Identification of the aquaporin gene family in Cannabis sativa and evidence for the accumulation of silicon in its tissues

Plant Science 287 (2019) 110167

Contents lists available at ScienceDirect

Plant Science journal homepage: www.elsevier.com/locate/plantsci

Identification of the aquaporin gene family in Cannabis sativa and evidence for the accumulation of silicon in its tissues

T

Gea Guerrieroa, , Rupesh Deshmukhb, Humira Sonahb, Kjell Sergeanta, Jean-Francois Hausmana, Esther Lentzena, Nathalie Vallea, Khawar Sohail Siddiquic,1, Christopher Exleyd ⁎

a

Research and Innovation Department, Luxembourg Institute of Science and Technology, 5 Avenue des Hauts-Fourneaux, L-4362, Esch/Alzette, Luxembourg National Agri-Food Biotechnology Institute (NABI), Sector-81 (Knowledge City), P.O. Manauli, S.A.S. Nagar, Mohali, 140306, Punjab, India c Life Sciences Department, King Fahd University of Petroleum and Minerals (KFUPM), 31261, Dhahran, Saudi Arabia d The Birchall Centre, Lennard Jones Laboratories, Keele University, Keele, Staffordshire, ST5 5BG, UK b

ARTICLE INFO

ABSTRACT

Keywords: Cannabis sativa Aquaporin Silicon RT-qPCR NanoSIMS Biogenic silica

Cannabis sativa is an economically important crop providing bast fibres for the textile and biocomposite sector. Length is a fundamental characteristic determining the properties of bast fibres. Aquaporins, channel-forming proteins facilitating the passage of water, urea, as well as elements such as boron and silicon, are known to play a role in the control of fibre length in other species, like cotton. By mining the available genome, we here identify, for the first time, the aquaporin gene family of C. sativa. The analysis of published RNA-Seq data and targeted qPCR on a textile variety reveal an organ-specific expression of aquaporin genes. Computational analyses, including homology-based search, phylogeny and protein modelling, identify two NOD26-like intrinsic proteins harbouring the Gly-Ser-Gly-Arg (GSGR) aromatic/Arg selectivity filter and 108 amino acid NPA (Asn-Pro-Ala) spacing, features reported to be associated with silicon permeability. SIMS nano-analysis and silica extraction coupled to fluorescence microscopy performed on hemp plantlets reveal the presence of silicon in the bast fibres of the hypocotyl and in leaves. The accumulation of silica in the distal cell walls of bast fibres and in the basal cells of leaf trichomes is indicative of a mechanical role.

1. Introduction Cannabis sativa is an annual herbaceous plant that has witnessed a renewed interest because of its multiple applications in different industrial sectors. It is a source of woody and cellulosic fibres; the former (referred to as hurds or shivs) are used to manufacture a concrete-like material known as Hempcrete® and the latter are employed in biocomposites to substitute for glass fibres [1]. Bast fibres are extraxylary cells that mechanically support the phloem, they are very long and contain little lignin [2]. The mechanisms involved in bast fibre formation are still not fully unveiled [3], however recent high-throughput studies have contributed to identify key genes involved in their sequential developmental phases and cell wall thickening [4,5]. Bast fibres are very long cells which can attain a length of > 50 mm for primary bast fibres [2]. The mechanism of bast fibre elongation is of the diffuse anisotropic type and during growth they invade the middle lamellas of the neighboring cells (intrusive mechanism) [6,7]. During the phase of intrusive growth, turgor pressure ensures extension which

is thought to be regulated by aquaporins [8]. Aquaporins are indeed membrane proteins involved in the control of plant hydraulic parameters at the tissue and cell levels [9]. The role of aquaporins in cell elongation is confirmed by studies on cotton fibres, where PIP2 genes (encoding plasma membrane intrinsic proteins belonging to the aquaporin family) are specifically induced during fibre development [10]. Recently, aquaporins have been identified and classified in the fibre crop flax, where genes coding for TIPs (tonoplast intrinsic proteins) and PIPs are differentially expressed in inner and outer stem tissues [11]. The study of aquaporins in fibre crops is important to understand how turgor pressure is regulated during the phase of elongation and cell wall thickening. The stem of fibre crops is, in this respect, a valuable model system, since it shows a gradient of bast fibre developmental stages going from the top to the bottom. At the top, the fibres elongate massively, while after a specific point known as snap point [12] they start to thicken and this translates into a change in the overall mechanical properties of the stem. Specific aquaporins belonging to the NIP-III group have been

Corresponding author. E-mail address: [email protected] (G. Guerriero). 1 Present address: 8 Archibald Crescent, Rosemeadow, NSW2560, Australia. ⁎

https://doi.org/10.1016/j.plantsci.2019.110167 Received 26 April 2019; Received in revised form 3 June 2019; Accepted 7 June 2019 Available online 11 June 2019 0168-9452/ © 2019 Elsevier B.V. All rights reserved.

Plant Science 287 (2019) 110167

G. Guerriero, et al.

Table 1 Details of the primers used in this study. Name

Sequence (5'→3')

Amplicon size (bp)

Efficiency (%)

Tm (°C)

R2

CsaLsi2-3 Fwd CsaLsi2-3 Rev CsaLsi2-2 Fwd CsaLsi2-2 Rev CsaLsi2-1 Fwd CsaLsi2-1 Rev CsaNIP1-2 Fwd CsaNIP1-2 Rev CsaNIP3-2 Fwd CsaNIP3-2 Rev CsaNIP5-1 Fwd CsaNIP5-1 Rev

ATTCCCAGCACTTTGTGGAC GCTAGAACAGCTATCCCACCAG GGCTTCAAATGTCCCAACTG ATCCCAGCAATGACAGGTTC ATGTTCCACCCCATCCTTTC ATTGCCGATAGGAGTTGCAG CTCGGTGGTGGTAAATTTGG GATTGAAATGGGCACCAGAG TGCTGCCCTAAAACACTTCC CGTCAAGGGATGAAACACTG CTGCTTCACCGATTTTACCG AAAGTTCCCACGAACTCTGC

