- Email: [email protected]
Identification of the Major Site of in Vitro PKA Phosphorylation in the Polycystin-1 C-Terminal Cytosolic Domain
Biochemical and Biophysical Research Communications 259, 539 –543 (1999) Article ID bbrc.1999.0810, available online at http://www.idealibrary.com on
Identification of the Major Site of in Vitro PKA Phosphorylation in the Polycystin-1 C-Terminal Cytosolic Domain Stephen C. Parnell, Brenda S. Magenheimer, Robin L. Maser, and James P. Calvet 1 Department of Biochemistry and Molecular Biology, University of Kansas Medical Center, Kansas City, Kansas 66160-7421 Received May 3, 1999
Sequence analysis of the C-terminal cytosolic domain of human and mouse polycystin-1 has identified three RxS consensus protein kinase A (PKA) phosphorylation motifs. GST-fusion proteins containing the full-length and truncated C-terminal cytosolic domain of murine polycystin-1 were phosphorylated in vitro by the purified catalytic subunit of PKA. This identified a sequence of 25 amino acids, immediately downstream of a previously identified heterotrimeric G-protein activation sequence, as the major site of PKA phosphorylation. Phosphorylation of wild-type and alanine substituted synthetic peptides containing this motif demonstrated that alanine substitution of serine 4159 largely eliminated phosphorylation. Mutation of this residue in the fusion protein reduced phosphorylation by about 70%, whereas mutation of the other two conserved phosphorylation motifs had little effect. We conclude that serine 4159 is the major site of PKA phosphorylation in the C-terminal cytosolic domain of murine polycystin-1. © 1999 Academic Press
Autosomal dominant polycystic kidney disease (PKD) (1-3) is a common genetic disorder characterized by the growth of fluid-filled cysts from the nephrons and collecting ducts of affected kidneys. Two unlinked genes, PKD1 and PKD2, are responsible for most cases of PKD, with mutations in the PKD1 gene being associated with 85-90% of all cases. Based on sequence analysis, the PKD1 protein, polycystin-1, is thought to be a large, membrane associated glycoprotein (4-8). The protein has a large, N-terminal extracellular region of about 3,000 amino acids, 7-11 membranespanning segments comprising about 1,000 amino acids, and a C-terminal, cytosolic domain of about 225 amino acids in length. The majority of the extracellular portion of polycystin-1 is made up of 16 copies of an 1
Corresponding author. Fax: 913-588-7440. E-mail: jcalvet@ kumc.edu.
80-90 amino acid repeat that adopts an immunoglobulin (Ig)-like fold (9). The extracellular domain also contains a number of other protein motifs (4-8, 10), including two leucine-rich repeats (LRRs) with cysteine-rich flanking regions, a C-type lectin domain, an LDL-A domain, and a region homologous to the sea urchin sperm receptor for egg jelly (11). The presence of these motifs and the topology of the protein suggest that polycystin-1 may function as a plasma membrane receptor, possibly to regulate cell differentiation (12, 13). Consistent with a function as part of a signaling complex, there is evidence that the C-terminal cytosolic domain of polycystin-1 interacts with cellular signaling proteins. These include 14-3-3 adaptor and GEF/GAP family proteins (14-16), and heterotrimeric G-proteins (17). Furthermore, this region of polycystin-1 has been shown to activate the transcription factor AP-1 (18) and to modulate Wnt signaling (19). Protein phosphorylation is a common, reversible, posttranslational modification that can affect protein structure and function (20-23) and numerous cellular processes, including signal transduction cascades. In this paper, we carried out in vitro phosphorylation studies using bacterially expressed polycystin-1 fusion constructs and synthetic peptides to determine if the C-terminal cytosolic domain of polycystin-1 could be phosphorylated by the cyclic AMP-dependent protein kinase, PKA. We show here that S4159 is the major site of PKA phosphorylation in the C-terminal cytosolic domain of murine polycystin-1. This is the first phosphorylation site (for any protein kinase) to be identified in polycystin-1. MATERIALS AND METHODS Fusion proteins. GST fusion proteins were prepared as previously described (17). Point mutations S4156A and S4268A were introduced into the fusion protein via the GeneEditor in vitro SiteDirected Mutagenesis System (Promega) as per the manufacturer’s instructions. The mutation S4159A was introduced by PCR. The cDNA region containing the S4159 site was PCR-amplified from the HT 193 clone (17) using a 59 primer AATGGATCCACTGCCTTCCCGCTCATCCAGGGGCGCCAAG that includes a BamHI site and
539
0006-291X/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.
Vol. 259, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
that would introduce a S4159A mutation, and a 39 primer AATGCTCGAGACCCCCTAGG that would introduce an XhoI site into the 39 untranslated region. The following PCR cycles were used: 3 cycles of melting (94°C, 1 min), annealing (50°C, 2 min), and extension (72°C, 3 min) were followed by 27 cycles with an increased annealing temperature of 60°C. The amplification was completed by a 5 min extension period. The PCR product was cut with BamHI and XhoI and the resulting fragment was ligated into pGEX-4T-1 (Pharmacia Biotech). The resulting construct was cut with BamHI, and a BamHI fragment encoding amino acids 4101-4149 from the template DNA was inserted on the 59 side to produce the S4159A-mutated HT 193. The mutations were verified by DNA sequencing. Synthetic peptides. Synthetic peptides were synthesized using Fmoc chemistry. After cleavage from the column and deprotection, the peptides were precipitated and washed two times using cold ether. Following lyophilization, the peptides were analyzed by C 18 reverse phase-HPLC. The HPLC peak containing each peptide was identified by amino acid analysis and mass spectrometry, and the peptides were purified by C 18 reverse phase-HPLC, collected, and used for subsequent studies. In vitro phosphorylation. GST fusion proteins (0.2-0.5 mg) or synthetic peptides (515 pmol) were incubated at 30°C for 5-10 min in PKA buffer (40 mM Tris-HCl pH 7.4, 20 mM MgOAc, 0.2 mM ATP) with g- 32P-ATP, 3000 Ci/mmol (NEN Life Science Products) in the presence of 6.25-62.5 units of purified, catalytic subunit of PKA (Promega). Reactions were terminated by the addition of Laemmli (fusion proteins) or Tricine (peptides) loading buffer and boiling for 3 min. Reactions were then loaded and electrophoresed on a 4%/12.5% (fusion proteins) SDS-polyacrylamide gel or on a 4%/9.8% (peptides) SDS-polyacrylamide gel as described by Schagger and von Jagow (24). Following electrophoresis, fusion protein gels were subjected to Western blotting as described below or were stained 15 min in Coomassie blue staining solution (0.1% Coomassie Blue R-250, 40% MeOH, 10% acetic acid) followed by 1 hr of destaining in 40% MeOH, 10% acetic acid. Peptide gels were stained 1 hr in Coomassie Blue G-250 staining solution (0.025% Coomassie blue G-250, 20% acetic acid) followed by 1 hr of destaining in 10% acetic acid. Gels were subsequently dried and placed under film for autoradiography. Quantitation. Prior to drying, Coomassie stained gels were placed in a sealable bag and fusion protein content was quantified by scanning densitometry using a Personal Densitometer SI (Molecular Dynamics). Gels were then dried and 32P incorporation was quantified using a PhosphorImager SI (Molecular Dynamics). Polycystin-1 antibody and Western blotting. A 10-amino acid peptide (PNNKVHPSST; peptide-19, Fig. 1) from the C-terminus of mouse polycystin-1 was synthesized as a BSA conjugated antigen peptide. Polycystin-1 specific rabbit antiserum (A19) was produced by Cocalico Biologicals. Following electrophoresis, gels were equilibrated for 30 min with transfer buffer (25 mM Tris, 192 mM glycine, 20% MeOH, 0.01% SDS) and transferred to nitrocellulose for 1 hr at 60 V. Membranes were blocked in TBS/T buffer (10 mM Tris-HCl, pH 7.5, 0.9% NaCl, 0.1% Tween-20) plus 5% nonfat milk, rinsed three times in TBS/T, and incubated with A19 (1:10,000) in TBS/T for 1 hr. After washing three times for 5 min in TBS/T, the blots were incubated with secondary antibody (alkaline phosphatase (AP)-conjugated goat antirabbit IgG at 1:10,000; Sigma) for 30 min, washed four times for 10 min in TBS/T, equilibrated 5 min in AP buffer (100 mM Tris-HCl, pH 9.5, 100 mM NaCl, 5 mM MgCl 2) and developed with BCIP/NBT (Sigma) in AP buffer. Blots were subsequently wrapped in Saran wrap and placed under film for autoradiography.
