- Email: [email protected]
Identification of the auto-inhibitory domains of Aurora-A kinase
Biochemical and Biophysical Research Communications 357 (2007) 347–352 www.elsevier.com/locate/ybbrc
Identification of the auto-inhibitory domains of Aurora-A kinase Yue Zhang a
a,b,1
, Jun Ni
a,1
, Qiang Huang a, Weihua Ren a, Long Yu
a,*
, Shouyuan Zhao
a
State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, Shanghai 200433, China b Cardiology Branch, NHLBI, National Institutes of Health, Bethesda, MD 20892, USA Received 6 March 2007 Available online 30 March 2007
Abstract Aurora-A is a centrosome-localized serine/threonine kinase that is overexpressed in multiple human cancers. Here, we report an intramolecular inhibitory regulation in Aurora-A between its N-terminal regulatory domain (aa 1–128, Nt) and the C-terminal catalytic domain (aa 129–403, Cd). Removal of Nt results in a significant increase in kinase activity. Nt inhibited the activity of the single C-terminal kinase domain, but had little effect on the activity of the full-length of Aurora-A. PP1 is not involved in this regulation, instead, Nt interacts Cd directly in vitro and in vivo. The non-Aurora box (aa 64–128) in the N-terminal negatively regulated the kinase activity of the C-terminal kinase domain by intramolecular interaction with aa 240–300 within the C-terminal. 2007 Elsevier Inc. All rights reserved. Keywords: Aurora-A; Autoinhibitory regulation; Protein interaction; Protein kinase
Aurora kinases family has taken central stage in regulation of mitosis and meiosis in eukaryotes. These serine/ threonine kinases comprise three members: Aurora A, B, and C in mammals, each of them exhibits diverse subcellular location during cell cycle, reflecting the discrete role of each kinase during mitosis. Aurora-A gene was mapped to human chromosome 20q13.2–13.3, the region commonly undergoes frequent amplification in human cancers. The expression and the activity of Aurora-A kinase is regulated in a cell cycledependent manner: the level is low in G1/S, up-regulated during G2/M, and reduced rapidly after miotosis [1,2]. Aurora-A mutations interfere with recruitment of c-tubulin ring complexes and other proteins during centrosome maturation, formation of a bipolar spindle and chromosome segregation [3–6]. Aurora-A also plays an important role in programmed cell death and chemoresistance [7]. Aurora-A kinase has a C-terminal catalytic domain that is highly conserved within Aurora kinase family. The phosphorylation of Thr288 residue within the activation loop *
1
Corresponding author. Fax: +86 21 656432 50. E-mail address: [email protected] (L. Yu). These authors contributed equally to this work.
0006-291X/$ - see front matter 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2007.03.129
(aa 274–300) in the C-terminal is required for the kinase activity [8–10]. The N-terminal of Aurora-A contains two distantly conserved motifs: the first motif spans 5–40 amino acids (Aurora box1) and the second motif spans 21 amino acids (aa 43–63, Aurora box2), these two boxes are commonly called Aurora box [11,12]. These functional motifs are important for the regulation of the kinase activity by interacting with other proteins. Ajuba, a protein involved in cell adhesion and cell–cell contacts, interact the N-terminal of Aurora-A, induces the autophosphorylation and consequent activation of Aurora-A [13–15]. A transactivity defective p53 binds the N-terminal of Aurora-A, and suppresses Aurora-A-induced centrosome amplification and cellular transformation [16,17]. However, both TPX2 and PP1 interact with the C-terminal of Aurora-A. TPX2 antagonizes the negative regulation of PP1, then activates and localizes Aurora-A to MTs [18–20]. The non-catalytic domains of many protein kinases have an important function in vivo to regulate the kinase activity by preventing aberrant autophosphorylation and subsequent activation of the kinase in the absence of a specific activation signal. In this study, we analyzed the role of the N-terminal non-catalytic domain in the regulation of Aurora-A kinase activity. Our results showed that the
348
Y. Zhang et al. / Biochemical and Biophysical Research Communications 357 (2007) 347–352
truncated N-terminal Aur-A kinase has higher kinase activity than that of the full-length Aur-A. The non-Aurora box (aa 64–128), but not Aurora box (aa 1–64), negatively regulated the kinase activity of the C-terminal kinase domain by intramolecular interaction. The region in the Cterminal for the interaction locates in aa 240–300, which comprises the activation loop of aa 274–300.
inhibitors. Immunoprecipitates were washed four times with kinase lysis buffer and twice with kinase assay buffer (10 mM Hepes (pH 7.4), 50 mM NaCl, 5 mM MgCl2, 50 mM NaF, and 0.1 mM Na3VO4). The immunoprecipitates were suspended in kinase assay buffer containing 10 lCi [c-32P]ATP (Amersham), 0.5 mM ATP and 1 lg MBP for 30 min at 30 C. After reaction, an equal volume of 2· Laemmli sampling buffer was added, and then the mixture was boiled for 10 min. This sample was subjected to 12% SDS–PAGE. The gel was dried on a 3 mm filter and used for autoradiography.
