. Using this test we have characterised a number of commercial BCG vaccines. © 2001 Elsevier Science Ltd. All rights reserved. Keywords: BCG vaccine; Identity; PCR
1. Introduction The current control methods recommended by the EP [1] and WHO [2] for confirming the identity of BCG vaccines involve microscopic examination of the bacilli in stained smears, demonstrating their acid-fast property, and determining the characteristic appearance of colonies grown on solid medium. Using this methodology it is not possible to differentiate between BCG and other members of the tuberculosis complex many of which are pathogenic. There is a requirement for an assay that could differentiate between BCG vaccine strains and distinguish them from related pathogenic mycobacteria. BCG vaccines although originating from one strain of Mycobacterium bo6is have, due to differing methods of passage and storage, produced many substrains showing phenotypic [3] and genetic heterogeneity [4]. These distinct characteristics have been used as a means of classification. The early BCG substrains, produced prior to 1926 [5], differ from late substrains because the former secrete the MPB70 antigen [6], produce methoxymycolates [7,8] and contain two copies of the * Corresponding author. Tel.: +44-1707-654753; fax: +441707646730. E-mail address: [email protected] (J. Bedwell).
IS986 insertion sequence [9]. Genetic identification techniques have been used on BCG to differentiate substrains including the use of a gene probe based on IS986; however, this method had only limited discriminatory ability and divided the substrains investigated into two groups [9]. Using restriction fragment patterns seven substrains of BCG were separated into six distinct entities [10] and in another study where large restriction fragment (LRF) patterns were used in combination with pulsed field gel electrophoresis, 25 BCG isolates gave between 11 and 15 different LRF patterns dependent on which restriction endonuclease was utilised [4]. Although discriminatory, RF patterns would not be suitable for routine control testing as they are labour intensive and have poor reproducibility and portability. PCR methodology is much more applicable to control testing and a number of methods have been developed to identify mycobacterial strains [11] including multiplex PCR [12 –14]. One PCR technique based on a deletion region from BCG vaccine strains, called the RD1 region, differentiated between the BCG strains and virulent TB and M. bo6is [14]. Using this method it was reported that the deletion of RD1 occurred in 23 of 23 BCG strains tested and the presence of RD1 was confirmed in 129 of 129 other M. tuberculosis complex strains. Another PCR procedure has been based on the
0264-410X/01/$ - see front matter © 2001 Elsevier Science Ltd. All rights reserved. PII: S 0 2 6 4 - 4 1 0 X ( 0 0 ) 0 0 3 6 9 - 8
J. Bedwell et al. / Vaccine 19 (2001) 2146–2151
intergenic region separating two genes encoding a mycobacterial two-component system SenX3 – RegX3. This has been used to differentiate BCG strains into three groups based on the PCR product length when run on an agarose gel [11]. As a result of the sequencing of the TB genome [15] it has now been possible to perform comparative genomics of BCG vaccines by whole-genome DNA microarray. Using this method 16 regions (RD1 to 16) were found to have been deleted from BCG strains in relation to the TB strain of H37Rv, some deletions varying between BCG substrains [16]. RD1 was lacking from all BCG vaccines and is presumed to have been lost during the initial attenuation between 1908 and 1921. The deletion of RD2 occurred at the Institut Pasteur between 1927 and 1931. A further deletion, RD14, that is specific to BCG Pasteur occurred between 1938 and 1961. Other deletions that occurred away from the Institut Pasteur are the loss of RD8 in Montre´al between 1937 and 1948 and RD16 in Uruguay or Brazil after 1925. We have exploited the deletion regions RD1, 2, 8, 14 and 16 in association with the SenX3 – RegX3 system to produce a multiplex PCR which has differentiated the BCG vaccine substrains studied into seven distinct fingerprints and confirmed all substrains to be BCG. To perform this PCR as a novel control test, no lengthy or difficult DNA extraction protocol from the vaccines was necessary and detection was easily achieved by agarose gel electrophoresis. This method has proven specific, rapid, reproducible and portable.