RESULTS Identification of conserved PKA phosphorylation motifs. To find potential PKA phosphorylation sites in the C-terminal cytosolic domain of polycystin-1, a
FIG. 1. Mouse polycystin-1 C-terminal cytosolic domain. The C-terminal cytosolic domain of the mouse sequence (upper) is shown in comparison to the human sequence (lower). Conserved sequence motifs identified by visual inspection or computer analysis are underlined. Consensus PKA phosphorylation sites (RxS; 25) are boxed, with the potentially phosphorylated residues noted by arrows. The rightward and leftward arrows indicate the starting and ending points, respectively, of the various GST-fusion constructs used in these studies (see Figs. 2, 3, and 5). Peptide-19, which is at the very C-terminus (underlined), was used to generate anti-peptide antibodies.
mouse 39-terminal cDNA clone was sequenced, and conserved regions were identified in the predicted polypeptide by comparison to the human homolog. Figure 1 shows the C-terminal cytosolic domain and the last two transmembrane domains (transmembrane-10 and -11) as predicted in the original 11-membrane spanning models (4-8, 10). Visual inspection revealed three conserved PKA phosphorylation sites conforming to the consensus motif RxS (25). Conserved sequences conforming to this motif included amino acids 41544156 (RSS), 4157-4159 (RGS), and 4266-4268 (RAS). Phosphorylation of the C-terminal cytosolic domain of polycystin-1. To determine if the C-terminal cytosolic domain of murine polycystin-1 can be phosphorylated by PKA, a GST-fusion protein was constructed and expressed in bacteria. The polycystin-1 portion of this construct (see Fig. 1) is comprised of the C-terminal 222 amino acids, starting with L4072 (L, rightward arrow) and ending with the C-terminal threonine. The sequence of this fusion construct (LT 222) and all other constructs used in this study are shown in Fig. 1 by the rightward and leftward arrows. The LT 222 GST-fusion protein was incubated with purified catalytic subunit of PKA (Promega) and g- 32P-ATP. The fusion protein was electrophoresed and detected by Western blotting using antibody A19. Radiolabeled proteins were subsequently detected by autoradiography. As shown in Fig. 2, PKA dependent phosphoryla-
540
Vol. 259, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Phosphorylation of polycystin-1 by PKA. The LT 222 GSTfusion protein (named for its first and last amino acids and its length) is shown at the top. The positions of the G-protein activation domain (stippled box labeled G) and the coiled-coil domain (hatched box labeled coiled-coil) are indicated as points of reference. Polycystin-1 sequence is indicated by the heavy line; non-polycystin-1 sequence is indicated by the narrow double lines. Conserved PKA phosphorylation motifs are indicated by arrows. The LT 222 fusion protein was incubated with g- 32P-ATP in the presence or absence of purified catalytic subunits of PKA (Promega). The protein was electrophoresed and detected by Western blotting (right) with a polycystin-1 specific antibody (A19). The blot was then placed under film for autoradiography (left). The position of phosphorylated fusion protein is indicated by the upper arrow. The lower molecular weight phosphoprotein is probably a degradation product, as this band is immunoreactive with the polycystin-1 antibody. The weakly phosphorylated protein in the GST control is probably autophosphorylated PKA (43). The position of GST is indicated by the lower arrow.
tion was detected in the polycystin-1 fusion protein, whereas GST alone was not phosphorylated. To determine the region of polycystin-1 phosphorylated by PKA, a number of truncated C-terminal constructs (Fig. 3) were made and tested for their ability to be phosphorylated by PKA. As shown in the autoradiograph (Fig. 3), removal of the C-terminal PKA consensus phosphorylation site S4268 (constructs HQ 128 and HA 74) had little effect on polycystin-1 phosphorylation. However, a further C-terminal truncation of 25 amino acids (HD 49), which removed PKA consensus phosphorylation sites S4156 and S4159, eliminated phosphorylation. Likewise, a C-terminal construct lacking these two sites (AT 120) was only weakly phosphorylated. Phosphorylation of polycystin-1 synthetic peptides. Wild-type and alanine substituted synthetic peptides containing the two putative PKA phosphorylation sites S4156 and S4159 were tested for their ability to be phosphorylated by PKA. As shown in Fig. 4, mutation S4156A (M1) had little effect on peptide phosphorylation. However, mutation S4159A (M2) dramatically reduced peptide phosphorylation. As expected, a double mutant (M3) was not phosphorylated at all. PKA phosphorylation of a synthetic peptide containing S4268 was barely detectable (data not shown).
FIG. 3. Phosphorylation of polycystin-1 truncation mutants by PKA. Truncated GST-fusion constructs are named for their first and last amino acids and their length. Conserved PKA phosphorylation motifs are indicated by arrows (see Figs. 1 and 2 for further details). Approximately equimolar amounts of the fusion proteins were labeled as described in Fig. 2, electrophoresed, and detected by autoradiography. The positions of the proteins as determined by Coomassie blue staining (not shown) are indicated by the asterisks.