74

103.6

79.8

0.981

143

90.8

84.7

0.97

77

91.6

83.8

0.993

124

110

79.8

0.987

112

97.2

81.8

0.99

75

107.7

80.3

0.993

characterized as channels mediating the entry of silicon in plants [13]. With respect to silicon, plants can be accumulators, excluders or intermediate-type; the monocot rice is an emblematic example of a silicon accumulator, while members of the nightshade family (tomato, tobacco) are excluders [14,15]. In rice, a cooperative silicon uptake system composed of a NIP-III member (Lsi1) and an efflux transporter (Lsi2) has been described [16], together with an additional NIP-III channel, Lsi6, responsible for silicon distribution in rice shoots [17]. A recent study has shown that in NIP-III aquaporins a specific spacing of 108 amino acids between the NPA (Asn-Pro-Ala) domains is conserved among channels reported to be permeable to silicon [18]. Among fibre crops, C. sativa is known to silicify. Hemp trichomes were shown to accumulate silicon (as amorphous opaline silica) [19] and the hurds are known to contain silica, a feature which makes them associate well with lime-based binders via the pozzolanic reaction (i.e. formation of calcium silicate with cementing properties). The association of silica with hemp bast fibres may have an important impact in terms of plant physiology and industrial applications. Since hemp bast fibres are arranged in bundles interspersed in the cortex around the central vascular tissues, a ring strengthening the whole stem forms, thereby increasing the overall resistance to mechanical stress. A clear evidence of the beneficial role of silicon in plants is via its association with the cell wall [20]. Concerning the cell wall aspect, studies in the literature have pointed to hemicelluloses [21,22], pectins [23] and cellulose [24] as macromolecules favoring silica precipitation. However, robust data concerning promotion of silica deposition both in vivo and in vitro are only available for the amorphous macromolecule callose [25]. Callose is an ideal template for silicification, since its amorphous structure provides microenvironments favoring the condensation of silicic acid and the precipitation of silica [26]. When silica is extracted from plant organs/tissues and is visualized under the microscope with the fluor PDMPO, very detailed structures can be discerned: stomata, trichomes, epidermal papillae-like projections [25]. These results suggest that the various plant cell structures (i.e. stomata, trichomes, cuticular projections) have different propensities to silicify and this propensity must be established by the local abundance and structural properties of the macromolecules (i.e. amorphous cell wall components, like callose) templating silica precipitation. We here analyze the aquaporin gene family of hemp and identify their expression pattern in different organs, as well as during the stages of bast fibre elongation and cell wall thickening. Two systems are used, which have been previously studied by us, i.e. the hypocotyl and adult plants [5,27]. Given the fundamental and application-oriented interest of studying silicon accumulation in C. sativa, we identify two putative NIP-III family members that contain the GSGR aromatic/Arg (ar/R) selectivity filter reported in silicon channels. Subsequently, we use NanoSIMS to map the metalloid distribution in the bast fibres. Finally,

to demonstrate the already proven intimate association of biosilicification with plant cell development, we examine silica skeletons from other hemp tissues, notably leaves, which are organs characterized by heterogeneous cell populations (epidermal cells, stomata, trichomes). Fluorescence microscope observations indeed confirm the presence of fine silicified cellular structures which are linked to different developmental stages of leaf cells. 2. Materials and methods 2.1. Genome-wide identification of aquaporins Transcriptome assemblies of Purple Kush and Finola were retrieved from the Cannabis Genome Browser (http://genome.ccbr.utoronto.ca/ downloads.html). A local transcriptome database was developed using NCBI local BLAST implemented in the BioEdit software tool. A set of Table 2 Aquaporins in the Purple Kush (PK) and Finola (FN) genome assemblies and proposed final nomenclature.

2

Purple Kush AQPs

Finola AQPs

Proposed final nomenclature

Name

Transcript

Name

Transcript

Name

PKPIP1-1 PKPIP1-2 PKPIP1-3 PKPIP1-4 PKPIP2-1 PKPIP2-2 PKPIP2-3 PKPIP2-4

PK28701.1 PK19617.1 PK28206.1 PK28630.1 PK01882.1 PK18043.1 PK10459.1 PK02995.1

PKTIP1-1 PKTIP1-2

PK28735.1 PK08469.1

PKTIP2-2 PKTIP2-1 PKTIP4-1 PKNIP1-1 PKNIP1-2

PK11931.1 PK10655.1 PK19836.1 PK09307.1 PK06869.1

PKNIP2-1 PKNIP2-2 PKNIP3-1 PKNIP5-1 PKSIP1-1 PKSIP2-1 PKXIP1-1 PKTIP2-3 PKNIP3-2 PKNIP5-2 PKNIP5-3 PKXIP1-2

PK09456.1 PK05483.1 PK21844.1 PK29364.1 PK16813.1 PK29764.1 PK24453.1 PK23141.1 PK23987.1 PK11676.1 PK22011.1 PK28369.1

FNPIP1-1 FNPIP1-2 FNPIP1-3 FNPIP1-4 FNPIP2-1 FNPIP2-2 FNPIP2-3 FNPIP2-4 FNPIP2-5 FNTIP1-1 FNTIP1-2 FNTIP5-1 FNTIP2-2 FNTIP2-1 FNTIP4-1 FNNIP1-1 FNNIP1-2 FNNIP1-3 FNNIP2-1 FNNIP2-2 FNNIP3-1 FNNIP5-1 FNSIP1-1 FNSIP2-1 FNXIP1-1

