Identification of the Drosophila eIF4A gene as a target of the DREF transcription factor

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 3 ( 2 00 7 ) 4 2 0 8 –42 2 0

a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m

w w w. e l s e v i e r. c o m / l o c a t e / y e x c r

Research Article

Identification of the Drosophila eIF4A gene as a target of the DREF transcription factor Hiroyuki Idaa,b , Hideki Yoshidaa,c,1 , Kumi Nakamuraa,b , Masamitsu Yamaguchia,b,⁎ a

Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585, Japan Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585, Japan c Venture Laboratory, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585, Japan b

ARTICLE INFORMATION

ABS T R AC T

Article Chronology:

The DNA replication-related element-binding factor (DREF) regulates cell proliferation-

Received 16 May 2007

related gene expression in Drosophila. We have carried out a genetic screening, taking

Revised version received

advantage of the rough eye phenotype of transgenic flies that express full-length DREF in the

17 August 2007

eye imaginal discs and identified the eukaryotic initiation factor 4A (eIF4A) gene as a dominant

Accepted 17 August 2007

suppressor of the DREF-induced rough eye phenotype. The eIF4A gene was here found to

Available online 24 August 2007

carry three DRE sequences, DRE1 (−40 to − 47), DRE2 (− 48 to − 55), and DRE3 (−267 to − 274) in its promoter region, these all being important for the eIF4A gene promoter activity in cultured

Keywords:

Drosophila Kc cells and in living flies. Knockdown of DREF in Drosophila S2 cells decreased

eIF4A

the eIF4A mRNA level and the eIF4A gene promoter activity. Furthermore, specific binding of

DREF

DREF to genomic regions containing DRE sequences was demonstrated by chromatin

Translation initiation

immunoprecipitation assays using anti-DREF antibodies. Band mobility shift assays using Kc

Transcription

cell nuclear extracts revealed that DREF could bind to DRE1 and DRE3 sequences in the eIF4A gene promoter in vitro, but not to the DRE2 sequence. The results suggest that the eIF4A gene is under the control of the DREF pathway and DREF is therefore involved in the regulation of protein synthesis. © 2007 Elsevier Inc. All rights reserved.

Introduction Promoters of many DNA replication- and proliferation-related genes in Drosophila contain a common eight base pair (bp) palindromic sequence, 5′-TATCGATA named the DNA replication-related element (DRE) [1–11]. The requirement of DRE for promoter activity has been confirmed in both cultured cell and transgenic fly systems [1,12,13] and a specific DRE-binding factor (DREF) has been identified. Molecular cloning of its cDNA has led to confirmation that DREF is a trans-activator of

DRE-containing genes [1]. It is also reported that DREF is a component of a transcription initiation complex containing TRF2 [14]. In addition, the chromatin remodeling factor dMi-2 and a homeodomain protein Distal-less can bind to the DNAbinding domain of DREF to inhibit its DNA-binding activity [15,16]. Searches of the Drosophila genome database have revealed the presence of 277 genes containing DRE-like sequences within their promoter regions [17,18] and immunostaining of polytene chromosomes of salivary glands with the anti-DREF

⁎ Corresponding author. Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585, Japan. Fax: +81 75 724 7760. E-mail address: [email protected] (M. Yamaguchi). 1 Present address: Terrence Donnelly Centre for Cellular and Biomolecular Research University of Toronto 160 College St., Toronto, Ontario, Canada M5S 3E1. 0014-4827/$ – see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2007.08.016

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 3 ( 2 00 7 ) 4 2 0 8 –42 2 0

monoclonal antibody demonstrated binding of DREF to a hundred discrete interband regions of polytene chromosomes [15]. In addition, serial analysis of gene expression (SAGE) showed that many genes selectively expressed in dividing precursor cells located anterior to the morphogenetic furrow of the Drosophila eye imaginal disc carry DRE in their 5′-flanking regions [19]. DREF may therefore regulate the expression of many genes and play multiple roles in vivo. Ectopic expression of the dominant-negative form of DREF using the GAL4-UAS targeted expression system causes inhibition of both endo-replication in larval salivary gland cells and mitotic DNA replication in eye imaginal disc cells [20]. Overexpression of full-length DREF in eye imaginal discs results in ectopic DNA synthesis and apoptosis in otherwise post-mitotic cells and inhibits photoreceptor cell differentiation so that a severe rough eye phenotype develops in adults [21]. Knockdown of the DREF gene by expressing inverted repeat RNA in imaginal discs causes defects in cell growth and cell cycle progression [22], while more efficient knockdown in wing imaginal discs induces loss-of-vein phenotypes [23].

4209

These results indicate that DREF is involved in the regulation of DNA replication in both mitotic and endo-replication cycles as well as in some differentiation processes. In the present study, we carried out a genetic screening, taking advantage of the rough eye phenotype of transgenic flies that express full-length DREF in the eye imaginal discs, and identified the eukaryotic initiation factor 4A (eIF4A) gene as an apparent dominant suppressor of the DREF-induced rough eye phenotype. The eIF4A gene carries three DRE sequences in its 5′-flanking region and luciferase transient expression assays in cultured Drosophila cells with the eIF4A gene promoter–luciferase fusion plasmids and chromatin immunoprecipitation assays using Drosophila S2 cells and anti-DREF antibody revealed that DREF directly regulates expression of the eIF4A gene. Analyses with transgenic flies carrying the eIF4A gene promoter-lacZ fusion genes also provided support for this conclusion. Since it is reported that the eIF4A protein is associated with growth by regulating protein translation [24], control of the eIF4A gene expression by DREF might be important for the regulation of cell proliferation.

Materials and methods Fly strains Fly strains were maintained at 25 °C on standard food. Canton S flies were used as the wild type strain. P{PZ}eIF-4a02439 cn1/CyO; ry506 were obtained from the Bloomington, Indiana stock center. The UAS-dDREF transgenic fly line was described earlier [21] as was the transgenic fly line (line number 16) carrying GMR-GAL4 on the X chromosome [25,26]. To examine effects of DREF overexpression in eye imaginal discs, P{PZ}eIF-4a02439 cn1/CyO; ry506 flies were crossed with +/CyO, P{ActGFP}JMR1 flies and progeny with the genotype P{PZ}eIF-4a02439 cn1/CyO, P{ActGFP}JMR1; +/ry506 were identified by GFP. All other stocks used in this study were obtained from the Bloomington, Indiana stock center.