Analysis of PKA phosphorylation of alanine substituted fusion proteins. To verify that S4159 is the major site of PKA phosphorylation, alanine substituted fusion proteins were generated and tested for their ability to be phosphorylated (Fig. 5). Consistent with the peptide studies, mutation of serines 4156 and 4268 had little effect on the ability of PKA to phosphorylate polycystin-1. However, mutation S4159A reduced fusion protein phosphorylation 71%. These data demonstrate that S4159 is the major site of PKA phosphorylation in the polycystin-1 C-terminal cytosolic domain. DISCUSSION Identification of a particular protein as a kinase substrate in vitro is a common step towards understanding
FIG. 4. Phosphorylation of wild-type and alanine substituted polycystin-1 synthetic peptides. Polycystin-1 wild-type and mutant peptides corresponding to murine residues 4150-4164 were synthesized and phosphorylated under conditions identical to those used for fusion proteins. Possible PKA phosphorylation sites are indicated by arrows. Modifications for electrophoresis and Coomassie blue staining are described in Materials and Methods. An autoradiograph showing the phosphorylation results is shown at the bottom. Approximately equimolar amounts of peptide were loaded on this gel.
541
Vol. 259, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 5. Phosphorylation of wild-type and alanine substituted polycystin-1 fusion proteins. (A) Point mutants are named for their parent construct and the precise site of serine to alanine mutation with respect to murine polycystin-1. Alanine substitution is indicated by the removal of these arrows in the various HT 193 mutants. (B) Equimolar amounts of the various proteins were phosphorylated and detected by autoradiography (top) as before. The position of the fusion proteins is indicated by the arrow. This autoradiograph is representative of three different trials. Protein phosphorylation was quantitated by the PhosphorImager and corrected for protein loading. Phosphorylation amounts are plotted (bottom) relative to wildtype. This graph represents the averages of three experiments with error bars indicating standard deviation.
that protein’s function. Frequently, these in vitro findings are of physiological significance (26-28). A search for consensus PKA phosphorylation motifs in the C-terminal cytosolic domain of human and mouse polycystin-1 identified three conserved and several non-conserved sites conforming to the RxS sequence motif (25). In vitro labeling experiments using synthetic peptides, GST-fusion proteins, and purified catalytic subunits of PKA confirmed that one of these sites, S4159, is the major site of PKA phosphorylation, as mutation of this residue (S4159A) reduced PKA phosphorylation approximately 70% (the corresponding site in human polycystin-1 is S4168; see Fig. 1). The fact that the S4159A mutation reduced phosphorylation to about 30% of the wild-type sequence, suggests that there may be secondary PKA phosphorylation sites. However, since it is likely that they are not conserved in human polycystin-1, they may not be
functionally significant. Polycystin-1 may also be phosphorylated by kinases other than PKA. Conservation of putative tyrosine phosphorylation sites (17) and phosphorylation of the C-terminal cytosolic domain of murine polycystin-1 by PKC (29) suggests that other phosphorylation events may also play a role in polycystin-1 function. PKA phosphorylation plays a central role in the regulation of a number of cellular processes. The activities of a number of voltage-gated and ligand-gated ion channels are controlled by PKA phosphorylation, including the CFTR protein (23), the ATP-sensitive K 1 channel (K ATP) (20), and the inwardly rectifying K 1 channel, ROMK (21). It has also been established that PKA phosphorylation plays a critical role in the control of G-protein coupled receptors. Heterologous desensitization of agonist-stimulated and non-stimulated receptors involves phosphorylation by the second messenger-dependent kinases PKA and PKC (30). PKA phosphorylation, in addition to promoting heterologous desensitization, plays a central role in receptor “signalswitching.” Many G-protein coupled receptors, such as the b-adrenergic receptor (b-AR) are capable of binding different classes of G-proteins (31-34). PKA phosphorylation of a specific site in the b-AR reduces receptor-Gs signaling and promotes Gi coupling (22, 35). This so-called “signal-switching” serves as a direct feedback inhibition of Gs-mediated pathways, and initiates a Gi-mediated response. We have recently demonstrated that the C-terminal cytosolic domain of polycystin-1 binds and activates heterotrimeric G-proteins in vitro (17). Thus, it is attractive to hypothesize that PKA phosphorylation of polycystin-1 may regulate G-protein binding and signaling. The minimal G-protein binding domain was defined as the amino acid residues contained in the GST-fusion protein HA 74 (Figs. 1 and 3). This region of polycystin-1 is highly conserved in mouse and human (having 93% identity and 96% similarity) and contains a consensus G-protein activation motif flanked by the S4159 PKA phosphorylation site (Fig. 1). Removal of 25 amino acids from this minimal domain, including the PKA phosphorylation site, eliminated G-protein binding. We propose that polycystin-1 acts as a G-protein coupled receptor whose activity is modulated by PKA phosphorylation. The connections between cAMP and PKD, cAMP and PKA activation, and polycystin-1 and Gi suggest a connection between polycystin-1 and cAMP. Agonists of cAMP have been shown to promote cyst growth via stimulation of transepithelial fluid secretion and proliferation in established renal cell lines (36). Furthermore, in cystic cpk mice, antagonists of the arginine vasopressin-V2 receptor, which stimulates cAMP production, slowed cyst enlargement and decreased azotemia (37). The ability of polycystin-1 to be phosphorylated by PKA may represent a mechanism
542
Vol. 259, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
whereby intracellular cAMP levels are detected and regulated. High cAMP levels may promote PKA phosphorylation of polycystin-1 and cause a subsequent down-regulation of cAMP levels, potentially via a Gimediated pathway. Most mutations in the PKD1 gene lead to premature protein truncation (38), and there is increasing evidence that PKD is the result of a two-hit mechanism (39-41) whereby the normal allele is inactivated. As such, affected cells may lack or have significantly reduced polycystin-1 levels, rendering them unable to properly sense and regulate cAMP levels. Such a mechanism might explain the elevated cAMP levels that are observed in PKD kidneys (42). ACKNOWLEDGMENTS We gratefully acknowledge Dr. G. Germino (Johns Hopkins University) for the mouse polycystin-1 cDNA clone and Bo Wisdom (KUMC Biotechnology Support Facility) for synthesis and purification of peptides. This research was supported by NIH Grant DK51047 (JPC), grants from the Polycystic Kidney Research Foundation (JPC and RLM), and a Kansas Health Foundation Predoctoral Fellowship (SCP).