2. Materials and methods
2.1. Mycobacterial strains The mycobacterial strains used in this study were M. bo6is BCG Connaught (ATCC35745), Brazil (ATCC35736), Birkhaug (ATCC35731), Pasteur (ATCC35734), Japan (ATCC35737), Russia (ATCC35740) and Glaxo (ATCC35741) (American Type Culture Collection), Moreau, a kind gift from Dr L. Castello-Branco (Fundacao Ataulapho de Paiva, Brazil), Tice (Institut Pasteur, France), TB H37Rv (National Institute for Medical Research, UK), TB 5648 and M bo6is 1546 (Public Health Laboratory Service reference unit, UK).
2.2. DNA extraction All mycobacterial strains were grown on solid 7H11 medium (Difco Laboratories) for 21 days at 37°C. DNA extraction was then performed using a method based on that devised by Anderberg et al. [17]. Approximately 2× 109 colony forming units (c.f.u.) were resus-
2147
pended in 1 ml TE buffer (10 mM Tris and 1 mM EDTA, pH 7.5) with 200 mg/ml proteinase K (Sigma) and 10 mg/ml lysozyme (Sigma) and incubated at 37°C for 1 h with gentle agitation. Cells were then harvested in a microcentrifuge at 12 000× g for 1 min, the supernatant discarded and the cells resuspended in 750 ml lysis solution containing guanidine thiocyanate (Reagent 1 from IsoQuick nucleic acid extraction kit, ORCA Research). This suspension was placed in a 2 ml capacity Ribolyser tube (Hybaid) containing 100 mm glass beads and beaten in a Ribolyser (Hybaid) for 90 s at a 6.5 speed setting. The tube was placed on ice whilst the contents settled. The sample lysate (400 ml) was then transferred to a microcentrifuge tube and the method for rapid DNA extraction (IsoQuick nucleic acid extraction kit, ORCA Research) followed. In brief, an extraction matrix (reagent 2) and an extraction buffer (reagent 3) were added to the lysate and this was vortex mixed and microcentrifuged at 12 000× g for 5 min. This step produced an upper aqueous phase containing the DNA which was transferred to a microcentrifuge tube and sodium acetate (reagent 4) and isopropanol added. The DNA was pelleted by microcentrifugation at 12 000× g for 10 min, washed with 70% ethanol and the pellet resuspended in Rnase-free water (Reagent 5).
2.3. Multiplex PCR amplification and analysis A multiplex PCR was performed with 13 primers against six different targets (Table 1). These targets were the SenX3 –RegX3 system (C3 and C5) [11] and the BCG deletion regions including RD1 (ET1-3) [14], primers were designed to the RD2 region and primers to all other deletion regions RD8, 14 and 16 were obtained from supplemental data at http:// molepi.stanford.edu/bcg [16]. The PCR reactions were carried out in a Techne Genius thermal cycler (Techne Cambridge). The PCR was performed in a volume of 50 ml with approximately 100 ng of template DNA and 20 mM Tris –HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTP mix (0.2 mM of each base), 0.1% Triton × 100 (v/v), 0.4 mM of all primers except ET1 and ET3 which were at a concentration of 0.2 mM and 1.5 U Taq DNA polymerase (Perkin-Elmer). The thermal profile was 1 cycle at 94°C (10 min), and 30 cycles at 94°C (1 min), 55°C (1 min) and 72°C (2 min) and 1 cycle 72°C (10 min). The PCR products were then analysed by horizontal electrophoresis on 3% (w/ v) agarose gels containing ethidium bromide, as in Fig. 1. The gels were run for approximately 2 hours at 100 mA in 40 mM Tris –acetate buffer. To determine the portability of the multiplex PCR two other thermal cyclers were used, a DNA engine (MJ Research) and a Techne Progene thermal cycler (Techne Cambridge) whilst all other aspects of the reactions remained the same.