Materials and methods Results Plasmid construction and site-directed mutagenesis. Aurora-A was constructed in pCMV-Myc/HA (Clontech). The sequence of the N-terminal domain (amino acids 1–128, Nt) and C-terminal domain (amino acids 129–403, Cd) were given artificial restriction sites using PCR from the cDNA of the full-length Aurora-A. To produce His fusion Nt and Cd proteins, each cDNA was inserted into pET-28a (Novagen), myc/HA fusions were constructed into pCMV-myc/HA. GST-Nt was constructed by fusing Nt in-frame with GST in pGEX-4T-2 (Amersham Pharmacia Biotech). All mutants of Aurora-A, Nt and Cd were constructed by mutagenesis using the Quick Change Site-Directed Mutagenesis Kit according to the manufacture’s protocol (Stratagen). Oligo nucleotides used for mutagenesis were listed in Table 1. All the constructs were confirmed by DNA sequencing. Immunoprecipitation and immunoblotting. Each expression plasmid was transfected in 293T cells, and proteins were extracted with IP buffer (10% Triton X-100, 1 mM b-glycerophosphate, 15 mM MgCl2, 1 mM EGTA, 1 mM EDTA, 150 mM NaCl, 1 mM NaVO4, 1 mM phenylmethylsulfonyl fluoride, 1 lg/ml leupeptin, 2.5 mM sodium pyrophosphate, and 20 mM Tris–HCl, pH 7.5), containing protease inhibitors. Cell lysates were precleared with 25 ll of resuspended protein-A/G PLUS-agarose, gently mixed for 1 h and centrifuged at 4000 rpm for 5 min. The supernatants were immunoprecipitated with either 20 ll of anti-HA monoclonal antibodyprotein G agarose or anti-myc antibody-protein G agarose (Clontech) rocked for 5 h. Following centrifugation, the pellets were washed five times in IP buffer, resuspended in 2· SDS sample buffer and boiled for 5 min. GST pull down. 293T cells expressing myc-Cd and its derivatives were harvested in TNT buffer (20 mM Tris–HCl, pH 7.6, 200 mM NaCl, and 1% Triton X-100). The protein lysate after centrifugation were mixed with 40 ll glutathione–Sepharose 4B beads (Amersham Biosciences, Inc.), and GST-fused protein was allowed to absorb to the beads for 1 h at 4 C. The GST proteins-beads were mixed with 100 ll of cell lysate, which were precleared with 20 lg GST protein. The suspension was incubated with gentle rocking for 2 h at 4 C. After collection by centrifugation, the beads were washed five times with TNT buffer. Bound proteins were extracted with SDS–PAGE sample buffer by boiling and were then subjected to SDS–PAGE and immunoblotted as described above. GST and GSTpeptides were confirmed by Ponceau protein stain. In vitro kinase assay. For the kinase assay, cells were lysed in kinase lysis buffer (10 mM Tris–HCl, 1% Triton X-100, 5 mM EDTA, 50 mM NaCl, 50 mM NaF, and 1 mM Na3VO4) supplemented with protease
The C-terminal kinase domain of the Aurora-A is negatively regulated by the N-terminal regulatory domain We performed kinase assay in vitro using Aurora-A and its mutants expressed and purified from 293T cells. As shown in Fig. 1A and B, the Cd exhibited about threefold increase in basal kinase activity toward the substrate MBP compared to that of full-length Aur-A. Nt and pCMV-vector did not show any kinase activity, indicating that the N-terminal domain has inhibitory effect on C-terminal catalytic activity. When 293T cells were co-transfected with myc-Nt with HA-Cd or with HA-Aur-A, the Nt inhibits the Cd kinase activity to MBP, but has a little effect on that of the full-length Aurora-A. PP1 can inhibit Aurora-A kinase activity by directly binding. We expressed and purified His-tagged Nt and Cd protein from Escherichia coli. After incubation of His-Cd with increasing amount of His-Nt, the kinase activity was decreased in a dose-dependent manner (Fig. 1C). PP1 does not exist in E. coli, therefore, we concluded that the negative regulation of the N-terminal to the C-terminal is specific and not involved in PP1. The N-terminal domain of Aurora-A can bind to its kinase domain in vivo and in vitro The preceding data clearly suggests an autoinhibitory role for the N-terminal domain in the C-terminal kinase domain catalytic activity, and the simplest model for such a regulation would be a direct interaction between them. We examined whether the Nt and Cd bind each other. 293T cells were transfected with myc-tagged Cd and HA-tagged Nt, while lysates were immunoprecipi-
Table 1 Forward versions of mutagenic primers of this study Oligonucleotides
Sequence (5 0 –3 0 )a
Aur box1(1–42 aa)-F Aur box(1–63 aa)-F CdC1(129–362)-F CdC2(129–300)-F CdC3(129–270)-F CdC4(129–240)-F Aur-A-T288A
CCTGTAAATAGTGGCTAGGCTCAGCGGG GCAAGCACAAAAGTAGGTCTCCAGTC GGACCTCATTTCCATAGCTGTTGAAGC CCTGCCCCCTAGATAGATTGAAGGTCGG CAGCTGGAGAGTAGAAAATTGCGA CAGAATTGGCATAGGCCCTGTCTTACTG CCAGGAGGACCGCCCTCTGTGGC
a
Altered nucleotides, which introduced the desired mutations, are underlined.
Y. Zhang et al. / Biochemical and Biophysical Research Communications 357 (2007) 347–352
349
Fig. 2. Nt interacts with Cd in vivo and in in vitro. (A) 293T cells were transfected to transiently express, either the HA-Nt (lane 1), the myc-Cd (lane 3) or a mixture of both (lane 2) was immunoprecipitated (IP) with either anti-HA agarose (lanes 4–6) or anti-myc agarose (lanes 7–9), and the precipitates were subjected to immunoblot analysis with either antiHA or anti-myc antibodies. (B) GST-pull down experiments confirm the interaction between the Nt and the Cd. Upper, cell extracts from 293T transfected with a vector expressing myc-tagged Cd were incubated with GST or the GST-Nt-coupled Sepharose beads. Bound proteins were analyzed by western blotting using an anti-myc antibody. Bottom, bacterial expression of GST or GST-Nt fusion proteins stained by Ponceau-S Red (PS Stain).
Fig. 1. Nt has a negative effect on the kinase activity of Cd in a dosedependent manner. (A) 293T cells were transfected with expression plasmids for vector, HA-Nt, myc-Cd, and myc-Aur-A alone, or cotransfected HA-Nt with myc-Cd or myc-Aur-A. The cell lysates were immunoprecipitated (IP) with anti-HA and/or anti-myc antibody. Aliquots of the immunoprecipitates were analyzed by immunoblotted with anti-HA or anti-myc antibodies, respectively. Aliqouts of immunoprecipitates were subjected to in vitro kinase assays with MBP and [c-32P]ATP as substrates, the peptides were separated by SDS–12% PAGE followed by autoradiography (bottom). (B) The activities of the proteins were assessed by measuring MBP phosphorylation as described in A (bottom). Representative autoradiograms are shown. Relative kinase activities of MBP were determined by scanning each band with a densitometer. (C) His-Cd and His-Nt were purified from E. coli. Constant amount of His-Cd incubated with different amount of His-Nt with MBP and [c-32P]ATP as substrates, His-Nt was as a control.
tated with myc-antibody or HA antibody and then subjected to immuno blotting analysis with anti-HA or antimyc in order to reveal any co-precipitation. myc-Cd can co-immunoprecipitate with HA-Nt from cells expressing both Nt and Cd, but not the Nt or Cd domain alone, suggesting a specific interaction between the Nt and Cd (Fig. 2A).