Oligonucleotides To obtain the eIF4A gene promoter region, the following primers for polymerase chain reaction (PCR) were chemically synthesized: 5′Kpn1P 3′Hind3P 5′Not1P 3′BamH1P eIF4a-DRE3mut eIF4a-anti-DRE3mut eIF4a-DRE1wtDRE2mut eIF4a-anti-DRE1wtDRE2mut eIF4a-DRE1mutDRE2wt eIF4a-anti-DRE1mutDRE2wt eIF4a-DRE1,2mut eIF4a-anti-DRE1,2mut

5′-TCTGGTACCCAAGAGAATGTAATCTGTTGGAAAA 5′-AGGAAGCTTCTTGCAAAAGTTTTAGTGATGTAAGAAAAC 5′-GCGGCCGCAAGGTTGTTGTTCAAATGGTTG 5′-GGATCCATTTTACCAACAGTACCGGAATGC 5′-GATGGGCGTAATcgCGAgcGCAAATAAAATAGCGAAGTCAGGCACC 5′-GGTGCCTGACTTCGCTATTTTATTTGCgcTCGcgATTACGCCCATC 5′-CATCTGGCGATAGTTGGCGcgCGAgCTATCGATAGTCGCTAATGT 5′-ACATTAGCGACTATCGATAGcTCGcgCGCCAACTATCGCCAGATG 5′-CATCTGGCGATAGTTGGCGATCGATCTcgCGAgcGTCGCTAATGT 5′-ACATTAGCGACgcTCGcgAGATCGATCGCCAACTATCGCCAGATG 5′-GCTAACATCTGGCGATAGTTGGCGcgCGAgCTcgCGAgcGTCGCTAATGT 5′-ACATTAGCGACgcTCGcgAGcTCGcgCGCCAACTCTCGCCAGATGTTAGC

For quantitative real-time PCR, the following oligonucleotides were synthesized: DREF-F DREF-R eIF4A-F eIF4A-R β-tubulin-F β-tubulin-R RP49-R RP49-R

5′-GGCAATCTCCGTTGAATGACG 5′-TTCACCTCCGAGAAGCCCTT 5′-TATGGTTTCGAGAAGCCGTC 5′-CCTGCTTCACGTTGACGTAA 5′-AGTTCACCGCTATGTTCA 5′-CGCAAAACATTGATCGAG 5′-GCTTCTGGTTTCCGGCAAGCTTCAAG 5′-GACCTCCAGCTCGCGCACGTTGTGCACCAGGAAC

4210

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 3 ( 2 00 7 ) 4 2 0 8 –42 2 0

For band mobility shift assays, the following oligonucleotides were synthesized: eIF4a-DRE3 eIF4a-anti-DRE3 eIF4a-DRE1,2 eIF4a-anti-DRE1,2

5′-GATGGGCGTAATATCGATAGCAAATAAAATAGCGAAGTCAGGCACC 5′-GGTGCCTGACTTCGCTATTTTATTTGCTATCGATATTACGCCCATC 5′-GCTAACATCTGGCGATAGTTGGCGATCGATCTATCGATAGTCGCTAATGT 5′-ACATTAGCGACTATCGATAGATCGATCGCCAACTCTCGCCAGATGTTAGC

To carry out chromatin immunoprecipitation, the following PCR primers were chemically synthesized: PCNAP PCNAantiP EIF4ADRE1P EIF4AantiDRE1P actin5CP actin5CantiP

5′-GATGAATGATTAACGTGGGCTG 5′-GAAATAAATATACTCTGTAAAAAGTGTGAAC 5′-CTTTACCATACACACTGCGAAG 5′-CAAAAGAGGCTCCATCTTGCAAAAG 5′-CTCCATCATGAAGTGTGATGTG 5′-CGTACTCCTGCTTGGACGTC

Plasmid construction To construct the plasmid p5′-436eIF4awt-luc, PCR was performed using Drosophila genomic DNA as a template and primers 5′ Kpn1P and 3′Hind3P in combination. PCR products were digested with KpnI and HindIII and inserted between the KpnI and HindIII sites of the PGVB plasmid (Toyo Ink). For site-directed mutagenesis, PCR was carried out using a QuickChange Site-directed Mutagenesis Kit (Stratagene). Oligonucleotidepairs carrying base substitutions in the region of interest were used as primers and the p5′-436peIF4awt-luc DNA was used as a template for the PCR. Fully amplified PCR products were digested with DpnI to remove the methylated template DNA and then transformed into E. coli XL-1 blue. The mutated nucleotide sequences were confirmed by nucleotide sequencing and the resultant plasmids were named p5′-436peIF4amutDRE1-luc, p5′-436peIF4amutDRE2-luc, p5′-436peIF4amutDRE3-luc, p5′436peIF4amutDRE1,2-luc, p5′-436peIF4amutDRE2,3-luc, p5′-436peIF4amutDRE1,3-luc and p5′-436peIF4amutDREall-luc. To construct the plasmids p5′-436eIF4awt-LacZ and p5′-436eIF4amutDREall-LacZ for transgenic flies, PCR was performed using plasmid p5′-436eIF4awt-luc as a template and p5′-436eIF4amutDREall-luc and primers 5′Not1P and 3′BamH1P in combination. PCR products were digested with BamHI and NotI and inserted between the BamHI and NotI sites of the pOBP plasmid [27].

DNA transfection into cells and luciferase assays Drosophila Kc and Schneider (S2) cells were grown in M3(BF) medium supplemented with 2% and 10% fetal calf serum [28]. Kc cells were plated at about 2 × 105 cells in each well of 24-well dishes at 24 h before transfection, carried out using CellFectin reagent as recommended by the manufacturer (Invitrogen). One microgram of 5′-436eIF4awt-luc as a reporter plasmid and 1 ng of pAct5C-seapansy as an internal control plasmid were co-transfected into cells, which were then harvested 48 h thereafter. Luciferase assays were carried out as described earlier [29] using the Dual-Luciferase Reporter assay system (Promega). All assays were performed within the range of linear relation of activity to incubation time and protein amount and values were normalized to Renilla luciferase activity. The obtained values were essentially comparable with those normalized to protein amounts. Transfections were performed several times with at least two independent plasmid preparations. For double-stranded RNA (dsRNA) interference experiments, 1 × 105 S2 cells were plated in 24-well dishes in the presence of 3 μg/well of DREF dsRNA and LacZ dsRNA in fetal bovine serum (FBS) free M3(BF) medium for 1 h. DsRNA free incubation (mock) was conducted as a control for 1 h in FBS free M3(BF). After the incubation, four volumes of M3(BF) medium containing 10% FBS were added to each well. Seventy-two hours after the RNAi treatment, the cells were co-transfected with reporter genes, 2 μg for each p5′-436eIF4awt-luc plasmid and 1 ng/well of plasmids containing the Renilla luciferase gene, with the aid of Cell-Fectin reagents (Invitrogen). Cells were harvested at 48 h after transfection and subjected to luciferase assays according to standard instructions with the kit (Promega). All assays were performed within the range of linear relation of activity to incubation time.

Western immunoblot analysis Whole cell extracts from S2 cells prepared as described earlier [30] were applied to SDS–polyacrylamide gels containing 10% acrylamide and transferred to polyvinylidene difluoride membranes (Bio-Rad) in transfer buffer (50 mM borate–NaOH, pH 9.0, 20% ethanol) at 4 °C for 16 h. The blotted membranes were incubated with culture supernatants of hybridomas producing monoclonal antibodies to DREF [1] at 1:10,000 dilution or anti-tubulin IgG (Sigma) at 1: 2000 for 16 h at 4 °C. The bound antibodies were detected with peroxidase-conjugated goat anti-mouse IgG and the ECL system (Amersham Pharmacia Biotech) according to the manufacturer's recommendations, and images were analyzed with a Lumivision Pro HSII image analyzer (Aisin Seiki).