J. Bedwell et al. / Vaccine 19 (2001) 2146–2151
2148
Table 1 Oligonucleotide primers used in the multiplex PCRa Primer name
Primer sequence (5%–3%)
Primer start site
Sequence accession number
ET1 ET2 ET3 RD2l RD2r RD8l RD8r RD14l RD14r RD16l RD16r C3 C5
AAGCGGTTGCCGCCGACCGACC CTGGCTATATTCCTGGGCCCGG GAGGCGATCTGGCGGTTTGGGG CCAGATTCAAATGTCCGACC GTGTCATAGGTGATTGGCTT ACTCCTAGCTTTGCTGTGCGCT GTACTGCGGGATTTGCAGGTTC CAGGGTTGAAGGAATGCGTGTC CTGGTACACCTGGGGAATCTGG ATCGTTCACGGACAGCCGTAGT CTCGATCCAAGGTCAACCACG GCGCGAGAGCCCGAACTGC GCGCAGCAGAAACGTCAGC
2230 11785 11930 10827 11141 16687 17158 32258 32509 12378 12778 1469 1744
U34848 U34848 U34848 U34849 U34849 Z96800 Z96800 Z95890 Z95890 Z77165 Z77165 Y13627 Y13627
a
Left primers are denoted by l and right primers by r. All sequences used for primer design can be found in EMBL.
2.4. Identity test for BCG 6accines Test BCG vaccines were commercial preparations of the Copenhagen, Glaxo, Tice or Japan substrains. Freeze-dried BCG vaccines were reconstituted in 1 ml of sterile water and centrifuged at 12 000×g for 10 min to remove surfactants. The pellets were then resuspended in sterile water at approximately 100 ml for 1 × 107 c.f.u. Five microlitres of any vaccine preparation was added per 50 ml PCR reaction instead of the chromosomal DNA. For the determination of the presence of mixed substrains in vaccine preparations the vaccines were grown on solid 7H11 medium (Difco Laboratories) for 21 days at 37°C and a single colony added to a PCR reaction instead of the chromosomal DNA.
2.5. DNA sequencing
BCG substrains examined gave a 196 base pair product with primers ET1 to 3, indicating deletion of the RD1 region, whereas the TB and M. bo6is strains gave a 146 base pair product indicating the presence of RD1. RD2 was present in BCG Moreau, Russia, Japan, and Birkhaug and gave a product of 315 base pairs. RD8 was present in Moreau, Russia, Japan, Tice, Glaxo, Pasteur and Birkhaug and gave a product of 472 base pairs. RD14 was present in Moreau, Russia, Japan, Connaught, Tice, Glaxo and Birkhaug and gave a product of 252 base pairs. RD16 was present in Russia, Japan, Connaught, Tice, Glaxo, Pasteur and Birkhaug and gave a product of 401 base pairs in all substrains examined except Japan that gave a product of 379 base pairs. The primers for the SenX3 –RegX3 region gave three different sized products with the BCG substrains examined. Japan, Glaxo and Birkhaug gave a product of 353 base pairs, whereas Russia, Moreau, Tice, Pas-
Sequences for the RD16 region were determined for Russia, Glaxo, Pasteur, Birkhaug, Connaught, Japan strains and the commercial Japan preparation. To prepare the RD16 region DNA for sequencing PCR was performed in the same manner as for the multiplex but only the specific primers for the RD16 region were added to the reaction mix. Sequencing reactions were performed with Big Dye terminators (PE Biosystems), and the products were separated and detected with an Applied Biosystems Prism 377 automated sequencer. The sequences were assembled with the sequence analysis package of Staden [18].
3. Results The primer sets were designed to the deletion regions so that the amplification products would be different sizes when separated on an agarose gel (Fig. 1). All
Fig. 1. Fingerprints of isolated DNA of BCG substrains, TB and M. bo6is in the multiplex PCR. Lane 1, BCG Moreau; lane 2, BCG Russia; lane 3, BCG Connaught; lane 4, BCG Tice; lane 5, BCG Glaxo; lane 6, BCG Pasteur; lane 7, BCG Japan; lane 8, BCG Birkhaug; lane 9, TB H37Rv; lane 10 TB 5648; lane 11, M bo6is 1546. The bands are sized against a 50 base pair ladder.