The specific interaction was further supported by GST-pull down assay in vitro. GST-Nt was expressed and purified from bacteria by using glutathione–agarose beads, myc-tagged Cd was transiently expressed in 293T cells and the cell lysates were subjected to GST pull down assay. As shown in Fig. 2B, GST-Nt bounds to C-terminal domain, and the specificity of the binding is supported by the lack of binding between GST alone and C-terminal domain. The presence of similar amounts of GST and GST-Nt in the samples was verified by Ponceau S staining of the same membrane (Fig. 2B bottom), and similar expression level of C-terminal domain was verified by immunoblotting aliquots of the starting materials with an antibody against with the construct’s myc tag. These results clearly demonstrate that N-terminal domain can bind the C-terminal kinase domain in vivo and in vitro. Minimal regions required for interaction in both N-terminal and C-terminal kinase domains We constructed GST-Nt and its deletion mutants (Fig. 3A), expressed and purified proteins from E. coli. myc-Cd was transiently expressed in 293T cells, and the lysates were subjected to GST-pull down assay. As shown in Fig. 3B (lanes 3 and 4), Aurora box1 (aa 1–42) and the Aurora box (aa 1–63) failed to bind Cd. In contrast,
350
Y. Zhang et al. / Biochemical and Biophysical Research Communications 357 (2007) 347–352
Together, theses results indicate that aa 64–128 of Nt can inhibit the Cd kinase activity by a direct binding. Minimal region required for interaction in the C-terminal kinase domain We also investigated the key motif within Cd that can bind to Nt by designing a series of deletion mutants of myc-Cd by mutagenesis (Fig. 4A). The cell lysates were incubated with GST-Nt and GST, and then subjected to GST pull down assay using glutathione–Sepharose 4B resin. As shown in Fig. 4B, all the myc-tagged deletion mutants but CC3 and CC4 can bind to GST-Nt fusion protein, which means the region between aa 240–300 may be responsible for the interaction. This interaction region comprises the important activation loop (aa 274–300) of the Aur-A kinase, in which Thr288 is the key site for the kinase activation. Immunoblot analysis of cell extracts revealed that all the transfected plasmids were equally expressed in cells, GST and GST peptides were confirmed by PS stain. Discussion
Fig. 3. Identification of the inhibitory interaction region in Nt. (A) Schematic presentation of the N-terminal domain. The grey box represents Aurora-box1 and Aurora-box2, respectively, with the boundaries of amino acid residues indicated above. (B) Upper, GST, GST-tagged Nt and its three deletion derivatives were purified from E. coli and incubated with the cell lysates containing myc-Cd. Co-precipitants by GST-Sepharose were fractionated by SDS–PAGE and detected by Western blot analysis with anti-myc antibody. Bottom, bacterial expression of GST and GSTfusion proteins stained by Ponceau-S Red (PS Stain). (C) His-Cd was incubated with GST or GST-Nt in the presence of [c-32P]ATP and MBP, running the samples on SDS–PAGE followed by autoradiography (bottom).
both the full-length of Nt and the C-terminus of Nt between aa 64–128 can associate with myc-Cd (Fig. 3B, lanes 5 and 6). Therefore, the minimal region necessary for binding Cd is within Nt (aa 64–128), a region outside of Aurora box (aa 1–63). Further, we investigated whether the region between aa 64 and 128 has any regulatory effect on the Cd kinase activity. In the end, we purified GST-Nt (64–128), GST and His-Cd from E. coli. In the presence of 200 ng GST-Nt (64–128), the His-Cd kinase activity was significantly reduced using MBP as substrate. In contrast, the kinase activity of the Cd was not affected by the addition of the same amount of GST alone. Neither GST nor GST-(64– 128) has kinase ability to phosphorylate MBP (Fig. 3C).
Aurora-A is a centrosome kinase and plays essential roles during the G2/M phase. The activity of Aurora-A is controlled by many other regulatory proteins [21], while intramolecular regulation of Aurora-A has not been reported previously. In this study, we have identified an intramolecular interaction between the N-terminal domain and the C-terminal kinase domain of Aurora-A, and provided evidences that this interaction negatively regulates Aurora-A kinase activity. We also showed the minimal regions for this interaction. The N-terminal domain of Aur-A is important in regulation of the Aur-A function. Neither human Aurora-A nor Aurora-B was able to complement the yeast Iplpts mutation at restrictive temperature, which due to an inhibition of cell growth on overexpression of unique N-terminal domains of these proteins. However, at the less restrictive temperature, Ipl1pts phenotype was partially rescued by the hybrid kinase comprising the Ipl1p non-catalytic domain fused to the human Aurora-A catalytic domain, whereas Aurora-B fusion construct failed [12]. Agreed with this finding, we found that the Nt of human Aurora-A has negative function on the regulation of Cd kinase activity. However, Nt can not bind fulllength Aur-A in vitro and in vivo (data were not shown), and Nt can not interfere with the catalytic activity of Aurora-A when they co-expressed in 293T cells. One possible reason might be that the Aurora-A kinase intramolecular interaction between Nt and Cd formed a condensed conformation to keep its low kinase activity, and this conformation prevents other proteins or molecules from interacting with the catalytic domain. This hypothesis may be supported by the crystal structure of the catalytic domain [22–24]. The unphosphorylated kinase
Y. Zhang et al. / Biochemical and Biophysical Research Communications 357 (2007) 347–352
351
Fig. 4. Identification the region within Cd binding to Nt. (A) Schematic representation of the full-length Cd and its deprives, including activation loop (aa 272–299) in grey and D-box (aa 363–382) in black, is shown. Deletions from N-terminus were designated as CN, those from C-terminus deletions were designated as CC. (B) Cd and its six deletion deprives were pulled down with GST-Nt. Upper, myc-tagged Cd and its deprives were expressed in 293T cells and were mixed with GST-bound-beads (lanes 2, 5, 8, 11, 14, 17, and 20) and GST-Nt-bound beads (lanes 3, 6, 9, 12, 15, 18, and 21).The expression of Cd and its deprives are shown in lanes 1, 4, 7, 10, 13, and 16. Bottom, bacterial expression of GST and GST-fusion proteins stained by Ponceau-S Red (PS Stain).
