Identification of the homozygous missense mutation in the lecithin: cholesterol-acyltransferase (LCAT) gene, causing LCAT familial deficiency in two French patients

ATHEROSCLEROSIS Atherosclerosis

105 (1994) 251-252

Short communication

Identification of the homozygous missense mutation in the lecithin:cholesterol-acyltransferase (LCAT) gene, causing LCAT familial deficiency in two French patients Ian Dorval*a,

Pascal Jezequel”, Christde Dubourga, Bruno Chauvel”, Patrick Le Pogampb, Jean-Yves Le Gall”

“Laboratoire de Biochimie MPdicale B, Fact& de Mkdecine 2, Av. du Pr Lkon Bernard, 35043 Rennes. France hService de NPphrologie CHRU Ponchaillou, rue Henr? Lc Guilloux, 35000 Rennes, France

(Received

Key words: LCAT;

Mutation;

and accepted

1993)

Sequencing

As reported previously [I], one of our patients, a 44-year-old woman, had a detailed analysis of the plasma lipid, lipoproteins, apolipoproteins and LCAT activity; the pedigree of this French family indicates consanguinity within the third generation. We report the identification of a T to C homozygote transition at position 2523 in exon 5 of the LCAT gene, causing a leucine to proline change at codon 209 (L209P) that is responsible for this LCAT deficiency. The second case report is a 35-year-old man from the same geographic origin but from another family, apparently not related to that of the first case. The same mutation L209P was previously reported in a third French family from a different geographic origin in France (Jacotot, personal * Corresponding

21 October

author.

002 l-9 150/94/$07.00 0 I994 Elsevier Science Ireland SSDI 002l-9150(93)05169-6

communication) that makes this molecular defect one of the most frequent mutations in French LCAT familial deficiency. These two L209P mutations were characterized by direct sequencing of the six exons and splice junctions after PCR amplification using intron oligonucleotides according to the genomic DNA sequence [2] exon 1 : 5 ’ AAGAAGGCGGAACTGAACCCA 3 ’ and 5 ’ CAGGGTCTGGCGTGGTGCATC 3 ‘, exon 2 and 3 : 5 ’ AATCCAGAGTCCAGAGTGAGG 3’ and 5’ GCTTGGGCCATGCCTGCTGTG 3’, exon 4 : 5’ TGGCAGGTTTGTGTCAGAGGG 3’ and 5’ CTGCGAGCTTGCGGTAGTACT 3’, exon 5 : 5’ AGCTGCCCTGACCCCTTCCAC 3’ and 5’ TGTGAGCAGGAGCCGCATGA 3’, exon 6 : 5’ GCTCCCTGTCCCACCTTGCT 3 ’ and 5 ’ TCTAGTGCCTTCCCTTCAACC 3 ’ The sequencing was carried out using the Sequenase version 2 kit

Ltd. All rights reserved

I. Dorval

et al. /Atherosclerosis

105 (1994)

251-252

(USB) as described [3,4] with the PCR primers after purification of the PCR product on a Chromaspin 100 column (Clontech). Fig. 1 shows that the patient has a missense mutation resulting in a T to C transition at nucleotide 2523. The leucine to proline change is located at residue 209 that is evolutionarily conserved at a homologous position in both rat and mouse LCAT protein. References 1

2

3

Fig. I. Direct PCR product sequencing of exon 5, from a control (c) and from the propositus, showing a T-C nucleotide substitution at position 2523 on the LCAT gene sequence (arrow).

4

Guerin, M., Dolphin, P.J. and Chapman, M.J., Familial lecithin:acyl transferase deficiency: further resolution of lipoprotein particle heterogeneity in the low density interval, Atherosclerosis, 104 (1993) 195. McLean, J., Wion, K., Drayana, D., Fielding, S. and Lawn, R., Human lecithin-cholesterol .,acyltransferase gene: complete gene sequence and site of expression, Nuct. Acids Res., I4 (1986) 9397. Sanger, F., Nicklens, S. and Coulson, A., Sequencing with chain-termination inhibitors, Proc. Natl. Acad. Sci. USA, 74 (1977) 5463. Casanova, J.L., Pannetier, C., Jaulin, C. and Kourilsky, P., Optimal conditions for directly sequencing doublestranded PCR products with sequenase, Nucl. Acids Res., 18 (1990) 4028.