4211

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 3 ( 2 00 7 ) 4 2 0 8 –42 2 0

The dsRNA interference experiments were performed as described above with some modifications [31,32]. 1 × 106 S2 cells were plated in 6 cm plates with 1 ml of serum free M3(BF) medium and incubated with 30 μg each of DREF or LacZ dsRNAs or no dsRNA for 1 h at 25 °C. Five milliliters of 10% FBS M3(BF) medium was then added to each plate followed by incubation for 2 days, 4 days or 6 days at 25 °C in 5% CO2 before harvesting.

Quantitative RT-PCR 1 × 106 S2 cells were plated in 6-well dishes in 2 l M3 medium containing 30 μg/well of double-stranded RNAs DREFdsRNA or LacZdsRNA for 1 h. After the incubation, 3 ml of 10% FBS M3 medium was added to each well. At 5 days after the RNAi treatment, total RNA was isolated from cells using Trizol® Reagent (Invitrogen) and 1 μg aliquots were reverse transcribed with oligo dT primer using a Takara high fidelity RNA PCR kit (Takara). Then, real-time PCR was performed with a SYBR Green I kit (Takara) and the Applied Biosystems 7500 Real-time PCR system using 1 μl of reverse transcribed sample per reaction. Levels of mRNAs in the DREFdsRNA or LacZdsRNA treated cells and no dsRNA treated cells were investigated by the CT comparative method [33]. The βtubulin gene was chosen as a negative control. Rp49 was used as an endogenous reference gene. Experiments were performed in triplicate for each of three RNA batches isolated separately.

Establishment of transgenic flies P element-mediated germ line transformation was carried out as described earlier [34] and F1 transformants were selected on the basis of white-eye color rescue [35]. The established transgenic fly strains and their chromosomal linkages are listed in Table 1.

Scanning electron microscopy Adult flies were anesthetized, mounted on stages and observed under a VE-7800 (Keyence Inc.) scanning electron microscope in the high vacuum mode.

Band mobility shift assay Band mobility shift analysis was performed as reported previously [9], with minor modifications. Kc cell nuclear extracts were prepared as described elsewhere [9]. They were then incubated in a reaction mixture containing 15 mM N-2-hydroxyethylpierazine-N′-2-ethanesulfonic acid (HEPES), pH 7.6, 60 mM KCl, 0.1 mM EDTA, 1 mM DTT, 12% glycerol, 0.1 mg/ml poly(dI-dC) and double-stranded 32P-labeled synthetic oligonucleotides (100,000 cpm) and incubated for 15 min on ice. When necessary, unlabeled oligonucleotides were added as competitors at this step. DNA–protein complexes were electrophoretically resolved on 4% polyacrylamide gels in 50 mM Tris–borate, pH 8.3, 1 mM EDTA and 2.5% glycerol at 25 °C. The gels were then dried and autoradiographed. Band mobility shift assays were also performed in the presence of anti-DREF monoclonal antibody 1, anti-DREF monoclonal antibody 4 [1] or mouse IgG as a control. Kc cell nuclear extracts were mixed with each antibody, incubated for 2 h on ice, added to mixtures containing 32P-labeled synthetic oligonucleotides (100,000 cpm) and 0.1 mg/ml poly (dI-dC) and then incubated for 15 min on ice as described above.

Immunohistochemistry Third instar larvae were dissected in PBS and imaginal discs and other tissues were fixed in 4% paraformaldehyde/PBS for 30 min at 25 °C. After washing with PBS/0.3% Triton X-100 (PBS-T), the samples were blocked with PBS-T containing 10% normal goat serum for 20 min at 25 °C and incubated with an anti-β-galactosidase monoclonal antibody (Promega) or an anti-DREF monoclonal antibody mixture at a 1:500 dilution at 4 °C for 16 h. After extensive washing with PBS-T, the imaginal discs and other tissues were incubated with an anti-mouse IgG conjugated with Alexa 594 (Molecular Probes) at a 1:400 dilution at 4 °C for 16 h. After extensive washing with PBS-T and PBS, samples were mounted in Fluoroguard Antifade Reagent (Bio-Rad) for microscopic observation. Microscopic images were obtained using an Olympus BX-50 microscope equipped with a cooled CCD camera (Hamamatsu Photo).

Table 1 – Transformants carrying the LacZ gene fused to the eIF4A gene 5′-flanking region P-element plasmids p5′-436eIF4awt-LacZ

p5′-436eIF4amutDREall-LacZ

Strains

Chromosome linkage

12 27 45 4 21 30

III II III II II III

4212

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 3 ( 2 00 7 ) 4 2 0 8 –42 2 0

Immunostaining of polytene chromosomes Polytene chromosome spreads were prepared from Canton S wild-type wandering third instar larvae as described [36], stored in PBS–0.05% Tween 20–1% bovine serum albumin (BSA) at 4 °C for 16 h and then incubated with anti-DREF monoclonal antibody at a 1:1000 dilution at 4 °C for 16 h. After extensive washing with PBS–0.05% Tween 20–1% BSA, samples were incubated at 25 °C for 1 h with anti-mouse IgG conjugated with Alexa 594 (Molecular Probe) at a 1:400 dilution. The chromosomes were then washed with PBS–0.05% Tween 20–1% BSA and mounted in Fluoroguard Antifade Reagent (Bio-Rad) for microscopic observation. Microscopic images were obtained using an Olympus BX-50 microscope equipped with a cooled CCD camera (Hamamatsu Photo).

Chromatin immunoprecipitation We performed chromatin immunoprecipitation using a Chip Assay kit as recommended by the manufacturer (Upstate) [37]. Approximately 1 × 107 S2 cells were fixed in 1% formaldehyde at 37 °C for 10 min and then quenched in 125 mM glycine for 5 min at 25 °C. Cells were washed twice in PBS containing protease inhibitors (1 mM PMSF, 1 μg/ml aprotinin and 1 μg/ml pepstatin A) and lysed in 2 ml of SDS lysis buffer. Lysates were sonicated to break DNA into fragments of less than 1 kb and centrifuged at 15,300×g for 10 min at 4 °C. The sonicated cell supernatants were diluted 10-fold in Chip Dilution Buffer and pre-cleared with 80 μl Salmon Sperm DNA/Protein A agarose-50% slurry for 30 min at 4 °C. After brief centrifugation, each supernatant was incubated with 1 μg of the rabbit IgG or anti-DREF polyclonal antibody for 16 h at 4 °C. Salmon Sperm DNA/Protein A agarose-50% slurry was added and incubated for 1 h at 4 °C. After washing, immunoprecipitated DNA was eluted with elution buffer containing 1% SDS and 0.1 M NaHCO3. Then the protein–DNA crosslinks were reversed by heating at 65 °C for 4 h. After deproteinization with proteinase K, DNA was recovered by phenol-chloroform extraction and ethanol precipitation. The immunoprecipitated DNA fragments were detected by quantitative real-time PCR using SYBR Green I (Takara) and the Applied Biosystems 7500 Real-time PCR system [38]. The ΔΔCT value for each sample was calculated by subtracting the CT value for the input sample from the CT value obtained for the immunoprecipitated samples. Fold differences relative to the control using non-immune IgG were then calculated by raising 2 to the ΔΔCT power. The ΔΔCT was calculated by subtracting the ΔCT value for the sample immunoprecipitated with control IgG.