adopts an unusually closed or inactive conformation, which is characterized by the hydrophobic aggregation of residues located in the activation segment and glycine-rich loop. The different parts of the N-terminal domain execute specific functions. However, data from this report and previous studies suggest the following model for Aurora-A regulation. The non-Aurora box keeps Aurora-A in an auto-inhibited conformation to prevent the phosphorylation and activation of the C-terminal domain when cells are not stimulated. After other proteins bind the Aurora box, the inhibitory conformation will turn open or closer, which depends on the structure and the function of the binding proteins. The data presented in this study allow a better understanding of regulation of Aurora-A and offer insights into the molecular mechanism involved in regulating the catalytic activity of Aurora-A. In future, we are going to find the key interaction sites using the known models, to find if Nt (64–128) has inhibitory function on catalytic domain of Aur-B and C, and to screen the possible inhibitors that can be exploited pharmacologically by use of this model. Acknowledgments This work was supported by the National 973 program of China (2004CB518605), 863 projects of China (2006
AA020501) and the National Natural Science foundation of China (30024001;30570406). References [1] M. Kimura, S. Kotani, T. Hattori, N. Sumi, T. Yoshioka, K. Todokoro, Y. Okano, Cell cycle-dependent expression and spindle pole localization of a novel human protein kinase, Aik, related to aurora of Drosophila and yeast Ipl1, J. Biol. Chem. 272 (1997) 13766–13771. [2] Y. Marumoto, T. Hirota, T. Morisaki, N. Kunitoku, D.W. Zhang, Y. Ichikawa, T. Sasayama, S. Kuninaka, T. Mimori, N. Tamaki, M. Kimura, Y. Okano, H. Saya, Roles of aurora-A kinase in mitotic entry and G2 checkpoint in mammalian cells, Genes Cells 7 (2002) 1173–1182. [3] P. Meraldi, R. Honday, E.A. Nigg, Aurora kinases link chromosome segregation and cell division to cancer susceptibility, Curr. Opin. Genet. Dev. 14 (2004) 29–36. [4] X. Wang, Y.X. Zhou, W. Qiao, Y. Tominaga, M. Ouchi, T. Ouchi, C.X. Deng, Over-expression of aurora kinase A in mouse mammary epithelium induces genetic instability preceding mammary tumor formation, Oncogene 25 (2006) 7148–7158. [5] T.A. Kufer, E.A. Nigg, H.H. Siljie, Regulation of Aurora-A kinase on the mitotic spindle, Chromosoma 112 (2003) 59–163. [6] R.R. Adams, M. Carmena, W.C. Earnshaw, Chromosomal passengers and the (aurora) ABCs of mitosis, Trends Cell Biol. 11 (2001) 49–54. [7] A. Anand, A. Penrhyn-Lowe, A.R. Venkitaraman, Aurora-A amplification overrides the mitotic spindle assembly checkpoint, inducing resistance to Taxol, Cancer Cell 3 (2003) 51–62. [8] L.E. Littlepage, H. Wu, T. Andresson, J.K. Deanehan, L.T. Amundadottir, J.V. Ruderman, Identification of phosphorylated residues
352
[9]
[10]
[11]
[12] [13]
[14]
[15]
Y. Zhang et al. / Biochemical and Biophysical Research Communications 357 (2007) 347–352 that affect the activity of the mitotic kinase Aurora-A, Proc. Natl. Acad. Sci. USA 99 (2002) 15440–15445. C.E. Haydon, P.A. Eyers, L.D. Aveline-Wolf, K.A. Resing, J.L. Maller, N.G. Ahn, Identification of novel phosphorylation sites on Xenopus laevis Aurora A and analysis of phosphopeptide enrichment by immobilized metal-affinity chromatography, Mol. Cell Proteomics 2 (2003) 1055–1067. A.O. Walter, W. Seghezzi, W. Korver, J. Sheung, E. Lees, The mitotic serine/threonine kinase Aurora2/AIK is regulated by phosphorylation and degradation, Oncogene 19 (2000) 4906–4916. J.R. Bischoff, L. Anderson, Y.F. Zhu, K. Mossie, N.L.B. Souza, B. Schryver, P. Flanagan, F. Clairvoyant, C. Ginther, C.S. Chan, M. Novotny, D.J. Slamon, G.D. Plowman, A homologue of Drosophila aurora kinase is oncogenic and amplified in human colorectalcancers, EMBO J. 17 (1998) 3052–3065. R. Giet, C. Prigent, Aurora/Ipl1p-related kinases, a new oncogenic family of mitotic serine/threonine kinases, J. Cell Sci. 112 (1999) 3591–3601. J. Kanungo, S.J. Pratt, H. Marie, G.D. Longmore, Ajuba, a cytosolic LIM Protein, shuttles into the nucleus and affects embryonal cell proliferation and fate decisions, Mol. Biol. Cell 11 (2000) 3299–3313. H. Marie, S.J. Pratt, M. Betson, H. Epple, J.T. Kittler, L. Meek, S.J. Moss, S. Troyanovsky, D. Attwell, G. D Longmore, V.M. Braga, The LIM protein Ajuba is recruited to Cadherin-dependent cell junctions through an association with Catenin, J. Biol. Chem. 278 (2003) 1220–1228. T. Hirota, N. Kunitoku, T. Sasayama, T. Marumoto, D.W. Zhang, M. Nitta, K. Hatakeyama, H. Saya, Aurora-A and an interacting activator, the LIM protein Ajuba, are required for mitotic commitment in human cells, Cell 114 (2003) 585–598.
[16] G. Crane, B. Gadea, L. Littlepage, H. Wu, V. Ruderman, Aurora A, meiosis and mitosis, Biol. Cell 96 (2003) 215–229. [17] S.S. Chen, P.C. Chang, Y.W. Cheng, F.M. Tang, Y.S. Lin, Suppression of the STK15 oncogenenic activity requires a transactivation-independent p53 function, EMBO J. 21 (2002) 4491–4499. [18] H. Katayama, H.Y. Zhou, Q. Li, M. Tatsuka, S. Sen, Interaction and feedback regulation between STK15/BTAK/Aurora-A kinase and protein phosphatase through mitotic cell division cycle, J. Biol. Chem. 276 (2001) 46219–46224. [19] S. Garrett, K. Auer, D.A. Compton, T.M. Kapoor, hTPX2 is required for normal spindle morphology and centrosome integrity during vertebrate cell division, Curr. Biol. 12 (2002) 2055–2069. [20] T.A. Kufer, H.W. Silji, R. Krner, O.J. Gruss, P. Meraldi, E.A. Nigg, Human TPX2 is required for targeting Aurora-A kinase to the spindle, J. Biol. Chem. 158 (2002) 617–623. [21] S.C. Dutertre, S. Descamps, C. Prigent, On the role of aurora-A in centrosome function, Oncogene 21 (2002) 6175–6183. [22] G.M. Cheetham, R.M. Knegtel, J.T. Coll, S.B. Renwick, L. Swenson, P. Weber, J.A. Lippke, D.A. Austen, Crystal structure of aurora-2, an oncogenic serine/threonine kinase, J. Biol. Chem. 277 (2002) 42419– 42422. [23] J. Nowakowski, C.N. Cronin, D.E. McRee, M.W. Knuth, C.G. Nelson, N.P. Pavletich, J. Rogers, B.C. Sang, D.N. Scheibe, R.V. Swanson, D.A. Thompson, Structures of the cancer- related AuroraA, FAK, and EphA2 protein kinases from nanovolume crystallograph, Structure 10 (2002) 1659–1667. [24] R. Bayliss, T. Sardon, I. Vernos, E. Conti, Structural basis of Aurora-A activation by TPX2 at the mitotic spindle, Mol. Cell 12 (2003) 851–862.