REFERENCES 1. Watson, M. L., and Torres, V. E. (Eds.) (1996) Polycystic Kidney Disease, Oxford University Press, Oxford. 2. Grantham, J. J. (1997) Kidney Int. Suppl. 63, S93–S97. 3. Torres, V. E. (1998) Curr. Opin. Nephrol. Hypertens. 7, 159 –169. 4. The European Polycystic Kidney Disease Consortium (1994) Cell 77, 881– 894. 5. Burn, T. C., Connors, T. D., Dackowski, W. R., Petry, L. R., Van Raay, T. J., Millholland, J. M., Venet, M., Miller, G., Hakim, R. M., Landes, G. M., Klinger, K. W., Quian, F., Onuchic, L. F., Watnick, T., Germino, G. G., and Doggett, N. A. (1995) Hum. Mol. Genet. 4, 575–582. 6. The International Polycystic Kidney Disease Consortium. (1995) Cell 81, 289 –298. 7. Hughes, J., Ward, C. J., Peral, B., Aspinwall, R., Clark, K., San Millan, J. L., Gamble, V., and Harris, P. C. (1995) Nat. Genet. 10, 151–160. 8. Harris, P. C., Ward, C. J., Peral, B., and Hughes, J. (1995) J. Am. Soc. Nephrol. 6, 1125–1133. 9. Bycroft, M., Bateman, A., Clarke, J., Hamill, S. J., Sandford, R., Thomas, R. L., and Chothia, C. (1999) EMBO J. 18, 297–305. 10. Lohning, C., Pohlschmidt, M., Glucksmann-Kuis, M. A., Duyk, G., Bork, P., Schneider, M. O., Reeders, S. T., and Frischauf, A. M. (1996) Nephrol. Dial. Transplant. 11(Suppl. 6), 2– 4. 11. Moy, G. W., Mendoza, L. M., Schulz, J. R., Swanson, W. J., Glabe, C. G., and Vacquier, V. D. (1996) J. Cell Biol. 133, 809 – 817. 12. Calvet, J. P. (1993) Kidney Int. 43, 101–108. 13. Carone, F. A., Bacallao, R., and Kanwar, Y. S. (1994) Lab. Invest. 70, 437– 448. 14. Kim, K., Sharma, C. P., and Arnaout, M. A. (1997) J. Am. Soc. Nephrol. 8, 375A. 15. Kim, E., Arnould, T., and Walz, G. (1997) J. Am. Soc. Nephrol. 8, 375A. 16. Qian, F., Germino, J., Zhang, X. B., and Germino, G. G. (1997) J. Am. Soc. Nephrol. 8, 380A.
17. Parnell, S. C., Magenheimer, B. S., Maser, R. L., Rankin, C. A., Smine, A., Okamoto, T., and Calvet, J.P. (1998) Biochem. Biophys. Res. Commun. 251, 625– 631. 18. Arnould, T., Kim, E., Tsiokas, L., Jochimsen, F., Gruning, W., Chang, J. D., and Walz, G. (1998) J. Biol. Chem. 273, 6013– 6018. 19. Kim, E., Arnould, T., Sellin, L. K., Benzing, T., Fan, M. J., Gruning, W., Sokol, S. Y., Drummond, I., and Walz, G. (1999) J. Biol. Chem. 274, 4947– 4953. 20. Wang, W., and Giebisch, G. (1991) J. Gen. Physiol. 98, 35– 61. 21. Xu, Z.-C., Yang, Y., and Hebert, S.C. (1996) J. Biol. Chem. 271, 9313–9319. 22. Daaka, Y., Luttrell, L. M., and Lefkowitz, R. J. (1997) Nature 390, 88 –91. 23. Gadsby, D. C., and Nairn, A. C. (1999) Physiol. Rev. 79, S77– S107. 24. Schagger, H., and von Jagow, G. (1987) Anal. Biochem. 166, 368 –379. 25. Pearson, R. B., and Kemp, B. E. (1991) Methods Enzymol. 200, 62– 81. 26. Ben-Levy, R., Leighton, I. A., Doza, Y. N, Attwood, P., Morrice N., Marshall, C. J., and Cohen, P. (1995) EMBO J. 23, 5920 – 5930. 27. Montminy, M. (1997) Annu. Rev. Biochem. 66, 807– 822. 28. Zhou, J., Huynh, Q. K., Hoffman, R. T., Crook, E. D., Daniels, M. C., Gulve, E. A., and McClain, D. A. (1998) Diabetes 47, 1836 –1840. 29. Parnell, S. C., and Calvet, J. P. (1997) J. Am. Soc. Nephrol. 8, 378A. 30. Chuang, T. T., Iacovelli, L., Sallese, M., and De Blasi, A. (1996) Trends Pharmacol. Sci. 17, 416 – 421. 31. Abramson, S., N., Martin, M. W., Hughes, A. R., Harden, T. K., Neve, K. A., Barrett, D. A., and Molinoff, P. B. (1988) Biochem. Pharmacol. 37, 4289 – 4297. 32. Xiao, R.P., Ji, X. W., and Lakatta, E. G. (1995) Mol. Pharmacol. 47, 322–329. 33. Herrlich, A., Kuhn, B., Grosse, R., Schmid, A., Schultz, G., and Gudermann, T. (1996). J. Biol. Chem. 271, 16764 –16772. 34. Laugwitz, K. L., Allgeier, A., Offermans, S., Spicher, K., Van Sande, J., Dumont, J. E., and Schultz, G. (1996) Proc. Natl. Acad. Sci. USA 93, 116 –120. 35. Okamoto, T., Murayama, Y., Hayashi, Y., Inagaki, M., Ogata, E., and Nishimoto, I. (1991) Cell 67, 723–730. 36. Mangoo-Karim, R., Uchic, M. E., Grant, M., Shumate, W. A., Calvet, J. P., Park, C. H., and Grantham, J. J. (1989) FASEB J. 3, 2629 –2632. 37. Gattone, V. H., Maser, R. L., Tian, C., Rosenberg, J. M., and Branden, M. G. (1999) Dev. Genet. 24, 1–10. 38. Calvet, J. P. (1998) J. Nephrol. 11, 24 –34. 39. Qian, F., Watnick, T. J., Onuchic, L. F., and Germino, G. G. (1996) Cell 87, 979 –987. 40. Brasier, J. L., and Henske, E. P. (1997) J. Clin. Invest. 99, 194 –199. 41. Koptides, M., Constantinides, R., Kyriakides, G., Hadjigavriel, M., Patsalis, P. C., Pierides, A., and Deltas, C. C. (1998) Hum. Genet. 103, 709 –717. 42. Yamaguchi, T., Nagao, S., Kasahara, M., Takahashi, H., and Grantham, J. J. (1997) Am. J. Kidney Dis. 30, 703–709. 43. Steinberg, R. A., Cauthron, R. D., Symcox, M. M., and Shuntoh, H. (1993) Mol. Cell. Biol. 13, 2332–2341.