Results Half reduction of the eIF4A gene dose suppresses the DREF-induced rough eye phenotype Overexpression of DREF induced ectopic DNA synthesis and apoptosis and inhibited photoreceptor cell differentiation in eye imaginal discs so that adult flies exhibited a severe rough eye phenotype (Fig. 1A, panels a and b) [21]. Since eye phenotype does not impair viability or fertility [21], these flies serve as an excellent genetic tool to screen for mutations that modify the rough eye phenotype. Previous studies identified 16 deletion regions that modify the DREFinduced rough eye phenotype in the second chromosome [21]. In order to identify genes in these genomic regions that are responsible for modification of the DREF-induced rough eye phenotype, various mutants mapped in 11 genomic regions were collected and used for crosses with transgenic flies expressing DREF. By this screening, we identified eIF4A as a dominant suppressor of the DREF-induced rough eye phenotype. Half reduction of the eIF4A gene dose partially suppressed the DREF-induced rough eye phenotype (Fig. 1A, panels c and d). The extent of suppression appears to be similar to those observed with skpA and orc2 mutants [10,38]. Suppression of the DREF-induced rough eye phenotype by reducing the eIF4A gene dose to one half might have been due to a decreased expression level or decreased stability of the DREF protein. To exclude these possibilities, the level of DREF in the mutant background was examined (Fig. 1B). Immunostaining with

anti-DREF antibodies revealed that the DREF protein was overexpressed in cells posterior to the furrow in the eye imaginal discs and the DREF levels were comparable between F1 progenies from DREF-overexpressing flies crossed with eIF4A mutant flies and those crossed with the control yw (Fig. 1B, panels a and b). These data indicate that a half-dose reduction of the eIF4A gene exerted no apparent effect on the accumulation levels of the DREF protein. The data, taken together, suggest that the DREF-induced rough eye phenotype is at least partly mediated by the eIF4A gene function, although up-regulation of other DREF target genes likely contributes to the DREF-induced rough eye phenotype.

The 5′-flanking region of the eIF4A gene contains two DRE and one DRE-like sequences To test the possibility that transcription of the eIF4A gene is directly regulated by DREF, we searched the DRE sequence in 5′-flanking region of the eIF4A gene from the NCBI genome database (http://www.ncbi.nlm.nih.gov/) and found two DREs and one DRE-like sequence. We named these sites DRE1 (−40 to − 47), DRE2 (−48 to −55) and DRE3 (−267 to −274), numbered with respect to the transcription initiation site (Fig. 2). DRE1 and DRE3 perfectly match the DRE consensus sequence, 5′TATCGATA, and DRE2, 5′-gATCGATc matches six out of eight DRE nucleotides. It has been reported that stimulatory effects of DRE can be observed at a position within 1.4 kb from the transcription initiation site [9]. Therefore, all three are good candidates as regulatory sites for the eIF4A gene promoter activity.

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 3 ( 2 00 7 ) 4 2 0 8 –42 2 0

4213

Roles of DRE sites in the function of the eIF4A gene promoter in cultured cells To investigate whether DREF regulates gene expression via DRE, we constructed the eIF4A gene promoter–luciferase fusion plasmid and derivatives carrying mutations in one or more of DRE1, DRE2 and DRE3. These plasmids were transfected into Kc cells, and 48 h later, luciferase activities were determined (Fig. 3). Mutation in DRE1 (DREmut1) almost completely abolished the promoter activity, as was also the case with mutations in both DRE1 and DRE3 (DRE1, 3), DRE1 and DRE2 (DRE1, 2) and in all DREs (DREmut all). Mutation in DRE2 (DREmut2) reduced the promoter activity by only 24% and that in DRE3 (DREmut3) by 75%. The promoter region carrying mutations in both DRE2 and DRE3 (DREmut2, 3) still retained 16% of the wild type activity. These results indicate that DRE1 is essential for the eIF4A gene promoter activity and DRE3 is also required for the full promoter activity. DRE2 appears to play a more minor role.

Roles of DRE sites in the eIF4A gene promoter activity in living flies

Fig. 1 – Genetic interactions between eIF4A and DREF. Half reduction of the eIF4A gene dose suppressed the DREF-induced rough eye phenotype. (A) Scanning electron micrographs of adult compound eyes. (a, b) GMR-GAL4/+; UAS-DREF/+, (c, d) GMR-GAL4/+; UAS-DREF/P{PZ}eIF-4a02439 cn1, a strain with half reduction of the eIF4A gene dose. (B) Overexpression of DREF protein with the GMR promoter. Immunostaining of eye imaginal discs with mixtures of anti-DREF monoclonal antibodies 1, 3 and 4 are shown. (a) GMR-GAL4/+; UAS-DREF/+. (b) GMR-GAL4/+; UAS-DREF/P{PZ}eIF-4a02439 cn1. MF, morphogenetic furrow.

Although the results of luciferase transient expression assay in Kc cells clearly demonstrate essential roles of at least two of the DRE sites for the eIF4A gene promoter activity, these observations are needed to be confirmed in living flies, and transgenic Drosophila provides an appropriate system to characterize transcriptional regulatory elements in vivo [39,40]. We therefore established transgenic flies carrying the eIF4A gene promoter and nuclear targeted lacZ fusion gene (5′-436eIF4awt-LacZ) or its DRE mutant derivative, 5′-436eIF4amutDREall-LacZ (Fig. 4A and Table 1). Male transgenic flies were crossed with wild type females and expression levels of the LacZ in the tissues at various developmental stages were examined by immunostaining with anti-β-galactosidase antibody (Fig. 4B). Staining signals were detected in nuclei of various tissues, such as salivary glands (Fig. 4B, panel a), eye– antenna imaginal discs (Fig. 4B, panel c), brain lobes (Fig. 4B, panel e), and midintestines (data not shown) in the third instar larvae carrying 5′-436eIF4awt-LacZ transgene. In testes of adult flies carrying the 5′-436eIF4awt-LacZ transgene, strong expression of lacZ in nuclei of cells in the germinal proliferation center at the apical tip was observed (Fig. 4B, panel g and its inset). In ovaries, strong expression of lacZ in polytenizing nurse cell nuclei was detected (Fig. 4B, panel i). However, in flies carrying 5′-436eIF4amutDREall-LacZ transgene, no staining signal was detected in these tissues (Fig. 4B, panels b, d, f, h and j). The results indicate that DRE sequences are essential for the eIF4A gene promoter activity in vivo.

DREF binds to the genomic region containing DRE and DRE-like sequences of the eIF4A gene To examine whether DREF is located in the chromosomal region containing the eIF4A gene, we carried out immunostaining of salivary gland polytene chromosomes in third instar larvae with anti-DREF monoclonal antibodies. DREF signals were detected in a number of discrete regions throughout the polytene chromosomes [15]. Careful inspection allowed the mapping of signals for DREF at the eIF4A gene locus, 26B2, on

4214

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 3 ( 2 00 7 ) 4 2 0 8 –42 2 0

Fig. 2 – Schematic of DRE sites in the 5′-flanking region of the eIF4A gene. The three potential DRE sites in the eIF4A gene promoter, termed DRE1, DRE2 and DRE3, are shown. The transcription initiation site is indicated by the arrow and designated as +1. Arrowheads indicate positions of the primers used for the chromatin immunoprecipitation assays. Bold bars correspond to probes used for band mobility shift assays.

the 2L chromosome (data not shown), suggesting that DREF binds to the genomic region containing the eIF4A gene. However, in this 26B2 band, there are several other genes; chickadee, infertile crescent, little imaginal discs, Tetraspanin 26A, βgalactosidase, CG9098 and Homeodomain protein 2.0. Although little imaginal discs, Tetraspanin 26A, β-galactosidase genes and CG9098 do not carry DRE-like sequences within the 1.5 kb upstream region, chickadee, infertile crescent and Homeodomain protein 2.0 carry DRE-like sequences. Therefore we cannot conclude from these data that the observed DREF signal at 26B2 band represents binding of DREF to the eIF4A gene locus.