Identification of the auto-inhibitory domains of Aurora-A kinase Yue Zhang a
a,b,1
, Jun Ni
a,1
, Qiang Huang a, Weihua Ren a, Long Yu
a,*
, Shouyuan Zhao
a
State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, Shanghai 200433, China b Cardiology Branch, NHLBI, National Institutes of Health, Bethesda, MD 20892, USA Received 6 March 2007 Available online 30 March 2007
Abstract Aurora-A is a centrosome-localized serine/threonine kinase that is overexpressed in multiple human cancers. Here, we report an intramolecular inhibitory regulation in Aurora-A between its N-terminal regulatory domain (aa 1–128, Nt) and the C-terminal catalytic domain (aa 129–403, Cd). Removal of Nt results in a significant increase in kinase activity. Nt inhibited the activity of the single C-terminal kinase domain, but had little effect on the activity of the full-length of Aurora-A. PP1 is not involved in this regulation, instead, Nt interacts Cd directly in vitro and in vivo. The non-Aurora box (aa 64–128) in the N-terminal negatively regulated the kinase activity of the C-terminal kinase domain by intramolecular interaction with aa 240–300 within the C-terminal. 2007 Elsevier Inc. All rights reserved. Keywords: Aurora-A; Autoinhibitory regulation; Protein interaction; Protein kinase
Aurora kinases family has taken central stage in regulation of mitosis and meiosis in eukaryotes. These serine/ threonine kinases comprise three members: Aurora A, B, and C in mammals, each of them exhibits diverse subcellular location during cell cycle, reflecting the discrete role of each kinase during mitosis. Aurora-A gene was mapped to human chromosome 20q13.2–13.3, the region commonly undergoes frequent amplification in human cancers. The expression and the activity of Aurora-A kinase is regulated in a cell cycledependent manner: the level is low in G1/S, up-regulated during G2/M, and reduced rapidly after miotosis [1,2]. Aurora-A mutations interfere with recruitment of c-tubulin ring complexes and other proteins during centrosome maturation, formation of a bipolar spindle and chromosome segregation [3–6]. Aurora-A also plays an important role in programmed cell death and chemoresistance [7]. Aurora-A kinase has a C-terminal catalytic domain that is highly conserved within Aurora kinase family. The phosphorylation of Thr288 residue within the activation loop *
1
Corresponding author. Fax: +86 21 656432 50. E-mail address: [email protected] (L. Yu). These authors contributed equally to this work.
0006-291X/$ - see front matter 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2007.03.129
(aa 274–300) in the C-terminal is required for the kinase activity [8–10]. The N-terminal of Aurora-A contains two distantly conserved motifs: the first motif spans 5–40 amino acids (Aurora box1) and the second motif spans 21 amino acids (aa 43–63, Aurora box2), these two boxes are commonly called Aurora box [11,12]. These functional motifs are important for the regulation of the kinase activity by interacting with other proteins. Ajuba, a protein involved in cell adhesion and cell–cell contacts, interact the N-terminal of Aurora-A, induces the autophosphorylation and consequent activation of Aurora-A [13–15]. A transactivity defective p53 binds the N-terminal of Aurora-A, and suppresses Aurora-A-induced centrosome amplification and cellular transformation [16,17]. However, both TPX2 and PP1 interact with the C-terminal of Aurora-A. TPX2 antagonizes the negative regulation of PP1, then activates and localizes Aurora-A to MTs [18–20]. The non-catalytic domains of many protein kinases have an important function in vivo to regulate the kinase activity by preventing aberrant autophosphorylation and subsequent activation of the kinase in the absence of a specific activation signal. In this study, we analyzed the role of the N-terminal non-catalytic domain in the regulation of Aurora-A kinase activity. Our results showed that the
348
Y. Zhang et al. / Biochemical and Biophysical Research Communications 357 (2007) 347–352
truncated N-terminal Aur-A kinase has higher kinase activity than that of the full-length Aur-A. The non-Aurora box (aa 64–128), but not Aurora box (aa 1–64), negatively regulated the kinase activity of the C-terminal kinase domain by intramolecular interaction. The region in the Cterminal for the interaction locates in aa 240–300, which comprises the activation loop of aa 274–300.
inhibitors. Immunoprecipitates were washed four times with kinase lysis buffer and twice with kinase assay buffer (10 mM Hepes (pH 7.4), 50 mM NaCl, 5 mM MgCl2, 50 mM NaF, and 0.1 mM Na3VO4). The immunoprecipitates were suspended in kinase assay buffer containing 10 lCi [c-32P]ATP (Amersham), 0.5 mM ATP and 1 lg MBP for 30 min at 30 C. After reaction, an equal volume of 2· Laemmli sampling buffer was added, and then the mixture was boiled for 10 min. This sample was subjected to 12% SDS–PAGE. The gel was dried on a 3 mm filter and used for autoradiography.