J. Bedwell et al. / Vaccine 19 (2001) 2146–2151
Fig. 2. Fingerprints of BCG substrains in the multiplex PCR produced in three types of thermal cycler. Lanes marked 1, BCG Pasteur; lanes marked 2, BCG Glaxo, lanes marked 3, BCG Tice; lanes marked 4, BCG Connaught; lanes marked 5, BCG Birkhaug; lanes marked 6, BCG Russia; lanes marked 7, BCG Moreau. The bands are sized against a 50 base pair ladder.
teur, gave a product of 276 base pairs and Connaught a product of 199 base pairs which was indistinguishable from the product for the deletion of the RD1 region. Using these primer sets resolved the BCG substrains into seven distinct patterns. The smaller RD16 in substrain Japan gave this pattern a further subdivision (Fig. 1, lane 7). All seven patterns were identical irrespective of PCR thermal cycler used (Fig. 2). When using the multiplex PCR as a control test with the five commercial BCG vaccines, fingerprints were obtained by performing PCR reactions directly on the vaccines without prior DNA extraction (Fig. 3). The Glaxo strains and the Tice gave the expected fingerprints. The Copenhagen strain gave a fingerprint that appeared to be a combination of the Glaxo and Tice due to the presence of two SenX3 – RegX3 bands one of 276 base pairs and one of 353 base pairs. The presence of both types of fingerprint independently was confirmed by analysing single colonies of vaccine in specific SenX3 –RegX3 and multiplex PCR. The Japan strain gave the expected fingerprint but showed two RD16
Fig. 3. Fingerprints of commercial BCG vaccines in the multiplex PCR. Lane 1, BCG Japan; lanes 2 and 3, BCG Glaxo; lane 4, BCG Copenhagen; lane 5, BCG Tice. The bands are sized against a 50 base pair ladder.
2149
products one of 401 base pairs and the other 379 base pairs. When analysing single colonies from the Japan vaccine in a specific PCR both sizes of RD16 region were obtained independently and in the multiplex PCR two types of fingerprints were obtained, one identical to the BCG Japan and one identical to BCG Birkhaug. To investigate the size difference in the BCG Japan RD16 product, the nucleotide sequence of this region was determined for the Japan substrain and five other BCG substrains and in the commercial preparation of Japan substrain. All RD16 regions sequenced had the same sequence as the TB genome in the region examined, except for Japan which had 22 base pairs missing between positions 12669 and 12690 of the published sequence Z77165 [15]. This BCG Japan sequence will appear in the EMBL database under the accession number AJ276503. Additionally, in the commercial preparation of BCG Japan two differently sized products were observed in a PCR with the specific RD16 primers and these were identified as the standard TB sequence and the shorter BCG Japan sequence.
4. Discussion The current EP [1] and WHO [2] requirements for identity testing BCG vaccines have no specificity for BCG. Whether grown on solid media or stained for acid fastness BCG will be indistinguishable from pathogenic mycobacteria from the tuberculosis complex. Supporting test methods are used to determine absence of virulence in these preparations; nevertheless, a rapid and specific test to identify BCG vaccines and differentiate into substrains would considerably improve the control and standardisation of these products. BCG substrains can be distinguished from each other by certain phenotypic and biochemical criteria, however, the best means of differentiation is at the genomic level. A range of differences between substrains have been identified due to the sequencing of the TB genome [15] and utilisation of advanced DNA microarray technology and are based on regions deleted from all, or certain, substrains of BCG vaccine [16]. We have exploited this information in association with two published PCR methods for distinguishing between BCG and virulent strains of the tuberculosis complex [11,14] to produce a novel multiplex PCR identity test for BCG vaccines. DNA from a range of BCG vaccine substrains was studied in the multiplex PCR and gave seven easily distinguishable fingerprints on agarose gel electrophoresis (Fig. 1). All fingerprints were reproducible in different experiments and also in different PCR thermal cyclers (Fig. 2). This suggests that this method would yield consistent data between different experiments in the same laboratory, but should also be portable be-
2150
J. Bedwell et al. / Vaccine 19 (2001) 2146–2151