To further examine DREF binding to the DRE1-, DRE2- and DRE3-containing region of the eIF4A gene, primers to amplify the region from −124 to + 15 (Fig. 2) were chemically synthesized and used for chromatin immunoprecipitation assays with anti-DREF polyclonal antibody. It is well known that the Drosophila PCNA gene is regulated by the DREF pathway [1,12,13]. Amplification of the PCNA gene promoter region containing the DRE in the immunoprecipitates with the antiDREF polyclonal antibody was 62.4-fold that with the control rabbit IgG (Fig. 5). In contrast, no amplification of the Actin 5C gene region was observed (Fig. 5). Amplification of the eIF4A

Fig. 3 – Effects of mutations in DRE sites in the 5′-flanking region of the eIF4A gene on promoter activity in cultured cells. Schematic features of the eIF4A gene promoter–luciferase fusion plasmids are illustrated. The wild type DRE sites are shown with open boxes. Closed boxes indicate the mutated sites (DRE1, 5′-TATCGATA; DRE1mut, 5′-TcgCGAcg; DRE2, 5′-gATCGATc; DRE2mut, 5′-gcgCGAcc; DRE3, 5′-TATCGATA; DRE3mut, 5′-TcgCGAcg, small letters indicate the mutated nucleotides). Transfections were performed with Kc cells and promoter activity measured as luciferase activity. Mean values with standard deviations from three independent transfections are shown. DREmut all, p5′-436peIF4amutDREall-luc; DREmut1,3, p5′-436peIF4amutDRE1,3-luc; DREmut1,2, p5′-436peIF4amutDRE1,2-luc; DREmut2,3, p5′-436peIF4amutDRE2,3-luc; DREmut1, p5′-436peIF4amutDRE1-luc; DREmut2, p5′-436peIF4amutDRE2-luc; DREmut3, 5′-436peIF4amutDRE3-luc, wt, p5′-436eIF4awt-luc.

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 3 ( 2 00 7 ) 4 2 0 8 –42 2 0

4215

gene promoter region containing the DRE1, 2 and 3 in the immunoprecipitates with anti-DREF polyclonal antibody was 72-fold (Fig. 5). These results indicate that DREF binds to the

Fig. 5 – Examination of DREF-binding in the 5′-flanking region of the eIF4A gene by chromatin immunoprecipitation. The data shown are derived from quantitative real-time PCR analysis of the eIF4A gene promoter, the PCNA gene promoter or the Act5C gene, shown at the bottom. Chromatin from S2 cells was immunoprecipitated with either anti-DREF IgG or control rabbit IgG. The fold different values are from comparison of the anti-DREF immunoprecipitated sample (shown as anti-DREF IgG column on chart) with the corresponding control IgG immunoprecipitated sample (control IgG column). A sample without antibody treatment was also included as a negative control (no antibody column).

genomic region containing DRE1, DRE2 and DRE3 of the eIF4A gene in S2 cells.

DREF binds to DRE 1 and 3, but not to DRE 2 in vitro To examine DREF capacity for binding to the DRE sequences in the 5′-flanking region of the eIF4A gene in vitro, oligonucleotides containing the region from DRE1 (−40 to −47), DRE2 (−48 to − 55) and DRE3 (−267 to − 274) (Fig. 2) were chemically synthesized and used for band mobility shift assay. When the oligonucleotides DRE1 or DRE3 were mixed with Kc cell nuclear extracts, specific DNA–protein complexes were

Fig. 4 – Role of DRE sites in the eIF4A gene promoter activity in vivo. (A) Schematic illustration of the eIF4A gene promoter-LacZ fusion gene constructs. DREwt, 5′-436eIF4awt-LacZ; DREmut all, 5′-436eIF4amutDREall-LacZ. (B) Expression of the eIF4A promoter-LacZ fusion gene in various tissues of the transgenic third instar larvae and adults was detected by anti-β-galactosidase immunostaining. (a, c, e, g, i) Salivary gland, eye–antenna disc, brain lobe in the third instar larvae and testis (open box shows proliferation center of a magnification part in the inset), ovary in the adult fly with the wild-type eIF4A gene promoter-NLS-LacZ fusion gene; (b, d, f, h, j) salivary gland, eye–antenna disc, brain lobe in the third instar larvae and testis (open box shows proliferation center of a magnification part in the inset), ovary in the adult fly with the DRE1-, DRE2- and DRE3-mutated eIF4A promoter-NLS-LacZ fusion gene. White bars represent 50 μm.

4216

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 3 ( 2 00 7 ) 4 2 0 8 –42 2 0

detected (Figs. 6A, lane 1 and B, lane 1), which were diminished by adding an excess amount of unlabeled oligonucleotides containing DRE3 (Fig. 6A, lanes 2 and 3), DRE1 (DRE1DRE2M) (Fig. 6B, lanes 8 and 9) and DRE1, 2 (Fig. 6B, lanes 2 and 3) as competitors but not by adding oligonucleotides containing DRE2 (DRE1MDRE2) (Fig. 6B, lanes 6 and 7) or those carrying mutations in both the DRE1 and DRE2 sequences (DRE1,2M) (Fig. 6B, lanes 4 and 5). Furthermore, the specific DNA–protein

complexes were either diminished or super-shifted by adding anti-DREF monoclonal antibodies to the binding reaction (Figs. 6A, lanes 7 to 8 and B, lanes 11 to 12). However, normal mouse IgG exerted no effect on the complex formation (Figs. 6A, lane 6 and B, lane 10). These results indicate that DREF can bind to both DRE1 and DRE3 sequences in the eIF4A gene promoter in vitro, but not to the DRE2 sequence.

Effects of knockdown of the DREF gene on the eIF4A gene promoter activity in cultured cells

Fig. 6 – Complex formation between eIF4A DREs and Kc cell nuclear extracts. 32P-labeled double-stranded oligonucleotides DRE3 (A) or DRE1, 2 (B) as probes were incubated with Kc cell nuclear extracts in the presence of the indicated competitor oligonucleotides or the anti-DREF monoclonal antibodies 1 (Ab1) or 4 (Ab4). The amount of competitors was 100-fold or 400-fold the molar ratio for each probe. The oligonucleotides are: DRE3M having a mutation in the DRE sequence; DRE1,2M having mutations in the DRE sequences of both DRE1 and DRE2; DRE1MDRE2 having a mutation in the DRE1 sequence; DRE1DRE2M having a mutation in the DRE2 sequence. NC: normal mouse IgG used as a negative control.