Materials and methods Results Plasmid construction and site-directed mutagenesis. Aurora-A was constructed in pCMV-Myc/HA (Clontech). The sequence of the N-terminal domain (amino acids 1–128, Nt) and C-terminal domain (amino acids 129–403, Cd) were given artificial restriction sites using PCR from the cDNA of the full-length Aurora-A. To produce His fusion Nt and Cd proteins, each cDNA was inserted into pET-28a (Novagen), myc/HA fusions were constructed into pCMV-myc/HA. GST-Nt was constructed by fusing Nt in-frame with GST in pGEX-4T-2 (Amersham Pharmacia Biotech). All mutants of Aurora-A, Nt and Cd were constructed by mutagenesis using the Quick Change Site-Directed Mutagenesis Kit according to the manufacture’s protocol (Stratagen). Oligo nucleotides used for mutagenesis were listed in Table 1. All the constructs were confirmed by DNA sequencing. Immunoprecipitation and immunoblotting. Each expression plasmid was transfected in 293T cells, and proteins were extracted with IP buffer (10% Triton X-100, 1 mM b-glycerophosphate, 15 mM MgCl2, 1 mM EGTA, 1 mM EDTA, 150 mM NaCl, 1 mM NaVO4, 1 mM phenylmethylsulfonyl fluoride, 1 lg/ml leupeptin, 2.5 mM sodium pyrophosphate, and 20 mM Tris–HCl, pH 7.5), containing protease inhibitors. Cell lysates were precleared with 25 ll of resuspended protein-A/G PLUS-agarose, gently mixed for 1 h and centrifuged at 4000 rpm for 5 min. The supernatants were immunoprecipitated with either 20 ll of anti-HA monoclonal antibodyprotein G agarose or anti-myc antibody-protein G agarose (Clontech) rocked for 5 h. Following centrifugation, the pellets were washed five times in IP buffer, resuspended in 2· SDS sample buffer and boiled for 5 min. GST pull down. 293T cells expressing myc-Cd and its derivatives were harvested in TNT buffer (20 mM Tris–HCl, pH 7.6, 200 mM NaCl, and 1% Triton X-100). The protein lysate after centrifugation were mixed with 40 ll glutathione–Sepharose 4B beads (Amersham Biosciences, Inc.), and GST-fused protein was allowed to absorb to the beads for 1 h at 4 C. The GST proteins-beads were mixed with 100 ll of cell lysate, which were precleared with 20 lg GST protein. The suspension was incubated with gentle rocking for 2 h at 4 C. After collection by centrifugation, the beads were washed five times with TNT buffer. Bound proteins were extracted with SDS–PAGE sample buffer by boiling and were then subjected to SDS–PAGE and immunoblotted as described above. GST and GSTpeptides were confirmed by Ponceau protein stain. In vitro kinase assay. For the kinase assay, cells were lysed in kinase lysis buffer (10 mM Tris–HCl, 1% Triton X-100, 5 mM EDTA, 50 mM NaCl, 50 mM NaF, and 1 mM Na3VO4) supplemented with protease
The C-terminal kinase domain of the Aurora-A is negatively regulated by the N-terminal regulatory domain We performed kinase assay in vitro using Aurora-A and its mutants expressed and purified from 293T cells. As shown in Fig. 1A and B, the Cd exhibited about threefold increase in basal kinase activity toward the substrate MBP compared to that of full-length Aur-A. Nt and pCMV-vector did not show any kinase activity, indicating that the N-terminal domain has inhibitory effect on C-terminal catalytic activity. When 293T cells were co-transfected with myc-Nt with HA-Cd or with HA-Aur-A, the Nt inhibits the Cd kinase activity to MBP, but has a little effect on that of the full-length Aurora-A. PP1 can inhibit Aurora-A kinase activity by directly binding. We expressed and purified His-tagged Nt and Cd protein from Escherichia coli. After incubation of His-Cd with increasing amount of His-Nt, the kinase activity was decreased in a dose-dependent manner (Fig. 1C). PP1 does not exist in E. coli, therefore, we concluded that the negative regulation of the N-terminal to the C-terminal is specific and not involved in PP1. The N-terminal domain of Aurora-A can bind to its kinase domain in vivo and in vitro The preceding data clearly suggests an autoinhibitory role for the N-terminal domain in the C-terminal kinase domain catalytic activity, and the simplest model for such a regulation would be a direct interaction between them. We examined whether the Nt and Cd bind each other. 293T cells were transfected with myc-tagged Cd and HA-tagged Nt, while lysates were immunoprecipi-
Table 1 Forward versions of mutagenic primers of this study Oligonucleotides
Sequence (5 0 –3 0 )a
Aur box1(1–42 aa)-F Aur box(1–63 aa)-F CdC1(129–362)-F CdC2(129–300)-F CdC3(129–270)-F CdC4(129–240)-F Aur-A-T288A
CCTGTAAATAGTGGCTAGGCTCAGCGGG GCAAGCACAAAAGTAGGTCTCCAGTC GGACCTCATTTCCATAGCTGTTGAAGC CCTGCCCCCTAGATAGATTGAAGGTCGG CAGCTGGAGAGTAGAAAATTGCGA CAGAATTGGCATAGGCCCTGTCTTACTG CCAGGAGGACCGCCCTCTGTGGC
a
Altered nucleotides, which introduced the desired mutations, are underlined.
Y. Zhang et al. / Biochemical and Biophysical Research Communications 357 (2007) 347–352
349
Fig. 2. Nt interacts with Cd in vivo and in in vitro. (A) 293T cells were transfected to transiently express, either the HA-Nt (lane 1), the myc-Cd (lane 3) or a mixture of both (lane 2) was immunoprecipitated (IP) with either anti-HA agarose (lanes 4–6) or anti-myc agarose (lanes 7–9), and the precipitates were subjected to immunoblot analysis with either antiHA or anti-myc antibodies. (B) GST-pull down experiments confirm the interaction between the Nt and the Cd. Upper, cell extracts from 293T transfected with a vector expressing myc-tagged Cd were incubated with GST or the GST-Nt-coupled Sepharose beads. Bound proteins were analyzed by western blotting using an anti-myc antibody. Bottom, bacterial expression of GST or GST-Nt fusion proteins stained by Ponceau-S Red (PS Stain).
Fig. 1. Nt has a negative effect on the kinase activity of Cd in a dosedependent manner. (A) 293T cells were transfected with expression plasmids for vector, HA-Nt, myc-Cd, and myc-Aur-A alone, or cotransfected HA-Nt with myc-Cd or myc-Aur-A. The cell lysates were immunoprecipitated (IP) with anti-HA and/or anti-myc antibody. Aliquots of the immunoprecipitates were analyzed by immunoblotted with anti-HA or anti-myc antibodies, respectively. Aliqouts of immunoprecipitates were subjected to in vitro kinase assays with MBP and [c-32P]ATP as substrates, the peptides were separated by SDS–12% PAGE followed by autoradiography (bottom). (B) The activities of the proteins were assessed by measuring MBP phosphorylation as described in A (bottom). Representative autoradiograms are shown. Relative kinase activities of MBP were determined by scanning each band with a densitometer. (C) His-Cd and His-Nt were purified from E. coli. Constant amount of His-Cd incubated with different amount of His-Nt with MBP and [c-32P]ATP as substrates, His-Nt was as a control.
tated with myc-antibody or HA antibody and then subjected to immuno blotting analysis with anti-HA or antimyc in order to reveal any co-precipitation. myc-Cd can co-immunoprecipitate with HA-Nt from cells expressing both Nt and Cd, but not the Nt or Cd domain alone, suggesting a specific interaction between the Nt and Cd (Fig. 2A).