FN09398.1 FN03298.1 FN30203.1 FN20092.1 FN00769.1 FN36356.1 FN28470.1 FN07100.1 FN10254.1 FN34985.1 FN17866.1 FN12886.1 FN03413.1 FN27560.1 FN11658.1 FN18987.1 FN33566.1 FN26914.1 FN14156.1 FN31611.1 FN02974.1 FN18289.1 FN36397.1 FN21234.1 FN35077.1

CsaPIP1-1 CsaPIP1-2 CsaPIP1-3 CsaPIP1-4 CsaPIP2-1 CsaPIP2-2 CsaPIP2-3 CsaPIP2-4 CsaPIP2-5 CsaTIP1-1 CsaTIP1-2 CsaTIP5-1 CsaTIP2-2 CsaTIP2-1 CsaTIP4-1 CsaNIP1-1 CsaNIP1-2 CsaNIP1-3 CsaNIP2-1 CsaNIP2-2 CsaNIP3-1 CsaNIP5-1 CsaSIP1-1 CsaSIP2-1 CsaXIP1-1 CsaTIP2-3 CsaNIP3-2 CsaNIP5-2 CsaNIP5-3 CsaXIP1-2

Plant Science 287 (2019) 110167

G. Guerriero, et al.

141 known aquaporins from soybean, Arabidopsis thaliana and rice were used as a query sequence to perform BLAST searches against the C. sativa transcriptome database. To claim a significant match, E-value cut-off < 0.00001 and bitscore > 100 were used. Non-redundant top hits were used for the rest of the analysis. Similarly, to look for hemp orthologs of OsLsi2, the rice gene was used as query sequence. Flax aquaporin orthologs were used to construct a phylogenetic tree. ClustalW was used for protein sequence alignment and the maximum likelihood method (MLM) for phylogenetic tree construction. The nomenclature of aquaporins identified in the C. sativa genome was assigned based on the phylogenetic tree and the homology with known aquaporins.

plants were 15 days old. Plant tissue sampling, RNA extraction, quality control/quantification and retrotranscription were performed as previously described [27]. The primers used for RT-qPCR are indicated in Table 1, while those used for reference gene amplifications have been previously described [27]. Tubulin and TIP41 were used as reference genes. A one-way ANOVA with a Tukey’s post-hoc test was performed with IBM SPSS Statistics v19, after converting the NRQs (Normalized Relative Quantities) to log2 values. 2.4. High resolution SIMS imaging Secondary Ion Mass Spectrometry (SIMS) imaging was performed on a CAMECA NanoSIMS50 instrument. A Cs+ primary ion beam of about 100 nm with an impact energy of 16 keV and a current of 1.5 pA was used for studying the distribution of 12C14N−, 28Si− and 31P− simultaneously in multicollection mode. The instrument was tuned for a mass resolution (Mass/ΔMass) of about 5000. Images of (40 × 40) μm2 were recorded in a pixel format of 256 × 256 image points and a counting time of 30 ms/pixel. Particular attention was paid to sample preparation in order to remove water from biological samples, whilst maintaining their morphological and physiochemical properties as close as possible to the in vivo state. The hemp samples were prepared by cryo fixation in liquid propane on a Leica EM CPC and freeze-dried with a Leica CFD System. Freeze-drying has the advantage that there is no interaction between cellular components and a liquid organic solvent. The latter may indeed cause dissolution or extraction of components, which would induce a change in the physicochemical properties of the sample [32]. After the freeze-drying step, samples were embedded in acrylic resin (Unicryl) at - 20 °C and polymerized under ultraviolet light. The embedded samples were adjusted crosswise by ultramicrotomy (Leica Ultracut UCT) and a thin gold layer (˜10 nm) (Baltec MED020) was deposited at their surface in order to avoid charging effects during measurements.

2.2. Protein tertiary structure and pore characterization The 3D homology models of both hemp aquaporins were generated with the I-TASSER Suite (http://zhanglab.ccmb.med.umich.edu/ITASSER/) [28] utilizing LOMETS, SPICKER, and TM-align. The models were constrained on A. thaliana aquaporin AtTIP2;1 (PDB 5i32), they were then refined using REMO by optimizing the backbone hydrogen-bonding networks and FG-MD by removing the steric clashes and improving the torsion angles. The quality of the models was checked by RAMPAGE [29]. The pore analysis was carried out with the ChExVis online tool (available at http://vgl.serc.iisc.ernet.in/chexvis/), using default values [30]. Tetramers of C. sativa NIP2-1 aquaporins were generated using GalaxyHomomer [31]. 2.3. Plant growth, RNA extraction and real-time PCR Plants of textile hemp (Santhica 27) were grown under controlled conditions (16 h light, 8 h dark) as previously reported [27]. For SIMS nano-analysis and silica extraction, hemp plantlets were grown for 6 days, then sodium metasilicate (Na2SiO3) 1 mM (pH 5.6) was added twice a week (controls were watered with 2 mM NaCl to provide the same concentration of sodium as the + silicon treatment), until the

Fig. 1. Maximum likelihood phylogenetic tree of C. sativa and flax aquaporins. Bootstraps = 1000 (circles indicate bootstraps > 0.7; the bigger the circle, the higher the bootstrap value). The Physcomitrella patens glycerol uptake facilitator (NCBI Reference Sequence: XP_024396316.1) was used as outgroup to root the tree. Different colours indicate different aquaporin families (SIPs red, XIPs lilac, NIPs dark blue, TIPs dark green, PIPs pink).

3

Plant Science 287 (2019) 110167

G. Guerriero, et al.

2.5. Extraction of silica skeletons from hemp leaves and PDMPO fluorescence microscopy

3. Results and discussion 3.1. Identification of aquaporins in the C. sativa genome

Hemp leaves were collected from plantlets that were 15 days old and dried until constant weight at 37 °C for 3 days. Sample processing for silica extraction and visualization with PDMPO at the fluorescence microscope were carried out as previously described [20].