To further explore the requirement of DREF for the eIF4A gene promoter activity, DREF RNA interference experiments in Drosophila S2 cells were carried out (Fig. 7). Efficiency of knockdown of the DREF gene was monitored by measuring levels of DREF proteins in Drosophila S2 cells after treatment with dsRNA. Western immunoblot analyses with anti-DREF monoclonal antibodies were conducted after treating cells with DREFdsRNA, LacZdsRNA or no dsRNA (no treatment). The results showed DREF dsRNAs to significantly reduce the expression level of DREF proteins, while LacZdsRNA or no treatment exerted no effect (Fig. 7A). To evaluate the function of DREF in the eIF4A gene promoter activity, transient luciferase expression assays were conducted with plasmids carrying the eIF4A gene promoter (−436 to +1) fused with the luciferase reporter gene, after treating Drosophila S2 cells with DREFdsRNA, LacZdsRNA or no dsRNA (no treatment). Treatment of cells with DREFdsRNA reduced the eIF4A gene promoter activity to 51.5%, while LacZdsRNA exerted no effect (Fig. 7C). These results indicate that DREF is required for the eIF4A gene promoter activity. To further confirm reduction of endogenous eIF4A gene expression under these conditions, the level of mRNA was quantified by real-time PCR at 5 days after addition of DREFdsRNA to the cultured S2 cells (Fig. 8). In the experiments, the β-tubulin gene was used as a negative control. DREF mRNA level was reduced to 2% by DREFdsRNA treatment. Treatment of cells with DREFdsRNA reduced the endogenous eIF4A mRNA level to 12%, while LacZdsRNA treatment exerted no effect (Fig. 8). These results further support that DREF is required for the eIF4A gene expression. We previously demonstrated that not only DREF but also Cut can bind to the DRE sequence of the PCNA gene and both transcription factors antagonistically regulate the PCNA gene promoter [41]. We therefore examined the effect of expression of CutdsRNA on the eIF4A gene promoter activity. In spite of the extensive decrease of Cut protein levels in CutdsRNA treated cells (Fig. 7B), no significant effect on the eIF4A gene promoter activity was observed (Fig. 7D). Therefore, Cut does not play a role in the eIF4A gene promoter activity in S2 cells.

Discussion In this study we identified the eIF4A gene as one of the target genes for DREF. eIF4A is a member of the DEAD box family of ATP-dependent RNA helicases [42] and is proposed to function in cap(m7GpppN)-dependent initiation of protein synthesis by

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 3 ( 2 00 7 ) 4 2 0 8 –42 2 0

4217

Fig. 7 – Effects of knockdown of DREF or Cut on the eIF4A gene promoter activity. (A, B) Western immunoblot analysis of cells treated with LacZdsRNA, DREFdsRNA or CutdsRNA. Thirty micrograms each of dsRNAs, LacZdsRNA, DREFdsRNA and CutdsRNA was transfected into S2 cells. As a control, no dsRNA treatment (no treatment) was performed in parallel. Two, four and six days after dsRNA treatment, S2 cells were harvested and subjected to SDS–PAGE and proteins were probed with anti-DREF, anti-Cut and anti-tubulin antibodies. (C, D) Drosophila S2 cells were treated with 3 μg each of LacZdsRNA, DREFdsRNA or CutdsRNA prior to transfection of the reporter plasmid for the eIF4A gene promoter. At 48 h after transfection, cells were harvested and subjected to luciferase assay. Mock indicates no treatment of cells with double-stranded RNA. Luciferase activity was normalized to Renilla luciferase activity and expressed as activity relative to that with mock alone scored as 100. Standard deviations are shown from three independent transfections.

unwinding the secondary structure of 5′-untranslated regions of mRNA [43,44]. eIF4A works in conjunction with eIF4B and eIF4H in this unwinding reaction [45]. It also functions as a subunit of eIF4F, a heterotrimeric protein complex composed

of eIF4A, eIF4E and eIF4G [46], in an important regulatory step of translation initiation [47]. We have searched for DRE sequences in their 5′-flanking regions on the genome database and found that promoters of Drosophila eIF4-related genes such

Fig. 8 – DREFdsRNA reduces eIF4A mRNA level in Drosophila S2 cells. DREF mRNA and eIF4A mRNA in DREFdsRNA-treated cells were measured by quantitative RT-PCR and compared with values for no dsRNA-treated (Mock) cells. The mRNA for β-tubulin was used as a negative control. Mean values with standard deviations from three independent dsRNA transfections are shown.

4218

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 3 ( 2 00 7 ) 4 2 0 8 –42 2 0

as eIF4A, eIF4B, eIF4G and eIF4H all contain DRE or DRE like sequences in their 5′-flanking regions. The eIF4B gene carries two DRE sequences and a DRE like sequence at −2315 to-2308, −2280 to −2373 and −13 to −6, with respect to the transcription initiation site. The eIF4G gene carries a DRE sequence and a DRE like sequence at −480 to −473 and − 13 to − 6. The eIF4H gene carries a DRE sequence and three DRE like sequences at − 2047 to − 2040, −1678 to −1671, −1594 to-1587 and −166 to −159. Therefore, many of the genes involved in translation initiation appear to be regulated by the DRE-DREF pathway. In previous studies, we demonstrated that DREF and Cut, a Drosophila homologue of mammalian CCAAT-displacement protein (CDP)/Cux, antagonistically regulate the PCNA gene [41]. Measurement of the PCNA gene promoter activity by transient luciferase expression assays in Drosophila S2 cells after RNA interference for Cut or DREF showed that DREF activates the PCNA gene promoter while Cut functions as a repressor. The chromatin immunoprecipitation assays in the presence or absence of 20-hydroxyecdysone further showed both DREF and Cut proteins to be localized in the genomic region containing the PCNA gene promoter in S2 cells, especially in the Cut case upon induction of differentiation [41]. However in the case of the eIF4A gene promoter, knockdown of Cut exerted no effect on the promoter activity, although that of DREF decreased it in S2 cells. The PCNA gene promoter region carries transcription factor binding sites such as E2F sites [39], URE (upstream regulatory element) [13], DRE [2,9,12] and the Grainyhead-binding site [48–50]. Since Cut has affinity for both DRE and URE in the PCNA gene promoter, the absence of URE in the eIF4A gene promoter may explain why knockdown of Cut does not up-regulate the eIF4A gene promoter activity. In any event, involvement of Cut in interfering DRE-DREF pathway may depend on each promoter context. Immunostaining with anti-LacZ of fly tissues carrying wild type eIF4a gene promoter-lacZ, 5′-436eIF4awt-LacZ or its DRE mutant derivative 5′-436eIF4amutDREall-LacZ revealed that the DRE sequences in the eIF4A gene promoter are essential for promoter activity in salivary glands, eye imaginal discs, brain lobes, midintestines, ovaries and testes. We could not detect any lacZ signals in embryos (data not shown), although the eIF4A mRNA and the eIF4A protein are ubiquitously detectable [51], suggesting that the examined eIF4A gene promoter region (− 436 to + 1) is missing some promoter elements responsible for zygotic expression of the eIF4A gene during embryogenesis. It would be interesting to identify such a promoter element(s) in the future. It has been reported that DREF regulates DNA replication-, cell cycle-, proliferation- and protein degradation-related genes [52]. We have very recently reported that the DRE-DREF pathway also regulates expression of the skpA gene [38], whose product is responsible for degradation of defective or misfolded proteins. In the present study, we found that DREF further regulates genes involved in translation initiation. The available data suggest that DREF promotes both protein synthesis and protein degradation by activating genes involved in these processes, this presumably being associated with the active protein metabolism typical of proliferating cells.