The specific interaction was further supported by GST-pull down assay in vitro. GST-Nt was expressed and purified from bacteria by using glutathione–agarose beads, myc-tagged Cd was transiently expressed in 293T cells and the cell lysates were subjected to GST pull down assay. As shown in Fig. 2B, GST-Nt bounds to C-terminal domain, and the specificity of the binding is supported by the lack of binding between GST alone and C-terminal domain. The presence of similar amounts of GST and GST-Nt in the samples was verified by Ponceau S staining of the same membrane (Fig. 2B bottom), and similar expression level of C-terminal domain was verified by immunoblotting aliquots of the starting materials with an antibody against with the construct’s myc tag. These results clearly demonstrate that N-terminal domain can bind the C-terminal kinase domain in vivo and in vitro. Minimal regions required for interaction in both N-terminal and C-terminal kinase domains We constructed GST-Nt and its deletion mutants (Fig. 3A), expressed and purified proteins from E. coli. myc-Cd was transiently expressed in 293T cells, and the lysates were subjected to GST-pull down assay. As shown in Fig. 3B (lanes 3 and 4), Aurora box1 (aa 1–42) and the Aurora box (aa 1–63) failed to bind Cd. In contrast,
350
Y. Zhang et al. / Biochemical and Biophysical Research Communications 357 (2007) 347–352
Together, theses results indicate that aa 64–128 of Nt can inhibit the Cd kinase activity by a direct binding. Minimal region required for interaction in the C-terminal kinase domain We also investigated the key motif within Cd that can bind to Nt by designing a series of deletion mutants of myc-Cd by mutagenesis (Fig. 4A). The cell lysates were incubated with GST-Nt and GST, and then subjected to GST pull down assay using glutathione–Sepharose 4B resin. As shown in Fig. 4B, all the myc-tagged deletion mutants but CC3 and CC4 can bind to GST-Nt fusion protein, which means the region between aa 240–300 may be responsible for the interaction. This interaction region comprises the important activation loop (aa 274–300) of the Aur-A kinase, in which Thr288 is the key site for the kinase activation. Immunoblot analysis of cell extracts revealed that all the transfected plasmids were equally expressed in cells, GST and GST peptides were confirmed by PS stain. Discussion
Fig. 3. Identification of the inhibitory interaction region in Nt. (A) Schematic presentation of the N-terminal domain. The grey box represents Aurora-box1 and Aurora-box2, respectively, with the boundaries of amino acid residues indicated above. (B) Upper, GST, GST-tagged Nt and its three deletion derivatives were purified from E. coli and incubated with the cell lysates containing myc-Cd. Co-precipitants by GST-Sepharose were fractionated by SDS–PAGE and detected by Western blot analysis with anti-myc antibody. Bottom, bacterial expression of GST and GSTfusion proteins stained by Ponceau-S Red (PS Stain). (C) His-Cd was incubated with GST or GST-Nt in the presence of [c-32P]ATP and MBP, running the samples on SDS–PAGE followed by autoradiography (bottom).
both the full-length of Nt and the C-terminus of Nt between aa 64–128 can associate with myc-Cd (Fig. 3B, lanes 5 and 6). Therefore, the minimal region necessary for binding Cd is within Nt (aa 64–128), a region outside of Aurora box (aa 1–63). Further, we investigated whether the region between aa 64 and 128 has any regulatory effect on the Cd kinase activity. In the end, we purified GST-Nt (64–128), GST and His-Cd from E. coli. In the presence of 200 ng GST-Nt (64–128), the His-Cd kinase activity was significantly reduced using MBP as substrate. In contrast, the kinase activity of the Cd was not affected by the addition of the same amount of GST alone. Neither GST nor GST-(64– 128) has kinase ability to phosphorylate MBP (Fig. 3C).
Aurora-A is a centrosome kinase and plays essential roles during the G2/M phase. The activity of Aurora-A is controlled by many other regulatory proteins [21], while intramolecular regulation of Aurora-A has not been reported previously. In this study, we have identified an intramolecular interaction between the N-terminal domain and the C-terminal kinase domain of Aurora-A, and provided evidences that this interaction negatively regulates Aurora-A kinase activity. We also showed the minimal regions for this interaction. The N-terminal domain of Aur-A is important in regulation of the Aur-A function. Neither human Aurora-A nor Aurora-B was able to complement the yeast Iplpts mutation at restrictive temperature, which due to an inhibition of cell growth on overexpression of unique N-terminal domains of these proteins. However, at the less restrictive temperature, Ipl1pts phenotype was partially rescued by the hybrid kinase comprising the Ipl1p non-catalytic domain fused to the human Aurora-A catalytic domain, whereas Aurora-B fusion construct failed [12]. Agreed with this finding, we found that the Nt of human Aurora-A has negative function on the regulation of Cd kinase activity. However, Nt can not bind fulllength Aur-A in vitro and in vivo (data were not shown), and Nt can not interfere with the catalytic activity of Aurora-A when they co-expressed in 293T cells. One possible reason might be that the Aurora-A kinase intramolecular interaction between Nt and Cd formed a condensed conformation to keep its low kinase activity, and this conformation prevents other proteins or molecules from interacting with the catalytic domain. This hypothesis may be supported by the crystal structure of the catalytic domain [22–24]. The unphosphorylated kinase
Y. Zhang et al. / Biochemical and Biophysical Research Communications 357 (2007) 347–352
351
Fig. 4. Identification the region within Cd binding to Nt. (A) Schematic representation of the full-length Cd and its deprives, including activation loop (aa 272–299) in grey and D-box (aa 363–382) in black, is shown. Deletions from N-terminus were designated as CN, those from C-terminus deletions were designated as CC. (B) Cd and its six deletion deprives were pulled down with GST-Nt. Upper, myc-tagged Cd and its deprives were expressed in 293T cells and were mixed with GST-bound-beads (lanes 2, 5, 8, 11, 14, 17, and 20) and GST-Nt-bound beads (lanes 3, 6, 9, 12, 15, 18, and 21).The expression of Cd and its deprives are shown in lanes 1, 4, 7, 10, 13, and 16. Bottom, bacterial expression of GST and GST-fusion proteins stained by Ponceau-S Red (PS Stain).