We identified Cannabis aquaporins in different organs by mining previously published datasets [33,34]. A total of 27 aquaporin orthologs were identified in the C. sativa genome assembly of Purple Kush. The set of C. sativa aquaporins includes 9 NIPs, 8 PIPs, 6 TIPs, 2 SIPs,

Fig. 2. Characteristic features of the pore predicted using the homology-based protein tertiary structure of C. sativa NIP2-1 aquaporins and alignment with known silicon channels from rice, soybean and poplar. A) Transmembrane pore of PKNIP2-1 (PK09456.1) with heatmaps of flexibility and hydrophobicity; B) tetramer of PKNIP2-1; C) transmembrane pore of FNNIP2-1 (FN14156.1) with heatmaps of flexibility and hydrophobicity; D) tetramer of FNNIP2-1; E, F) pores through the protein ribbon structures; G) Protein sequence alignment showing conserved G-S-G-R Ar/R selectivity filter (denoted with green letters on the top of alignment) and NPA domain (denoted with black letters).

4

Plant Science 287 (2019) 110167

G. Guerriero, et al.

and 2 XIPs (Table 2; Supplementary Table S1). The genome assembly of an industrial variety, Finola, was also explored to identify aquaporins. A total of 25 aquaporins (without counting the duplicates; Supplementary Table S2), including 7 NIP, 9 PIP, 6 TIP, 2 SIP and 1 XIP, were identified (Table 2). All aquaporins from Finola show homologs in Purple Kush, except for FNPIP2-5, FNTIP5-1 and FNNIP1-3. The total non-redundant number of aquaporins identified in these two assemblies of C. sativa is therefore 30 (Table 2). The proposed nomenclature of Table 2 will be used hereafter to designate the corresponding genes/proteins. Since a recent publication analysed the aquaporins of another bast fibre-producing crop, i.e. flax (Linum usitatissimum L.) [11], a phylogenetic analysis of the C. sativa aquaporins and L. usitatissimum aquaporins was performed (Fig. 1). The combined phylogenetic tree shows high level of similarity among the aquaporin from these two bast fibreproducing plants. A characteristic clustering of aquaporins into five distinct subfamilies like NIP, PIP, TIP (tonoplast intrinsic protein), SIP (small intrinsic protein) and XIP (uncharacterized intrinsic protein) was observed. Based on the ar/R selectivity filters in aquaporins and phylogenetic position, a corresponding NIP2-1 gene ortholog to the rice silicon channel OsLsi1, which we named CsaNIP2-1 (Table 2), was identified in Purple Kush (PK09456.1) and Finola (FN14156.1) (Table 2). The CsaNIP2-1 protein has all the signature attributes like two conserved NPA motifs, G-S-G-R ar/R selectivity filters and 108 amino acid spacing between the NPA motifs reported to be associated with silicon permeability of NIP-IIIs. Three Cannabis genes corresponding to the rice efflux transporter OsLsi2 [35] were also retrieved, i.e. CsaLsi2-1 (PK18630.1/FN08935.1), CsaLsi2-2 (PK08860.1/FN07382.1) and CsaLsi2-3 (PK00413.1/ FN13891.1).

pore structure through the protein ribbon structures are shown in Fig. 2A–F. The minimum (bottleneck) radius determined by ChExVis ranges from 1.770-1.644 Å which are smaller than the estimated maximum radius of 4 Å for silicic acid (based on quantum calculations taking into account the electron density) [36]. FNNIP2-1 shows the largest radius (1.770 Å) for the transmembrane pore. Proteins are dynamic and “breathe” in vivo, as well exemplified by the dynamics of protein binding pockets [37]; therefore, the pore diameter may increase to accommodate silicic acid passage. A heat map of the pores based on average flexibility of residues shows indeed that in areas corresponding to the bottleneck, residues with higher flexibility (Fig. 2A and C, top half) and less hydrophobicity residues (Fig. 2A and C, bottom half) line the pores. For example, PKNIP2-1 has a minimum radius of 1.644 Å, but shows very high flexibility with concomitant low hydrophobicity (Fig. 2A). Based on these in silico studies, we cannot conclude that the modelled channels mediate silicon passage without functional proof. CsaNIP2-1 (protein) has the typical GSGR ar/R selectivity filter found in all plant aquaporins that have been suggested/shown to be permeable to silicic acid. In addition, a 108 amino acids spacing between NPA domains was also observed (Fig. 2G), which was shown to be a feature shared by all the aquaporins currently reported to be permeable to silicon [18]. 3.3. Gene expression dynamics of C. sativa aquaporins As a first step towards the determination of the aquaporin expression in different C. sativa tissues, publicly available transcriptomic datasets were mined [33,34]. The heatmap hierarchical clustering of the C. sativa aquaporin genes shows heterogeneous expression patterns in the different tissues analyzed (Fig. 3). The CsaNIP2-2 and CsaTIP1-2 show a preferential expression in roots, others, like CsaXIP1-2 are almost exclusively expressed in the aerial organs. The cluster of genes composed of CsaSIP1-1, CsaPIP2-4, CsaPIP1-3, CsaPIP1-2, CsaTIP1-1 is expressed constitutively in all the tissues considered. CsaNIP2-1, the aquaporin putatively involved in silicon channeling, has slightly higher expression in aerial organs, namely the flowers and the shoot. We also looked for the expression pattern of the hemp Lsi2 ortholog, since this belongs to a cooperative system of uptake in rice [16]. The three Lsi2 genes cluster in different branches; among them, CsaLsi2-2 is

3.2. Protein tertiary structure of C. sativa NIP2-1 aquaporins Homology-based tertiary structures developed for FN14156.1 (Cscore -0.15 and TM-score 0.12 ± 0.69) and PK09456.1 (C-score value is -2.46 and the TM-score 0.43 ± 0.14) were used to analyze pore morphology (indicated respectively FNNIP2-1 and PKNIP2-1). Transmembrane pore analyses, tetramers of both C. sativa NIP2-1 and

Fig. 3. Heatmap and hierarchical clustering of the expression values relative to the C. sativa (Purple Kush) aquaporins and Lsi2 orthologs. The clustering was performed with Pearson distance metrics in complete linkage. The hierarchical clustering was generated with Cluster 3.0 and visualized with Java TreeView (after log2 transformation of the values), as reported in Material and Methods. The expression values are taken from [34].