543
Identification of the Major Site of in Vitro PKA Phosphorylation in the Polycystin-1 C-Terminal Cytosolic Domain Stephen C. Parnell, Brenda S. Magenheimer, Robin L. Maser, and James P. Calvet 1 Department of Biochemistry and Molecular Biology, University of Kansas Medical Center, Kansas City, Kansas 66160-7421 Received May 3, 1999
Sequence analysis of the C-terminal cytosolic domain of human and mouse polycystin-1 has identified three RxS consensus protein kinase A (PKA) phosphorylation motifs. GST-fusion proteins containing the full-length and truncated C-terminal cytosolic domain of murine polycystin-1 were phosphorylated in vitro by the purified catalytic subunit of PKA. This identified a sequence of 25 amino acids, immediately downstream of a previously identified heterotrimeric G-protein activation sequence, as the major site of PKA phosphorylation. Phosphorylation of wild-type and alanine substituted synthetic peptides containing this motif demonstrated that alanine substitution of serine 4159 largely eliminated phosphorylation. Mutation of this residue in the fusion protein reduced phosphorylation by about 70%, whereas mutation of the other two conserved phosphorylation motifs had little effect. We conclude that serine 4159 is the major site of PKA phosphorylation in the C-terminal cytosolic domain of murine polycystin-1. © 1999 Academic Press
Autosomal dominant polycystic kidney disease (PKD) (1-3) is a common genetic disorder characterized by the growth of fluid-filled cysts from the nephrons and collecting ducts of affected kidneys. Two unlinked genes, PKD1 and PKD2, are responsible for most cases of PKD, with mutations in the PKD1 gene being associated with 85-90% of all cases. Based on sequence analysis, the PKD1 protein, polycystin-1, is thought to be a large, membrane associated glycoprotein (4-8). The protein has a large, N-terminal extracellular region of about 3,000 amino acids, 7-11 membranespanning segments comprising about 1,000 amino acids, and a C-terminal, cytosolic domain of about 225 amino acids in length. The majority of the extracellular portion of polycystin-1 is made up of 16 copies of an 1
Corresponding author. Fax: 913-588-7440. E-mail: jcalvet@ kumc.edu.
80-90 amino acid repeat that adopts an immunoglobulin (Ig)-like fold (9). The extracellular domain also contains a number of other protein motifs (4-8, 10), including two leucine-rich repeats (LRRs) with cysteine-rich flanking regions, a C-type lectin domain, an LDL-A domain, and a region homologous to the sea urchin sperm receptor for egg jelly (11). The presence of these motifs and the topology of the protein suggest that polycystin-1 may function as a plasma membrane receptor, possibly to regulate cell differentiation (12, 13). Consistent with a function as part of a signaling complex, there is evidence that the C-terminal cytosolic domain of polycystin-1 interacts with cellular signaling proteins. These include 14-3-3 adaptor and GEF/GAP family proteins (14-16), and heterotrimeric G-proteins (17). Furthermore, this region of polycystin-1 has been shown to activate the transcription factor AP-1 (18) and to modulate Wnt signaling (19). Protein phosphorylation is a common, reversible, posttranslational modification that can affect protein structure and function (20-23) and numerous cellular processes, including signal transduction cascades. In this paper, we carried out in vitro phosphorylation studies using bacterially expressed polycystin-1 fusion constructs and synthetic peptides to determine if the C-terminal cytosolic domain of polycystin-1 could be phosphorylated by the cyclic AMP-dependent protein kinase, PKA. We show here that S4159 is the major site of PKA phosphorylation in the C-terminal cytosolic domain of murine polycystin-1. This is the first phosphorylation site (for any protein kinase) to be identified in polycystin-1. MATERIALS AND METHODS Fusion proteins. GST fusion proteins were prepared as previously described (17). Point mutations S4156A and S4268A were introduced into the fusion protein via the GeneEditor in vitro SiteDirected Mutagenesis System (Promega) as per the manufacturer’s instructions. The mutation S4159A was introduced by PCR. The cDNA region containing the S4159 site was PCR-amplified from the HT 193 clone (17) using a 59 primer AATGGATCCACTGCCTTCCCGCTCATCCAGGGGCGCCAAG that includes a BamHI site and
539
0006-291X/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.
Vol. 259, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
that would introduce a S4159A mutation, and a 39 primer AATGCTCGAGACCCCCTAGG that would introduce an XhoI site into the 39 untranslated region. The following PCR cycles were used: 3 cycles of melting (94°C, 1 min), annealing (50°C, 2 min), and extension (72°C, 3 min) were followed by 27 cycles with an increased annealing temperature of 60°C. The amplification was completed by a 5 min extension period. The PCR product was cut with BamHI and XhoI and the resulting fragment was ligated into pGEX-4T-1 (Pharmacia Biotech). The resulting construct was cut with BamHI, and a BamHI fragment encoding amino acids 4101-4149 from the template DNA was inserted on the 59 side to produce the S4159A-mutated HT 193. The mutations were verified by DNA sequencing. Synthetic peptides. Synthetic peptides were synthesized using Fmoc chemistry. After cleavage from the column and deprotection, the peptides were precipitated and washed two times using cold ether. Following lyophilization, the peptides were analyzed by C 18 reverse phase-HPLC. The HPLC peak containing each peptide was identified by amino acid analysis and mass spectrometry, and the peptides were purified by C 18 reverse phase-HPLC, collected, and used for subsequent studies. In vitro phosphorylation. GST fusion proteins (0.2-0.5 mg) or synthetic peptides (515 pmol) were incubated at 30°C for 5-10 min in PKA buffer (40 mM Tris-HCl pH 7.4, 20 mM MgOAc, 0.2 mM ATP) with g- 32P-ATP, 3000 Ci/mmol (NEN Life Science Products) in the presence of 6.25-62.5 units of purified, catalytic subunit of PKA (Promega). Reactions were terminated by the addition of Laemmli (fusion proteins) or Tricine (peptides) loading buffer and boiling for 3 min. Reactions were then loaded and electrophoresed on a 4%/12.5% (fusion proteins) SDS-polyacrylamide gel or on a 4%/9.8% (peptides) SDS-polyacrylamide gel as described by Schagger and von Jagow (24). Following electrophoresis, fusion protein gels were subjected to Western blotting as described below or were stained 15 min in Coomassie blue staining solution (0.1% Coomassie Blue R-250, 40% MeOH, 10% acetic acid) followed by 1 hr of destaining in 40% MeOH, 10% acetic acid. Peptide gels were stained 1 hr in Coomassie Blue G-250 staining solution (0.025% Coomassie blue G-250, 20% acetic acid) followed by 1 hr of destaining in 10% acetic acid. Gels were subsequently dried and placed under film for autoradiography. Quantitation. Prior to drying, Coomassie stained gels were placed in a sealable bag and fusion protein content was quantified by scanning densitometry using a Personal Densitometer SI (Molecular Dynamics). Gels were then dried and 32P incorporation was quantified using a PhosphorImager SI (Molecular Dynamics). Polycystin-1 antibody and Western blotting. A 10-amino acid peptide (PNNKVHPSST; peptide-19, Fig. 1) from the C-terminus of mouse polycystin-1 was synthesized as a BSA conjugated antigen peptide. Polycystin-1 specific rabbit antiserum (A19) was produced by Cocalico Biologicals. Following electrophoresis, gels were equilibrated for 30 min with transfer buffer (25 mM Tris, 192 mM glycine, 20% MeOH, 0.01% SDS) and transferred to nitrocellulose for 1 hr at 60 V. Membranes were blocked in TBS/T buffer (10 mM Tris-HCl, pH 7.5, 0.9% NaCl, 0.1% Tween-20) plus 5% nonfat milk, rinsed three times in TBS/T, and incubated with A19 (1:10,000) in TBS/T for 1 hr. After washing three times for 5 min in TBS/T, the blots were incubated with secondary antibody (alkaline phosphatase (AP)-conjugated goat antirabbit IgG at 1:10,000; Sigma) for 30 min, washed four times for 10 min in TBS/T, equilibrated 5 min in AP buffer (100 mM Tris-HCl, pH 9.5, 100 mM NaCl, 5 mM MgCl 2) and developed with BCIP/NBT (Sigma) in AP buffer. Blots were subsequently wrapped in Saran wrap and placed under film for autoradiography.