adopts an unusually closed or inactive conformation, which is characterized by the hydrophobic aggregation of residues located in the activation segment and glycine-rich loop. The different parts of the N-terminal domain execute specific functions. However, data from this report and previous studies suggest the following model for Aurora-A regulation. The non-Aurora box keeps Aurora-A in an auto-inhibited conformation to prevent the phosphorylation and activation of the C-terminal domain when cells are not stimulated. After other proteins bind the Aurora box, the inhibitory conformation will turn open or closer, which depends on the structure and the function of the binding proteins. The data presented in this study allow a better understanding of regulation of Aurora-A and offer insights into the molecular mechanism involved in regulating the catalytic activity of Aurora-A. In future, we are going to find the key interaction sites using the known models, to find if Nt (64–128) has inhibitory function on catalytic domain of Aur-B and C, and to screen the possible inhibitors that can be exploited pharmacologically by use of this model. Acknowledgments This work was supported by the National 973 program of China (2004CB518605), 863 projects of China (2006
AA020501) and the National Natural Science foundation of China (30024001;30570406). References [1] M. Kimura, S. Kotani, T. Hattori, N. Sumi, T. Yoshioka, K. Todokoro, Y. Okano, Cell cycle-dependent expression and spindle pole localization of a novel human protein kinase, Aik, related to aurora of Drosophila and yeast Ipl1, J. Biol. Chem. 272 (1997) 13766–13771. [2] Y. Marumoto, T. Hirota, T. Morisaki, N. Kunitoku, D.W. Zhang, Y. Ichikawa, T. Sasayama, S. Kuninaka, T. Mimori, N. Tamaki, M. Kimura, Y. Okano, H. Saya, Roles of aurora-A kinase in mitotic entry and G2 checkpoint in mammalian cells, Genes Cells 7 (2002) 1173–1182. [3] P. Meraldi, R. Honday, E.A. Nigg, Aurora kinases link chromosome segregation and cell division to cancer susceptibility, Curr. Opin. Genet. Dev. 14 (2004) 29–36. [4] X. Wang, Y.X. Zhou, W. Qiao, Y. Tominaga, M. Ouchi, T. Ouchi, C.X. Deng, Over-expression of aurora kinase A in mouse mammary epithelium induces genetic instability preceding mammary tumor formation, Oncogene 25 (2006) 7148–7158. [5] T.A. Kufer, E.A. Nigg, H.H. Siljie, Regulation of Aurora-A kinase on the mitotic spindle, Chromosoma 112 (2003) 59–163. [6] R.R. Adams, M. Carmena, W.C. Earnshaw, Chromosomal passengers and the (aurora) ABCs of mitosis, Trends Cell Biol. 11 (2001) 49–54. [7] A. Anand, A. Penrhyn-Lowe, A.R. Venkitaraman, Aurora-A amplification overrides the mitotic spindle assembly checkpoint, inducing resistance to Taxol, Cancer Cell 3 (2003) 51–62. [8] L.E. Littlepage, H. Wu, T. Andresson, J.K. Deanehan, L.T. Amundadottir, J.V. Ruderman, Identification of phosphorylated residues
352
[9]
[10]
[11]
[12] [13]
[14]
[15]
Y. Zhang et al. / Biochemical and Biophysical Research Communications 357 (2007) 347–352 that affect the activity of the mitotic kinase Aurora-A, Proc. Natl. Acad. Sci. USA 99 (2002) 15440–15445. C.E. Haydon, P.A. Eyers, L.D. Aveline-Wolf, K.A. Resing, J.L. Maller, N.G. Ahn, Identification of novel phosphorylation sites on Xenopus laevis Aurora A and analysis of phosphopeptide enrichment by immobilized metal-affinity chromatography, Mol. Cell Proteomics 2 (2003) 1055–1067. A.O. Walter, W. Seghezzi, W. Korver, J. Sheung, E. Lees, The mitotic serine/threonine kinase Aurora2/AIK is regulated by phosphorylation and degradation, Oncogene 19 (2000) 4906–4916. J.R. Bischoff, L. Anderson, Y.F. Zhu, K. Mossie, N.L.B. Souza, B. Schryver, P. Flanagan, F. Clairvoyant, C. Ginther, C.S. Chan, M. Novotny, D.J. Slamon, G.D. Plowman, A homologue of Drosophila aurora kinase is oncogenic and amplified in human colorectalcancers, EMBO J. 17 (1998) 3052–3065. R. Giet, C. Prigent, Aurora/Ipl1p-related kinases, a new oncogenic family of mitotic serine/threonine kinases, J. Cell Sci. 112 (1999) 3591–3601. J. Kanungo, S.J. Pratt, H. Marie, G.D. Longmore, Ajuba, a cytosolic LIM Protein, shuttles into the nucleus and affects embryonal cell proliferation and fate decisions, Mol. Biol. Cell 11 (2000) 3299–3313. H. Marie, S.J. Pratt, M. Betson, H. Epple, J.T. Kittler, L. Meek, S.J. Moss, S. Troyanovsky, D. Attwell, G. D Longmore, V.M. Braga, The LIM protein Ajuba is recruited to Cadherin-dependent cell junctions through an association with Catenin, J. Biol. Chem. 278 (2003) 1220–1228. T. Hirota, N. Kunitoku, T. Sasayama, T. Marumoto, D.W. Zhang, M. Nitta, K. Hatakeyama, H. Saya, Aurora-A and an interacting activator, the LIM protein Ajuba, are required for mitotic commitment in human cells, Cell 114 (2003) 585–598.
[16] G. Crane, B. Gadea, L. Littlepage, H. Wu, V. Ruderman, Aurora A, meiosis and mitosis, Biol. Cell 96 (2003) 215–229. [17] S.S. Chen, P.C. Chang, Y.W. Cheng, F.M. Tang, Y.S. Lin, Suppression of the STK15 oncogenenic activity requires a transactivation-independent p53 function, EMBO J. 21 (2002) 4491–4499. [18] H. Katayama, H.Y. Zhou, Q. Li, M. Tatsuka, S. Sen, Interaction and feedback regulation between STK15/BTAK/Aurora-A kinase and protein phosphatase through mitotic cell division cycle, J. Biol. Chem. 276 (2001) 46219–46224. [19] S. Garrett, K. Auer, D.A. Compton, T.M. Kapoor, hTPX2 is required for normal spindle morphology and centrosome integrity during vertebrate cell division, Curr. Biol. 12 (2002) 2055–2069. [20] T.A. Kufer, H.W. Silji, R. Krner, O.J. Gruss, P. Meraldi, E.A. Nigg, Human TPX2 is required for targeting Aurora-A kinase to the spindle, J. Biol. Chem. 158 (2002) 617–623. [21] S.C. Dutertre, S. Descamps, C. Prigent, On the role of aurora-A in centrosome function, Oncogene 21 (2002) 6175–6183. [22] G.M. Cheetham, R.M. Knegtel, J.T. Coll, S.B. Renwick, L. Swenson, P. Weber, J.A. Lippke, D.A. Austen, Crystal structure of aurora-2, an oncogenic serine/threonine kinase, J. Biol. Chem. 277 (2002) 42419– 42422. [23] J. Nowakowski, C.N. Cronin, D.E. McRee, M.W. Knuth, C.G. Nelson, N.P. Pavletich, J. Rogers, B.C. Sang, D.N. Scheibe, R.V. Swanson, D.A. Thompson, Structures of the cancer- related AuroraA, FAK, and EphA2 protein kinases from nanovolume crystallograph, Structure 10 (2002) 1659–1667. [24] R. Bayliss, T. Sardon, I. Vernos, E. Conti, Structural basis of Aurora-A activation by TPX2 at the mitotic spindle, Mol. Cell 12 (2003) 851–862.