5

Plant Science 287 (2019) 110167

G. Guerriero, et al.

Fig. 4. Gene expression profiles of some aquaporins in hemp hypocotyls and internodes. A) Expression values (RPKM) of an aquaporin gene subset obtained from the previously published RNA-Seq data on the developing hemp hypocotyl [27]. Error bars are relative to the standard deviations of 3 independent biological replicates (n = 3). Details of the RPKM for each single biological replicate, statistical values, means are provided in Supplementary File 1. B) Expression values (RPKM) of an aquaporin gene subset obtained from the previously published RNA-Seq data on the isolated hemp bast fibres sampled along different stem regions [5]. Error bars are relative to the standard deviations of 4 independent biological replicates (n = 4). Details of the RPKM for each single biological replicate, statistical values, means are provided in Supplementary File 1.

expressed at extremely low levels in the roots. We have previously published two sets of RNA-Seq data on the hypocotyl and on isolated bast fibres collected from adult plants of the industrial fibre variety Santhica 27 [5,27]. In these studies we aimed at analyzing the development of the hemp hypocotyl’s tissues from a cell wall perspective and the processes underlying bast fibre elongation and thickening. Both datasets were analyzed using the Finola genome annotation, since it is another industrial variety used for oil. We looked specifically for aquaporin genes expressed at statistically significant varying levels (FDR corrected ANOVA p-values < 0.05) in the conditions studied. Representatives of the NIP, PIP, TIP and XIP subfamilies were retrieved from our two published datasets (Fig. 4). In the hypocotyl, the aquaporins expressed at the highest levels in young developmental stages (6 and 9 days after sowing, i.e. H6 and H9) are CsaPIP1-3 and CsaTIP2-2; their expression subsequently decreases

at older phases of development (15 and 20 days after sowing, i.e. H15 and H20) (Fig. 4A). In particular, CsaTIP2-2 shows an increased expression at H9, a phase characterized by rapid growth and therefore represents an interesting candidate potentially partaking in hypocotyl elongation, in a manner analogous to what was discussed for the TIP1-1 gene of castorbean [38]. The PIP gene CsaPIP1-4 shows an increase as the hypocotyl ages, attaining the highest level at H20. Since at H15 and H20 the hypocotyl develops bast fibres with thick cellulosic cell walls and since PIPs are known to regulate fibre differentiation in cotton [10], it will be interesting to investigate the role of CsaPIP1-4 in secondary cell wall biosynthesis in hemp bast fibres. Studies involving cellulose biosynthesis inhibitors could be performed to analyze how perturbations in cellulose deposition affect CsaPIP1-4 expression. CsaNIP2-1 is expressed at low levels and shows a peak in expression at H15. CsaNIP5-1 is also expressed at low levels: its expression is

Fig. 5. Normalized relative expressions of a subset of aquaporins in different hemp tissues. Error bars are relative to the standard deviations of 4 independent biological replicates (n = 4). Different letters indicate statistically significant values at the one-way ANOVA test (p < 0.05) after a Tukey’s post-hoc test. 6

Plant Science 287 (2019) 110167

G. Guerriero, et al.

Fig. 6. A) Optical image showing the locations of the SIMS nano-analysis (white circles) in the xylem and the bast fibres. The scale bar is 200 μm; B) and C) NanoSIMS images of hemp hypocotyl. Distribution of 12C14N− (upper row), 28 Si- (middle row) and 31P− (bottom row) in the xylem fibres (B) and in the bast fibres (C) of untreated sample (Control) and silicon-treated sample (1 mM sodium metasilicate). The colour scale goes from black to red with increasing intensity. The scale bars in panels (B) and (C) are 10 μm.

substantially stable at H6, H9 and H15 and decreases at H20. From the RNA-Seq data of isolated hemp bast fibres, gene expression data for the NIP, PIP, TIP and XIP members were retrieved (Fig. 4B). CsaPIP1-1, CsaXIP1-1 and CsaTIP2-2 show an increased expression along the stem: the bast fibres collected at the internode containing the snap point and at the bottom show indeed a higher expression of the genes, as compared to the fibres sampled at the top. Among the genes displaying low expression, CsaTIP4-1 and CsaNIP3-2 are more expressed at the top and gradually decrease at the bottom. CsaNIP1-2 increases in expression at the snap point and bottom. CsaTIP1-2 and CsaXIP1-1 are the only genes in our dataset showing higher expression at the snap point. We decided to perform a gene expression analysis on different tissues of adult hemp plants and targeting a subset of aquaporins, notably the three putative rice Lsi2 orthologs and genes showing a low expression in our RNA-Seq datasets (i.e. CsaNIP3-2, CsaNIP1-2 and CsaNIP5-1). The rationale was to determine whether these low expressed genes showed higher expressions in tissues/organs other than the hypocotyl or the isolated bast fibres. The genes CsaLsi2-1 and CsaLsi2-2 show higher expressions in the isolated hemp fibres than the core tissues (Fig. 5); CsaLsi2-3 shows comparable levels of expression in the core and the bast fibres, with the exception of the bast fibres sampled at the bottom, where the expression increases. The higher expression of Lsi2 genes in the fibres may imply an accumulation of silicon (as opaline silica) in the apoplast of phloem fibres (as shown in the next section), a feature that has important consequences for their physical properties. The accumulation of silica in the walls of fibres could for example affect the mechanical properties, e.g. the density of cellulose microfibrils, similarly to what demonstrated in rice cells [22]. It should be noted that Lsi2-1 and Lsi2-2 are expressed at equal levels in female and male flowers; CsaLsi2-3 shows higher expression in male flowers as compared to female ones. The gene CsaNIP3-2 is expressed at higher levels in the leaves than roots. CsaNIP1-2 is expressed at higher levels in the bast fibres at the snap point and at the bottom (confirming the RNA-Seq data, Fig. 4B) and shows the same expression values in the other organs. Finally, CsaNIP5-1 is expressed at the highest levels in roots. 3.4. High resolution SIMS imaging on stems and silica extraction from leaves The SIMS nano-analysis reveals the presence of silicon in the hypocotyls of hemp (Fig. 6). In the xylem vessels, an evident enrichment in silicon is visible when the plants were supplemented with 1 mM sodium metasilicate (Fig. 6B). In the bast fibres and in the presence of sodium metasilicate, the presence of silicon is more evident in the distal side of the cell walls (i.e. facing the stem cortex) (Fig. 6C). The signal is continuous on the distal side and covers the whole cell wall depth (Supplementary Fig. S1). This preferential accumulation can be interpreted by invoking a purely mechanical principle: the impregnation of the distal cell walls of bast fibres with silica results in the formation of a ring strengthening the whole stem. It is known that plants grown in the presence of silicon are more vigorous, but above all more resistant to mechanical stresses, like lodging [39]. PDMPO staining of the silica extracted from the hemp plantlets did not reveal any silicified structures in bast fibres (not shown). This could be due to the silica extraction procedure, which employs a step of 7