RESULTS Identification of conserved PKA phosphorylation motifs. To find potential PKA phosphorylation sites in the C-terminal cytosolic domain of polycystin-1, a
FIG. 1. Mouse polycystin-1 C-terminal cytosolic domain. The C-terminal cytosolic domain of the mouse sequence (upper) is shown in comparison to the human sequence (lower). Conserved sequence motifs identified by visual inspection or computer analysis are underlined. Consensus PKA phosphorylation sites (RxS; 25) are boxed, with the potentially phosphorylated residues noted by arrows. The rightward and leftward arrows indicate the starting and ending points, respectively, of the various GST-fusion constructs used in these studies (see Figs. 2, 3, and 5). Peptide-19, which is at the very C-terminus (underlined), was used to generate anti-peptide antibodies.
mouse 39-terminal cDNA clone was sequenced, and conserved regions were identified in the predicted polypeptide by comparison to the human homolog. Figure 1 shows the C-terminal cytosolic domain and the last two transmembrane domains (transmembrane-10 and -11) as predicted in the original 11-membrane spanning models (4-8, 10). Visual inspection revealed three conserved PKA phosphorylation sites conforming to the consensus motif RxS (25). Conserved sequences conforming to this motif included amino acids 41544156 (RSS), 4157-4159 (RGS), and 4266-4268 (RAS). Phosphorylation of the C-terminal cytosolic domain of polycystin-1. To determine if the C-terminal cytosolic domain of murine polycystin-1 can be phosphorylated by PKA, a GST-fusion protein was constructed and expressed in bacteria. The polycystin-1 portion of this construct (see Fig. 1) is comprised of the C-terminal 222 amino acids, starting with L4072 (L, rightward arrow) and ending with the C-terminal threonine. The sequence of this fusion construct (LT 222) and all other constructs used in this study are shown in Fig. 1 by the rightward and leftward arrows. The LT 222 GST-fusion protein was incubated with purified catalytic subunit of PKA (Promega) and g- 32P-ATP. The fusion protein was electrophoresed and detected by Western blotting using antibody A19. Radiolabeled proteins were subsequently detected by autoradiography. As shown in Fig. 2, PKA dependent phosphoryla-
540
Vol. 259, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Phosphorylation of polycystin-1 by PKA. The LT 222 GSTfusion protein (named for its first and last amino acids and its length) is shown at the top. The positions of the G-protein activation domain (stippled box labeled G) and the coiled-coil domain (hatched box labeled coiled-coil) are indicated as points of reference. Polycystin-1 sequence is indicated by the heavy line; non-polycystin-1 sequence is indicated by the narrow double lines. Conserved PKA phosphorylation motifs are indicated by arrows. The LT 222 fusion protein was incubated with g- 32P-ATP in the presence or absence of purified catalytic subunits of PKA (Promega). The protein was electrophoresed and detected by Western blotting (right) with a polycystin-1 specific antibody (A19). The blot was then placed under film for autoradiography (left). The position of phosphorylated fusion protein is indicated by the upper arrow. The lower molecular weight phosphoprotein is probably a degradation product, as this band is immunoreactive with the polycystin-1 antibody. The weakly phosphorylated protein in the GST control is probably autophosphorylated PKA (43). The position of GST is indicated by the lower arrow.
tion was detected in the polycystin-1 fusion protein, whereas GST alone was not phosphorylated. To determine the region of polycystin-1 phosphorylated by PKA, a number of truncated C-terminal constructs (Fig. 3) were made and tested for their ability to be phosphorylated by PKA. As shown in the autoradiograph (Fig. 3), removal of the C-terminal PKA consensus phosphorylation site S4268 (constructs HQ 128 and HA 74) had little effect on polycystin-1 phosphorylation. However, a further C-terminal truncation of 25 amino acids (HD 49), which removed PKA consensus phosphorylation sites S4156 and S4159, eliminated phosphorylation. Likewise, a C-terminal construct lacking these two sites (AT 120) was only weakly phosphorylated. Phosphorylation of polycystin-1 synthetic peptides. Wild-type and alanine substituted synthetic peptides containing the two putative PKA phosphorylation sites S4156 and S4159 were tested for their ability to be phosphorylated by PKA. As shown in Fig. 4, mutation S4156A (M1) had little effect on peptide phosphorylation. However, mutation S4159A (M2) dramatically reduced peptide phosphorylation. As expected, a double mutant (M3) was not phosphorylated at all. PKA phosphorylation of a synthetic peptide containing S4268 was barely detectable (data not shown).
FIG. 3. Phosphorylation of polycystin-1 truncation mutants by PKA. Truncated GST-fusion constructs are named for their first and last amino acids and their length. Conserved PKA phosphorylation motifs are indicated by arrows (see Figs. 1 and 2 for further details). Approximately equimolar amounts of the fusion proteins were labeled as described in Fig. 2, electrophoresed, and detected by autoradiography. The positions of the proteins as determined by Coomassie blue staining (not shown) are indicated by the asterisks.