tween laboratories, which is critical for a control test. To allow this portability to extend to other control laboratories, a standardised mix of primers, or total PCR reaction mix, could be prepared and freeze dried as examined by Klatser et al. [19] who found this mix to be stable when detecting mycobacteria in clinical samples. The multiplex PCR was easily developed to assay BCG directly from vaccine samples without the need to extract DNA. A simple wash step was performed to remove any detergents that might be in the preparations that could interfere in the PCR reaction. A 10 minute 940C incubation step at the beginning of the multiplex PCR was sufficient to liberate enough DNA to obtain clear fingerprints (Fig. 3). The PCR fingerprints produced directly from DNA samples were consistent with predictions based on published genetic information on BCG substrains with a few exceptions. The expected size of the PCR product due to deletion of the RD1 region from BCG strains from nucleotide sequence data was 196 base pairs not the published 200 base pairs [14]. To confirm this in all agarose gels, this band always ran slightly in front of the 200 base pair marker. The ATCC strain of Japan had an RD16 region which was 22 base pairs shorter than all other substrains examined and which was readily visible on 3% agarose gels, but also confirmed by sequencing. BCG Glaxo gave a different sized product for SenX3 – RegX3 operon either in the multiplex, or specific primer PCR to that reported by Magdalena et al. [11]. In our study using either DNA produced from BCG Glaxo (ATCC35741) or amplifying from either of two commercial preparation of BCG Glaxo vaccine directly, gave a band of 353 base pairs. However, all these Glaxo strains were obtained from a different source to that previously reported providing the likely explanation for the difference. In agreement with Behr and Small [5], the ATCC Brazil strain had an unexpected genotype and gave an identical pattern to the ATCC Connaught strain (presence of RD14 and 16 and absence of RD2 and 8 and a SenX3 – RegX3 product of 199 base pairs). However, when using BCG Moreau from Brazil, the expected pattern of PCR products was obtained (presence of RD2, 8 and 14 and absence of RD16 and SenX3 – RegX3 product of 276 base pairs). This has been considered to be the actual genotype of BCG Moreau suggested by its history [5] and previous molecular studies [6,9]. The considerable ability of this multiplex PCR to discriminate between BCG substrains was proven using commercial preparations. Resultant fingerprints were not always as expected from the substrain suggested in a preparation. Interestingly, when screening the commercial Japan preparation two PCR products were observed corresponding to the RD16 region. When these products were sequenced the longer
product was identical to the RD16 products from all substrains of BCG other than Japan and the smaller identical to the ATCC Japan substrain as it had the same 22 base pairs missing. This suggested that the commercial preparation could be based on a mixed culture, a finding confirmed by subsequent studies. Specific PCR amplification of the RD16 region from single colonies of Japan vaccine resulted in a single product but products of both sizes were obtained from different colonies. The full multiplex PCR on single colonies gave fingerprints of substrains Japan and Birkhaug suggesting that these substrains became inadvertently mixed at sometime. However, there is no indication of this from the literature [20]. The Copenhagen commercial preparation of BCG vaccine also gave an unexpected fingerprint as it gave two SenX3 –RegX3 products of different size from the same preparation. When investigated to determine if it contained mixed substrains, separate fingerprints identical to either Glaxo or Tice were obtained from multiplex PCR with single colonies. The novel approach described here may prove suitable for identification of BCG in clinical samples as well as vaccines. Although considered non-pathogenic, in certain circumstances BCG can cause disease in humans when given to an immunosuppressed individual [21]. Also BCG is being used as an immunostimulatory agent to prevent relapses of urinary bladder carcinoma and this may produce local, regional or systemic infection [22]. The multiplex PCR could be used to determine whether mycobacterial infection occurred due to introduction of BCG vaccine and whether the PCR banding of the disease resembles that of the original vaccination. Such a clinical study has been performed using the multiplex PCR based on the deletion region RD1 [14] for specific identification of BCG isolates from a variety of clinical situations including both immunosuppressed children and adults undergoing therapy for bladder cancer. This study found that the assay was a rapid, simple and effective method for the discrimination of the BCG vaccine strain from other members of the M. tuberculosis complex [23]. This suggests that our novel PCR could be effective on similar samples but would also supply information on the substrain of BCG causing the infection, which could be compared to that used for the vaccination. Once standardised within a control laboratory the novel multiplex PCR could be very effective for determining the identity of BCG vaccines. Many vaccine substrains will give a distinctive fingerprint based on BCG deletion and variable regions, and this test may identify polymorphism in these regions or the presence of mixed strains. The identity can then be assured for all new lots of vaccine, particularly when changing master seed lots.