Plant Science 287 (2019) 110167

G. Guerriero, et al.

Fig. 7. Biogenic silica deposition in hemp leaves after acid extraction and fluorescence imaging with PDMPO. A) Isolated trichomes, some of which with basal cells; B) Isolated trichomes and two adjacent trichomes with basal and epidermal cells; C) Trichomes with epidermal cells showing replicas of waxy “wrinkles” (boxed region and bottom magnified image thereof); D) Compound trichome base (arrow) interspersed with single-celled trichome bases; E) Reticulated structure possibly representing a developmental stage of trichomes with compound bases; F) strongly labeled structures inside epidermal cells possibly representing vacuoles/large vesicles. The scale bars in panels A–C are 200 μm, in D–E 100 μm and in F 50 μm.

for the first time evidence for the presence of genes with homology to the rice OsLsi1 and OsLsi2. Modelling of the pores suggests that the diameter of these aquaporins is too small for the computed maximum radius of silicic acid, despite the presence of more flexible amino acids at the pore bottlenecks. By using NanoSIMS and fluorescence microscopy coupled to PDMPO staining, we show that silicon is found in hemp tissues. Overall, our study shows not only that silicon is present in hemp tissues, but also that it accumulates preferentially on the distal side of the bast fibre cell walls. The results provided have relevance in terms of application-oriented follow up studies, since silica is known to be fireretardant and to increase the durability of the biomaterial (i.e. resistance to natural decay).

filtration through 0.2 μm filters prior to collecting the silica particles. Any bast fibre-derived silica smaller than 200 nm may thus have been lost. The multitude of shapes observed in silica extracted from silicifiers like rice and horsetail [20,40] indicates an intimate association of silicification with cellular processes. Such a versatility can be easily shown if an organ comprising different cell types is analyzed. Leaves are excellent organs to study the different types of silicified cells, since it comprises epidermal jigsaw puzzle-like cells, trichomes, stomata. Since PDMPO was shown to be very useful in mapping the fine silicified structures of rice and horsetail leaves [20,25,40], we decided to extract and analyze the silica obtained from hemp leaves. PDMPO labeling and fluorescence microscopy reveals fine cellular details, such as non-secreting trichomes and associated basal cells (Fig. 7). It is possible to observe detailed cellular features, notably the ring of basal cells contouring the base of the hollow non-secretory trichome shaft (Figs. 7A and B), “wrinkles” from the waxy replicas of leaf epidermal cells (Fig. 7C), a compound trichome base interspersed with single-celled trichome bases (Fig. 7D). Reticulated structures (maybe representing a developmental stage of trichomes with compound bases) associated with the trichomes are also present (Fig. 7E); strongly labeled structures are observed inside the epidermal cells which may represent vacuoles/ large vesicles (Fig. 7F). The presence of silicified trichomes was previously reported in Cannabis [19]; here we provide evidence that the finest details of the cells composing the base of the trichome are perfectly replicated in the silica residues extracted. This feature was also observed in thale cress [41]. Silica residues extracted from rice, horsetail and fern [26] also show fine cell details, with stomata providing an emblematic example [20,25]. The silicification of the trichome base is a clear demonstration of the mechanical role played by silica, which in this case provides the required mechanical requisites to support the trichome shaft.

Author contributions GG, RD, J-FH, NV, KSS and CE conceived the experimental work; GG, RD, HS, EL, NV, KSS and CE carried out the experiments; GG, RD, HS, EL, NV, KSS and CE collected, analyzed and interpreted the data. GG, RD, NV and KSS wrote the initial draft. All authors contributed to editing and to the finalization of the manuscript. Funding GG, KS and J-FH thank The Fonds National de la Recherche, Luxembourg, (Project CANCAN C13/SR/5774202) for financial support. Acknowledgements The personal assistance of KSS by KFUPM is acknowledged. Laurent Solinhac and Aude Corvisy are thanked for their technical assistance.