Acknowledgments We thank Dr. Dean P. Smith for kindly providing the caspernls-LacZ plasmid, Dr. Fumiko Hirose for the anti-DREF monoclonal antibodies and Dr. Malcolm Moore for the advice on English usage on the manuscript. This work was supported in part by grants-in-aid from the Ministry of Education, Science, Sports, Technology and Culture of Japan.

REFERENCES

[1] F. Hirose, M. Yamaguchi, K. Kuroda, A. Omori, T. Hachiya, M. Ikeda, Y. Nishimoto, A. Matsukage, Isolation and characterization of cDNA for DREF, a promoter activating factor for Drosophila DNA replication-related genes, J. Biol. Chem. 271 (1996) 3930–3937. [2] Y. Takahashi, M. Yamaguchi, F. Hirose, S. Cotterill, J. Kobayashi, S. Miyajima, A. Matsukage, DNA replication-related elements cooperate to enhance promoter activity of the Drosophila DNA polymerase α 73-kDa subunit gene, J. Biol. Chem. 271 (1996) 14541–14547. [3] H. Huikeshoven, S. Cotterill, Cloning and characterisation of the gene for the large subunit of the DNA primase from Drosophila melanogaster, Biochim. Biophys. Acta 1445 (1999) 359–362. [4] T. Sawado, F. Hirose, Y. Takahashi, T. Sasaki, T. Shinomiya, K. Sakaguchi, A. Matsukage, M. Yamaguchi, The DNA replication-related element (DRE)/DRE-binding factor system is a transcriptional regulator of the Drosophila E2F gene, J. Biol. Chem. 273 (1998) 26042–26051. [5] K. Ohno, F. Hirose, K. Sakaguchi, Y. Nishida, A. Matsukage, Transcriptional regulation of the Drosophila cycA gene by the DNA replication-related element (DRE) and DRE binding factor (DREF), Nucleic Acids Res. 24 (1996) 3942–3946. [6] N.V. Sharkov, G. Ramsay, A.L. Katzen, The DNA replication-related element-binding factor (DREF) is a transcriptional regulator of the Drosophila myb gene, Gene 297 (2002) 209–219. [7] K. Lightfoot, L. Maltby, R. Duarte, R. Veale, O. Segev, Conserved cis-elements bind a protein complex that regulates Drosophila ras2/rop bidirectional expression, Br. J. Cancer 69 (1994) 264–273. [8] J.R. Ryu, T.Y. Choi, E.J. Kwon, W.H. Lee, Y. Nishida, Y. Hayashi, A. Matsukage, M. Yamaguchi, M.A. Yoo, Transcriptional regulation of the Drosophila-raf protooncogene by the DNA replication-related element (DRE)/DRE-binding factor (DREF) system, Nucleic Acids Res. 24 (1997) 794–799. [9] F. Hirose, M. Yamaguchi, H. Handa, Y. Inomata, A. Matsukage, Novel 8-base pair sequence (Drosophila DNA replication-related element) and specific binding factor involved in the expression of Drosophila genes for DNA polymerase α and proliferating cell nuclear antigen, J. Biol. Chem. 268 (1993) 2092–2099. [10] K. Okudaira, K. Ohno, H. Yoshida, M. Asano, F. Hirose, M. Yamaguchi, Transcriptional regulation of the Drosophila orc2 gene by the DREF pathway, Biochim. Biophys. Acta 1732 (2005) 23–30. [11] A. Tsuchiya, Y.H. Inoue, H. Ida, Y. Kawase, K. Okudaira, K. Ohno, H. Yoshida, M. Yamaguchi, Transcriptional regulation of the Drosophila rfc1 gene by the DRE-DREF pathway, FEBS J. 274 (2007) 1818–1832. [12] M. Yamaguchi, Y. Hayashi, Y. Nishimoto, F. Hirose, A. Matsukage, A nucleotide sequence essential for the function of DRE, a common promoter element for Drosophila

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 3 ( 2 00 7 ) 4 2 0 8 –42 2 0

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

DNA replication-related genes, J. Biol. Chem. 270 (1995) 15808–15814. M. Yamaguchi, F. Hirose, A. Matsukage, Roles of multiple promoter elements of the proliferating cell nuclear antigen gene during Drosophila development, Genes Cells 1 (1996) 47–58. A. Hochheimer, S. Zhou, S. Zheng, M.C. Holmes, R. Tjian, TRF2 associates with DREF and directs promoter-selective gene expression in Drosophila, Nature 420 (2002) 439–445. F. Hirose, N. Ohshima, E.J. Kwon, H. Yoshida, M. Yamaguchi, Drosophila Mi-2 negatively regulates dDREF by inhibiting its DNA-binding activity, Mol. Cell. Biol. 22 (2002) 5182–5193. Y. Hayashi, M. Kato, H. Seto, M. Yamaguchi, Drosophila distal-less negatively regulates dDREF by inhibiting its DNA binding activity, Biochim. Biophys. Acta. 1759 (2006) 359–366. A. Matsukage, F. Hirose, Y. Hayashi, K. Hamada, M. Yamaguchi, The DRE sequence TATCGATA, a putative promoter-activating element for Drosophila melanogaster cell-proliferation-related genes, Gene 166 (1995) 233–236. U. Ohler, G.C. Liao, H. Niemann, G.M. Rubin, Computational analysis of core promoters in the Drosophila genome, Genome Biol. 3 (2002) (research0087.1–0087.12.). H. Jasper, V. Benes, A. Atzberger, S. Sauer, W. Ansorge, D. Bohmann, A genomic switch at the transition from cell proliferation to terminal differentiation in the Drosophila eye, Dev. Cell 3 (2002) 511–521. F. Hirose, M. Yamaguchi, A. Matsukage, Targeted expression of the DNA binding domain of DRE-binding factor, a Drosophila transcription factor, attenuates DNA replication of the salivary gland and eye imaginal disc, Mol. Cell. Biol. 19 (1999) 6020–6028. F. Hirose, N. Ohshima, M. Shiraki, H.Y. Inoue, O. Taguchi, Y. Nishi, A. Matsukage, M. Yamaguchi, Ectopic expression of DREF induced DNA synthesis, apoptosis, and unusual morphogenesis in the Drosophila eye imaginal disc: possible interaction with Polycomb and trithorax group proteins, Mol. Cell. Biol. 21 (2001) 7231–7242. J. Hyun, H. Jasper, D. Bohmann, DREF is required for efficient growth and cell cycle progression in Drosophila imaginal discs, Mol. Cell. Biol. 25 (2005) 5590–5598. H. Yoshida, E. Kwon, F. Hirose, K. Otsuki, M. Yamada, M. Yamaguchi, DREF is required for EGFR signalling during Drosophila wing vein development, Genes Cells 9 (2004) 935–944. M. Galloni, B. Edger, Cell-autonomous and non-autonomous growth-defective mutants of Drosophila melanogaster, Development 126 (1999) 2365–2375. Y. Takahashi, F. Hirose, A. Matsukage, M. Yamaguchi, Identification of three conserved regions in the DREF transcription factors from Drosophila melanogaster and Drosophila virilis, Nucleic Acids Res. 27 (1999) 510–516. M. Yamaguchi, F. Hirose, Y.H. Inoue, M. Shiraki, Y. Hayashi, Y. Nishi, A. Matsukage, Ectopic expression of human p53 inhibits entry into S phase and induces apoptosis in the Drosophila eye imaginal disc, Oncogene 18 (1999) 6767–6775. K. Galindo, D.P. Smith, A large family of divergent Drosophila odorant-binding proteins expressed in gustatory and olfactory sensilla, Genetics 159 (2001) 1059–1072. D.P. Cross, J.H. Sang, Cell culture of individual Drosophila embryos. I. Development of wild type cultures, J. Embryol. Exp. Morphol. 45 (1978) 161–172. M. Yamaguchi, Y. Hayashi, S. Matsuoka, T. Takahashi, A. Matsukage, Differential effect of p53 on the promoters of mouse DNA polymerase β gene and proliferating-cell-nuclear-antigen gene, Eur. J. Biochem. 221 (1994) 227–237.