J. Bedwell et al. / Vaccine 19 (2001) 2146–2151
References [1] European Pharmacopoeia Commission. Freeze-dried BCG vaccine. In: European Pharmacopoeia, 3rd edn. Strasbourg: Council of Europe, 1997:442–443. [2] Donikian R, Gheorghiu M, Jablokova TB. Requirements for dried BCG vaccine. WHO Tech Rep Ser 1987;745:60–92. [3] Anonymous. Phenotypes of BCG-vaccines seed lot strains: results of an international cooperative study. International Union against Tuberculosis. Tubercle 1978;59:139–142. [4] Zhang Y, Wallace RJ, Jr, Mazurek GH. Genetic differences between BCG substrains. Tuberc Lung Dis 1995;76:43–50. [5] Behr MA, Small PM. A historical and molecular phylogeny of BCG strains. Vaccine 1999;17:915–22. [6] Harboe M, Nagai S. MPB70, a unique antigen of Mycobacterium bo6is BCG. Am Rev Respir Dis 1984;129:444–52. [7] Minnikin DE, Parlett JH, Magnusson M, Ridell M, Lind A. Mycolic acid patterns of representatives of Mycobacterium bo6is BCG. J Gen Microbiol 1984;130:2733–6. [8] Behr MA, Schroeder BG, Brinkman JN, Slayden RA, Barry CE III. Point mutation in mma3 gene is responsible for impaired methoxymycolic acid production in BCG strains obtained after 1927. J Bacteriol (in press). [9] Fomukong NG, Dale JW, Osborn TW, Grange JM. Use of gene probes based on the insertion sequence IS986 to differentiate between BCG vaccine strains. J Appl Bacteriol 1992;72:126– 33. [10] Collins DM, de Lisle GW. BCG identification by DNA restriction fragment patterns. J Gen Microbiol 1987;133:1431– 4. [11] Magdalena J, Supply P, Locht C. Specific differentiation between Mycobacterium bo6is BCG and virulent strains of the Mycobacterium tuberculosis complex. J Clin Microbiol 1998;36:2471– 6. [12] Del Portillo P, Thomas MC, Martinez E, et al. Multiprimer PCR
.
[13]
[14] [15]
[16]
[17]
[18] [19]
[20]
[21]
[22] [23]
2151
system for differential identification of mycobacteria in clinical samples. J Clin Microbiol 1996;34:324– 8. Herrera EA, Perez O, Segovia M. Differentiation between Mycobacterium tuberculosis and Mycobacterium bo6is by a multiplex-polymerase chain reaction. J Appl Bacteriol 1996;80:596– 604. Talbot EA, Williams DL, Frothingham R. PCR identification of Mycobacterium bo6is BCG. J Clin Microbiol 1997;35:566–9. Cole ST, Brosch R, Parkhill J, et al. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 1998;393:537– 44. Behr MA, Wilson MA, Gill WP, et al. Comparative genomics of BCG vaccines by whole-genome DNA microarray. Science 1999;284:1520– 3. Anderberg RJ, Strachan JA, Cangelosi GA. Purification of DNA from Mycobacterium species without sonication or phenol. Biotechniques 1995;18:217– 9. Staden R. The Staden sequence analysis package. Mol Biotechnol 1996;5:233– 41. Klatser PR, Kuijper S, van Ingen CW, Kolk AH. Stabilized, freeze-dried PCR mix for detection of mycobacteria. J Clin Microbiol 1998;36:1798– 800. Guld J. Requirements for BCG vaccine, and reference batches of BCG vaccine: the present situation. WHO Expert Comm Biol Stand 1962;590:1– 3. Abramowsky C, Gonzalez B, Sorensen RU. Disseminated bacillus Calmette– Guerin infections in patients with primary immunodeficiencies. Am J Clin Pathol 1993;100:52– 6. Nicol D. BCG in bladder cancer — a warning. Aust NZ J Med 1995;25:275– 7 (Editorial). Kearns AM, Magee JG, Gennery A, et al. Rapid identification of Mycobacterium bo6is BCG by the detection of the RD1 deletion using a multiplex PCR technique. Int J Tuberc Lung Dis 1999;3:635– 8.