Analysis of PKA phosphorylation of alanine substituted fusion proteins. To verify that S4159 is the major site of PKA phosphorylation, alanine substituted fusion proteins were generated and tested for their ability to be phosphorylated (Fig. 5). Consistent with the peptide studies, mutation of serines 4156 and 4268 had little effect on the ability of PKA to phosphorylate polycystin-1. However, mutation S4159A reduced fusion protein phosphorylation 71%. These data demonstrate that S4159 is the major site of PKA phosphorylation in the polycystin-1 C-terminal cytosolic domain. DISCUSSION Identification of a particular protein as a kinase substrate in vitro is a common step towards understanding
FIG. 4. Phosphorylation of wild-type and alanine substituted polycystin-1 synthetic peptides. Polycystin-1 wild-type and mutant peptides corresponding to murine residues 4150-4164 were synthesized and phosphorylated under conditions identical to those used for fusion proteins. Possible PKA phosphorylation sites are indicated by arrows. Modifications for electrophoresis and Coomassie blue staining are described in Materials and Methods. An autoradiograph showing the phosphorylation results is shown at the bottom. Approximately equimolar amounts of peptide were loaded on this gel.
541
Vol. 259, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 5. Phosphorylation of wild-type and alanine substituted polycystin-1 fusion proteins. (A) Point mutants are named for their parent construct and the precise site of serine to alanine mutation with respect to murine polycystin-1. Alanine substitution is indicated by the removal of these arrows in the various HT 193 mutants. (B) Equimolar amounts of the various proteins were phosphorylated and detected by autoradiography (top) as before. The position of the fusion proteins is indicated by the arrow. This autoradiograph is representative of three different trials. Protein phosphorylation was quantitated by the PhosphorImager and corrected for protein loading. Phosphorylation amounts are plotted (bottom) relative to wildtype. This graph represents the averages of three experiments with error bars indicating standard deviation.
that protein’s function. Frequently, these in vitro findings are of physiological significance (26-28). A search for consensus PKA phosphorylation motifs in the C-terminal cytosolic domain of human and mouse polycystin-1 identified three conserved and several non-conserved sites conforming to the RxS sequence motif (25). In vitro labeling experiments using synthetic peptides, GST-fusion proteins, and purified catalytic subunits of PKA confirmed that one of these sites, S4159, is the major site of PKA phosphorylation, as mutation of this residue (S4159A) reduced PKA phosphorylation approximately 70% (the corresponding site in human polycystin-1 is S4168; see Fig. 1). The fact that the S4159A mutation reduced phosphorylation to about 30% of the wild-type sequence, suggests that there may be secondary PKA phosphorylation sites. However, since it is likely that they are not conserved in human polycystin-1, they may not be
functionally significant. Polycystin-1 may also be phosphorylated by kinases other than PKA. Conservation of putative tyrosine phosphorylation sites (17) and phosphorylation of the C-terminal cytosolic domain of murine polycystin-1 by PKC (29) suggests that other phosphorylation events may also play a role in polycystin-1 function. PKA phosphorylation plays a central role in the regulation of a number of cellular processes. The activities of a number of voltage-gated and ligand-gated ion channels are controlled by PKA phosphorylation, including the CFTR protein (23), the ATP-sensitive K 1 channel (K ATP) (20), and the inwardly rectifying K 1 channel, ROMK (21). It has also been established that PKA phosphorylation plays a critical role in the control of G-protein coupled receptors. Heterologous desensitization of agonist-stimulated and non-stimulated receptors involves phosphorylation by the second messenger-dependent kinases PKA and PKC (30). PKA phosphorylation, in addition to promoting heterologous desensitization, plays a central role in receptor “signalswitching.” Many G-protein coupled receptors, such as the b-adrenergic receptor (b-AR) are capable of binding different classes of G-proteins (31-34). PKA phosphorylation of a specific site in the b-AR reduces receptor-Gs signaling and promotes Gi coupling (22, 35). This so-called “signal-switching” serves as a direct feedback inhibition of Gs-mediated pathways, and initiates a Gi-mediated response. We have recently demonstrated that the C-terminal cytosolic domain of polycystin-1 binds and activates heterotrimeric G-proteins in vitro (17). Thus, it is attractive to hypothesize that PKA phosphorylation of polycystin-1 may regulate G-protein binding and signaling. The minimal G-protein binding domain was defined as the amino acid residues contained in the GST-fusion protein HA 74 (Figs. 1 and 3). This region of polycystin-1 is highly conserved in mouse and human (having 93% identity and 96% similarity) and contains a consensus G-protein activation motif flanked by the S4159 PKA phosphorylation site (Fig. 1). Removal of 25 amino acids from this minimal domain, including the PKA phosphorylation site, eliminated G-protein binding. We propose that polycystin-1 acts as a G-protein coupled receptor whose activity is modulated by PKA phosphorylation. The connections between cAMP and PKD, cAMP and PKA activation, and polycystin-1 and Gi suggest a connection between polycystin-1 and cAMP. Agonists of cAMP have been shown to promote cyst growth via stimulation of transepithelial fluid secretion and proliferation in established renal cell lines (36). Furthermore, in cystic cpk mice, antagonists of the arginine vasopressin-V2 receptor, which stimulates cAMP production, slowed cyst enlargement and decreased azotemia (37). The ability of polycystin-1 to be phosphorylated by PKA may represent a mechanism
542
Vol. 259, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
whereby intracellular cAMP levels are detected and regulated. High cAMP levels may promote PKA phosphorylation of polycystin-1 and cause a subsequent down-regulation of cAMP levels, potentially via a Gimediated pathway. Most mutations in the PKD1 gene lead to premature protein truncation (38), and there is increasing evidence that PKD is the result of a two-hit mechanism (39-41) whereby the normal allele is inactivated. As such, affected cells may lack or have significantly reduced polycystin-1 levels, rendering them unable to properly sense and regulate cAMP levels. Such a mechanism might explain the elevated cAMP levels that are observed in PKD kidneys (42). ACKNOWLEDGMENTS We gratefully acknowledge Dr. G. Germino (Johns Hopkins University) for the mouse polycystin-1 cDNA clone and Bo Wisdom (KUMC Biotechnology Support Facility) for synthesis and purification of peptides. This research was supported by NIH Grant DK51047 (JPC), grants from the Polycystic Kidney Research Foundation (JPC and RLM), and a Kansas Health Foundation Predoctoral Fellowship (SCP).