4219

[30] E.J. Kwon, H.S. Park, Y.S. Kim, E.J. Oh, Y. Nishida, A. Matsukage, M.A. Yoo, M. Yamaguchi, Transcriptional regulation of the Drosophila raf proto-oncogene by Drosophila STAT during development and in immune response, J. Biol. Chem. 275 (2000) 19824–19830. [31] C.A. Worby, N. Simonson-Leff, J.E. Dixon, RNA interference of gene expression (RNAi) in cultured Drosophila cells, Sci. STKE 2001 (2001) PL1. [32] E.J. Kwon, H. Seto, F. Hirose, N. Ohshima, Y. Takahashi, Y. Nishida, M. Yamaguchi, Transcription control of a gene for Drosophila transcription factor, DREF by DRE and cis-elements conserved between Drosophila melanogaster and virilis, Gene 309 (2003) 101–116. [33] T.B. Morrison, J.J. Weis, C.T. Wittwer, Quantification of lowcopy transcripts by continuous SYBR Green I monitoring during amplification, Biotechniques 24 (1998) 954–958 (960, 962). [34] A.C. Spradling, P-element-mediated transformation, in: D.B. Roberts (Ed.), Drosophila: A Practical Approach, IRL Press, Oxford, 1986. [35] H.M. Robertson, C.R. Preston, R.W. Philips, D.M. JohnsonSchlitz, W.K. Benz, W.R. Engels, A stable genomic source of Pelement transposase in Drosophila melanogaster, Genetics 118 (1988) 461–470. [36] B. Zink, Y. Engstrom, W.J. Gehring, R. Paro, Direct interaction of the Polycomb protein with Antennapedia regulatory sequences in polytene chromosomes of Drosophila melanogaster, EMBO J. 10 (1991) 153–162. [37] R.X. Luo, A.A. Postigo, D.C. Dean, Rb interacts with histone deacetylase to repress transcription, Cell 92 (1998) 463–473. [38] D.T. Phuong Thao, H. Ida, H. Yoshida, M. Yamaguchi, Identification of the Drosophila skpA gene as a novel target of the transcription factor DREF, Exp. Cell Res. 312 (2006) 3641–3650. [39] Y.J. Choi, T.Y. Choi, M. Yamaguchi, A. Matsukage, Y.S. Kim, M. A. Yoo, Transcriptional regulation of the Drosophila caudal homeobox gene by DRE/DREF, Nucleic Acids Res. 32 (2004) 3734–3742. [40] M. Yamaguchi, Y. Hayashi, A. Matsukage, Essential role of E2F recognition sites in regulation of the proliferating cell nuclear antigen gene promoter during Drosophila development, J. Biol. Chem. 270 (1995) 25159–25165. [41] H. Seto, Y. Hayashi, E. Kwon, O. Taguchi, M. Yamaguchi, Antagonistic regulation of the Drosophila PCNA gene promoter by DREF and Cut, Genes Cells 11 (2006) 499–512. [42] P. Linder, P.F. Lasko, M. Ashburner, P. Leroy, P.J. Nielsen, K. Nishi, J. Schnier, P.P. Slonimski, Birth of the D-E-A-D box, Nature 337 (1989) 121–122. [43] S. Blum, S.R. Schmid, A. Pause, P. Buser, P. Linder, N. Sonenberg, H. Trachsel, ATP hydrolysis by initiation factor 4A is required for translation initiation in Saccharomyces cerevisiae, Proc. Natl. Acad. Sci. U. S. A. 89 (1992) 7664–7668. [44] T.V. Pestova, V.G. Kolupaeva, I.B. Lomakin, E.V. Pilipenko, I.N. Shatsky, V.I. Agol, C.U. Hellen, Molecular mechanisms of translation initiation in eukaryotes, Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 7029–7036. [45] G.W. Rogers Jr., N.J. Richter, W.F. Lima, W.C. Merrick, Modulation of the helicase activity of eIF4A by eIF4B, eIF4H, and eIF4F, J. Biol. Chem. 276 (2001) 30914–30922. [46] J.A. Grifo, S.M. Tahara, M.A. Morgan, A.J. Shatkin, W.C. Merrick, New initiation factor activity required for globin mRNA translation, J. Biol. Chem. 258 (1983) 5804–5810. [47] T.V. Pestova, I.N. Shatsky, C.U. Hellen, Functional dissection of eukaryotic initiation factor 4F: the 4A subunit and the central domain of the 4G subunit are sufficient to mediate internal entry of 43S preinitiation complexes, Mol. Cell. Biol. 16 (1996) 6870–6878.

4220

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 3 ( 2 00 7 ) 4 2 0 8 –42 2 0

[48] S.J. Bray, B. Burke, N.H. Brown, J. Hirsh, Embryonic expression pattern of a family of Drosophila proteins that interact with a central nervous system regulatory element, Genes Dev. 3 (1989) 1130–1145. [49] B.D. Dynlacht, L.D. Attardi, A. Admon, M. Freeman, R. Tjian, Functional analysis of NTF-1, a developmentally regulated Drosophila transcription factor that binds neuronal cis elements, Genes Dev. 3 (1989) 1677–1688. [50] Y. Hayashi, M. Yamagishi, Y. Nishimoto, O. Taguchi, A. Matsukage, M. Yamaguchi, A binding site for the transcription factor Grainyhead/Nuclear transcription

factor-1 contributes to regulation of the Drosophila proliferating cell nuclear antigen gene promoter, J. Biol. Chem. 274 (1999) 35080–35088. [51] G. Hernandez, V. Lalioti, J. Vandekerckhove, J.M. Sierra, J.F. Santaren, Identification and characterization of the expression of the translation initiation factor 4A (eIF4A) from Drosophila melanogaster, Proteomics 4 (2004) 316–326. [52] P. Masson, J. Lundgren, P. Young, Drosophila proteasome regulator REGgamma: transcriptional activation by DNA replication-related factor DREF and evidence for a role in cell cycle progression, J. Mol. Biol. 327 (2003) 1001–1012.