4. Conclusions

Appendix A. Supplementary data

We have here identified 30 aquaporins of the important multipurpose plant C. sativa. We have analyzed the expression of some aquaporins in different tissues of a textile hemp variety and provided

Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.plantsci.2019.110167. 8

Plant Science 287 (2019) 110167

G. Guerriero, et al.

References

[20] G. Guerriero, C. Law, I. Stokes, K.L. Moore, C. Exley, Rough and tough. How does silicic acid protect horsetail from fungal infection? J. Trace Elem. Med. Biol. Organ Soc. Miner. Trace Elem. GMS 47 (2018) 45–52, https://doi.org/10.1016/j.jtemb. 2018.01.015. [21] S.C. Fry, B.H.W.A. Nesselrode, J.G. Miller, B.R. Mewburn, Mixed-linkage (1 > 3,1 > 4)-beta-D-glucan is a major hemicellulose of Equisetum (horsetail) cell walls, New Phytol. 179 (2008) 104–115, https://doi.org/10.1111/j.1469-8137. 2008.02435.x. [22] C. He, J. Ma, L. Wang, A hemicellulose-bound form of silicon with potential to improve the mechanical properties and regeneration of the cell wall of rice, New Phytol. 206 (2015) 1051–1062, https://doi.org/10.1111/nph.13282. [23] O. Leroux, F. Leroux, A.A. Mastroberti, F. Santos-Silva, D. Van Loo, A. BagniewskaZadworna, L. Van Hoorebeke, S. Bals, Z.A. Popper, J.E. de Araujo Mariath, Heterogeneity of silica and glycan-epitope distribution in epidermal idioblast cell walls in Adiantum raddianum laminae, Planta 237 (2013) 1453–1464, https://doi. org/10.1007/s00425-013-1856-6. [24] C.C. Perry, Y. Lu, Preparation of silicas from silicon complexes: role of cellulose in polymerisation and aggregation control, J. Chem. Soc. Faraday Trans. 88 (1992) 2915–2921, https://doi.org/10.1039/FT9928802915. [25] C. Law, C. Exley, New insight into silica deposition in horsetail (Equisetum arvense), BMC Plant Biol. 11 (2011) 112, https://doi.org/10.1186/1471-2229-11-112. [26] C. Exley, A possible mechanism of biological silicification in plants, Front. Plant Sci. 6 (2015), https://doi.org/10.3389/fpls.2015.00853. [27] M. Behr, S. Legay, E. Žižková, V. Motyka, P.I. Dobrev, J.-F. Hausman, S. Lutts, G. Guerriero, Studying secondary growth and bast fiber development: the hemp hypocotyl peeks behind the wall, Front. Plant Sci. 7 (2016) 1733. [28] J. Yang, R. Yan, A. Roy, D. Xu, J. Poisson, Y. Zhang, The I-TASSER suite: protein structure and function prediction, Nat. Methods 12 (2015) 7–8, https://doi.org/10. 1038/nmeth.3213. [29] S.C. Lovell, I.W. Davis, W.B. Arendall, P.I.W. de Bakker, J.M. Word, M.G. Prisant, J.S. Richardson, D.C. Richardson, Structure validation by Calpha geometry: phi, psi and Cbeta deviation, Proteins 50 (2003) 437–450, https://doi.org/10.1002/prot. 10286. [30] T.B. Masood, S. Sandhya, N. Chandra, V. Natarajan, CHEXVIS: a tool for molecular channel extraction and visualization, BMC Bioinformatics 16 (2015) 119, https:// doi.org/10.1186/s12859-015-0545-9. [31] M. Baek, T. Park, L. Heo, C. Park, C. Seok, GalaxyHomomer: a web server for protein homo-oligomer structure prediction from a monomer sequence or structure, Nucleic Acids Res. 45 (2017) W320–W324, https://doi.org/10.1093/nar/gkx246. [32] L. Edelmann, Freeze-dried and resin-embedded biological material is well suited for ultrastructure research, J. Microsc. 207 (2002) 5–26. [33] H. van Bakel, J.M. Stout, A.G. Cote, C.M. Tallon, A.G. Sharpe, T.R. Hughes, J.E. Page, The draft genome and transcriptome of Cannabis sativa, Genome Biol. 12 (2011) R102, https://doi.org/10.1186/gb-2011-12-10-r102. [34] L. Massimino, In silico gene expression profiling in Cannabis sativa, F1000Research 6 (2017), https://doi.org/10.12688/f1000research.10631.1. [35] J.F. Ma, N. Yamaji, N. Mitani, K. Tamai, S. Konishi, T. Fujiwara, M. Katsuhara, M. Yano, An efflux transporter of silicon in rice, Nature 448 (2007) 209–212, https://doi.org/10.1038/nature05964. [36] C. Exley, G. Guerriero, X. Lopez, Silicic acid: the omniscient molecule, Sci. Total Environ. 665 (2019) 432–437, https://doi.org/10.1016/j.scitotenv.2019.02.197. [37] A. Stank, D.B. Kokh, J.C. Fuller, R.C. Wade, Protein binding pocket dynamics, Acc. Chem. Res. 49 (2016) 809–815, https://doi.org/10.1021/acs.accounts.5b00516. [38] D.A. Eisenbarth, A.R. Weig, Dynamics of aquaporins and water relations during hypocotyl elongation in Ricinus communis L. seedlings, J. Exp. Bot. 56 (2005) 1831–1842, https://doi.org/10.1093/jxb/eri173. [39] D. Dorairaj, M.R. Ismail, U.R. Sinniah, T.K. Ban, Influence of silicon on growth, yield, and lodging resistance of MR219, a lowland rice of Malaysia, J. Plant Nutr. 40 (2017) 1111–1124, https://doi.org/10.1080/01904167.2016.1264420. [40] G. Guerriero, I. Stokes, C. Exley, Is callose required for silicification in plants? Biol. Lett. 14 (2018), https://doi.org/10.1098/rsbl.2018.0338. [41] T. Brugiére, C. Exley, Callose-associated silica deposition in Arabidopsis, J. Trace Elem. Med. Biol. Organ Soc. Miner. Trace Elem. GMS 39 (2017) 86–90, https://doi. org/10.1016/j.jtemb.2016.08.005.