REFERENCES 1. Watson, M. L., and Torres, V. E. (Eds.) (1996) Polycystic Kidney Disease, Oxford University Press, Oxford. 2. Grantham, J. J. (1997) Kidney Int. Suppl. 63, S93–S97. 3. Torres, V. E. (1998) Curr. Opin. Nephrol. Hypertens. 7, 159 –169. 4. The European Polycystic Kidney Disease Consortium (1994) Cell 77, 881– 894. 5. Burn, T. C., Connors, T. D., Dackowski, W. R., Petry, L. R., Van Raay, T. J., Millholland, J. M., Venet, M., Miller, G., Hakim, R. M., Landes, G. M., Klinger, K. W., Quian, F., Onuchic, L. F., Watnick, T., Germino, G. G., and Doggett, N. A. (1995) Hum. Mol. Genet. 4, 575–582. 6. The International Polycystic Kidney Disease Consortium. (1995) Cell 81, 289 –298. 7. Hughes, J., Ward, C. J., Peral, B., Aspinwall, R., Clark, K., San Millan, J. L., Gamble, V., and Harris, P. C. (1995) Nat. Genet. 10, 151–160. 8. Harris, P. C., Ward, C. J., Peral, B., and Hughes, J. (1995) J. Am. Soc. Nephrol. 6, 1125–1133. 9. Bycroft, M., Bateman, A., Clarke, J., Hamill, S. J., Sandford, R., Thomas, R. L., and Chothia, C. (1999) EMBO J. 18, 297–305. 10. Lohning, C., Pohlschmidt, M., Glucksmann-Kuis, M. A., Duyk, G., Bork, P., Schneider, M. O., Reeders, S. T., and Frischauf, A. M. (1996) Nephrol. Dial. Transplant. 11(Suppl. 6), 2– 4. 11. Moy, G. W., Mendoza, L. M., Schulz, J. R., Swanson, W. J., Glabe, C. G., and Vacquier, V. D. (1996) J. Cell Biol. 133, 809 – 817. 12. Calvet, J. P. (1993) Kidney Int. 43, 101–108. 13. Carone, F. A., Bacallao, R., and Kanwar, Y. S. (1994) Lab. Invest. 70, 437– 448. 14. Kim, K., Sharma, C. P., and Arnaout, M. A. (1997) J. Am. Soc. Nephrol. 8, 375A. 15. Kim, E., Arnould, T., and Walz, G. (1997) J. Am. Soc. Nephrol. 8, 375A. 16. Qian, F., Germino, J., Zhang, X. B., and Germino, G. G. (1997) J. Am. Soc. Nephrol. 8, 380A.
17. Parnell, S. C., Magenheimer, B. S., Maser, R. L., Rankin, C. A., Smine, A., Okamoto, T., and Calvet, J.P. (1998) Biochem. Biophys. Res. Commun. 251, 625– 631. 18. Arnould, T., Kim, E., Tsiokas, L., Jochimsen, F., Gruning, W., Chang, J. D., and Walz, G. (1998) J. Biol. Chem. 273, 6013– 6018. 19. Kim, E., Arnould, T., Sellin, L. K., Benzing, T., Fan, M. J., Gruning, W., Sokol, S. Y., Drummond, I., and Walz, G. (1999) J. Biol. Chem. 274, 4947– 4953. 20. Wang, W., and Giebisch, G. (1991) J. Gen. Physiol. 98, 35– 61. 21. Xu, Z.-C., Yang, Y., and Hebert, S.C. (1996) J. Biol. Chem. 271, 9313–9319. 22. Daaka, Y., Luttrell, L. M., and Lefkowitz, R. J. (1997) Nature 390, 88 –91. 23. Gadsby, D. C., and Nairn, A. C. (1999) Physiol. Rev. 79, S77– S107. 24. Schagger, H., and von Jagow, G. (1987) Anal. Biochem. 166, 368 –379. 25. Pearson, R. B., and Kemp, B. E. (1991) Methods Enzymol. 200, 62– 81. 26. Ben-Levy, R., Leighton, I. A., Doza, Y. N, Attwood, P., Morrice N., Marshall, C. J., and Cohen, P. (1995) EMBO J. 23, 5920 – 5930. 27. Montminy, M. (1997) Annu. Rev. Biochem. 66, 807– 822. 28. Zhou, J., Huynh, Q. K., Hoffman, R. T., Crook, E. D., Daniels, M. C., Gulve, E. A., and McClain, D. A. (1998) Diabetes 47, 1836 –1840. 29. Parnell, S. C., and Calvet, J. P. (1997) J. Am. Soc. Nephrol. 8, 378A. 30. Chuang, T. T., Iacovelli, L., Sallese, M., and De Blasi, A. (1996) Trends Pharmacol. Sci. 17, 416 – 421. 31. Abramson, S., N., Martin, M. W., Hughes, A. R., Harden, T. K., Neve, K. A., Barrett, D. A., and Molinoff, P. B. (1988) Biochem. Pharmacol. 37, 4289 – 4297. 32. Xiao, R.P., Ji, X. W., and Lakatta, E. G. (1995) Mol. Pharmacol. 47, 322–329. 33. Herrlich, A., Kuhn, B., Grosse, R., Schmid, A., Schultz, G., and Gudermann, T. (1996). J. Biol. Chem. 271, 16764 –16772. 34. Laugwitz, K. L., Allgeier, A., Offermans, S., Spicher, K., Van Sande, J., Dumont, J. E., and Schultz, G. (1996) Proc. Natl. Acad. Sci. USA 93, 116 –120. 35. Okamoto, T., Murayama, Y., Hayashi, Y., Inagaki, M., Ogata, E., and Nishimoto, I. (1991) Cell 67, 723–730. 36. Mangoo-Karim, R., Uchic, M. E., Grant, M., Shumate, W. A., Calvet, J. P., Park, C. H., and Grantham, J. J. (1989) FASEB J. 3, 2629 –2632. 37. Gattone, V. H., Maser, R. L., Tian, C., Rosenberg, J. M., and Branden, M. G. (1999) Dev. Genet. 24, 1–10. 38. Calvet, J. P. (1998) J. Nephrol. 11, 24 –34. 39. Qian, F., Watnick, T. J., Onuchic, L. F., and Germino, G. G. (1996) Cell 87, 979 –987. 40. Brasier, J. L., and Henske, E. P. (1997) J. Clin. Invest. 99, 194 –199. 41. Koptides, M., Constantinides, R., Kyriakides, G., Hadjigavriel, M., Patsalis, P. C., Pierides, A., and Deltas, C. C. (1998) Hum. Genet. 103, 709 –717. 42. Yamaguchi, T., Nagao, S., Kasahara, M., Takahashi, H., and Grantham, J. J. (1997) Am. J. Kidney Dis. 30, 703–709. 43. Steinberg, R. A., Cauthron, R. D., Symcox, M. M., and Shuntoh, H. (1993) Mol. Cell. Biol. 13, 2332–2341.
543