[1] C.M. Andre, J.-F. Hausman, G. Guerriero, Cannabis sativa: the plant of the thousand and one molecules, Front. Plant Sci. 7 (2016) 19, https://doi.org/10.3389/fpls. 2016.00019. [2] G. Guerriero, K. Sergeant, J.-F. Hausman, Integrated -Omics: a powerful approach to understanding the heterogeneous lignification of fibre crops, Int. J. Mol. Sci. 14 (2013) 10958–10978, https://doi.org/10.3390/ijms140610958. [3] T. Gorshkova, N. Brutch, B. Chabbert, M. Deyholos, T. Hayashi, S. Lev-Yadun, E.J. Mellerowicz, C. Morvan, G. Neutelings, G. Pilate, Plant fiber formation: state of the art, recent and expected progress, and open questions, Crit. Rev. Plant Sci. 31 (2012) 201–228, https://doi.org/10.1080/07352689.2011.616096. [4] O. Gorshkov, N. Mokshina, V. Gorshkov, S. Chemikosova, Y. Gogolev, T. Gorshkova, Transcriptome portrait of cellulose-enriched flax fibres at advanced stage of specialization, Plant Mol. Biol. (2016) 1–19, https://doi.org/10.1007/s11103-0160571-7. [5] G. Guerriero, M. Behr, S. Legay, L. Mangeot-Peter, S. Zorzan, M. Ghoniem, J.F. Hausman, Transcriptomic profiling of hemp bast fibres at different developmental stages, Sci. Rep. 7 (2017) 4961, https://doi.org/10.1038/s41598-01705200-8. [6] M.V. Ageeva, B. Petrovská, H. Kieft, V.V. Sal’nikov, A.V. Snegireva, J.E.G. van Dam, W.L.H. van Veenendaal, A.M.C. Emons, T.A. Gorshkova, A.A.M. van Lammeren, Intrusive growth of flax phloem fibers is of intercalary type, Planta 222 (2005) 565–574, https://doi.org/10.1007/s00425-005-1536-2. [7] G. Guerriero, J.-F. Hausman, G. Cai, No stress! relax! mechanisms governing growth and shape in plant cells, Int. J. Mol. Sci. 15 (2014) 5094–5114, https://doi.org/10. 3390/ijms15035094. [8] A.V. Snegireva, M.V. Ageeva, S.I. Amenitskii, T.E. Chernova, M. Ebskamp, T.A. Gorshkova, Intrusive growth of sclerenchyma fibers, Russ. J. Plant Physiol. 57 (2010) 342–355, https://doi.org/10.1134/S1021443710030052. [9] F. Chaumont, S.D. Tyerman, Aquaporins: highly regulated channels controlling plant water relations1, Plant Physiol. 164 (2014) 1600–1618, https://doi.org/10. 1104/pp.113.233791. [10] D.-D. Li, X.-M. Ruan, J. Zhang, Y.-J. Wu, X.-L. Wang, X.-B. Li, Cotton plasma membrane intrinsic protein 2s (PIP2s) selectively interact to regulate their water channel activities and are required for fibre development, New Phytol. 199 (2013) 695–707, https://doi.org/10.1111/nph.12309. [11] S.M. Shivaraj, R.K. Deshmukh, R. Rai, R. Bélanger, P.K. Agrawal, P.K. Dash, Genome-wide identification, characterization, and expression profile of aquaporin gene family in flax (Linum usitatissimum), Sci. Rep. 7 (2017) 46137, https://doi.org/ 10.1038/srep46137. [12] T.A. Gorshkova, V.V. Sal’nikov, S.B. Chemikosova, M.V. Ageeva, N.V. Pavlencheva, J.E.G. van Dam, The snap point: a transition point in Linum usitatissimum bast fiber development, Ind. Crops Prod. 18 (2003) 213–221, https://doi.org/10.1016/ S0926-6690(03)00043-8. [13] J.F. Ma, K. Tamai, N. Yamaji, N. Mitani, S. Konishi, M. Katsuhara, M. Ishiguro, Y. Murata, M. Yano, A silicon transporter in rice, Nature 440 (2006) 688–691, https://doi.org/10.1038/nature04590. [14] G. Heine, G. Tikum, W.J. Horst, Silicon nutrition of tomato and bitter gourd with special emphasis on silicon distribution in root fractions, J. Plant Nutr. Soil Sci. 168 (2005) 600–606, https://doi.org/10.1002/jpln.200420508. [15] W. Zellner, J. Frantz, S. Leisner, Silicon delays tobacco ringspot virus systemic symptoms in Nicotiana tabacum, J. Plant Physiol. 168 (2011) 1866–1869, https:// doi.org/10.1016/j.jplph.2011.04.002. [16] J.F. Ma, N. Yamaji, A cooperative system of silicon transport in plants, Trends Plant Sci. 20 (2015) 435–442, https://doi.org/10.1016/j.tplants.2015.04.007. [17] N. Yamaji, N. Mitatni, J.F. Ma, A transporter regulating silicon distribution in rice shoots, Plant Cell 20 (2008) 1381–1389, https://doi.org/10.1105/tpc.108.059311. [18] R.K. Deshmukh, J. Vivancos, G. Ramakrishnan, V. Guérin, G. Carpentier, H. Sonah, C. Labbé, P. Isenring, F.J. Belzile, R.R. Bélanger, A precise spacing between the NPA domains of aquaporins is essential for silicon permeability in plants, Plant J. 83 (2015) 489–500, https://doi.org/10.1111/tpj.12904. [19] P. Dayanandan, P.B. Kaufman, Trichomes of Cannabis sativa L. (Cannabaceae), Am. J. Bot. 63 (1976) 578–591, https://doi.org/10.2307/2441821.

9