Identification of trimethylation at C-terminal lysine of pilin in the cyanobacterium Synechocystis PCC 6803

Biochemical and Biophysical Research Communications 404 (2011) 587–592

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

Identification of trimethylation at C-terminal lysine of pilin in the cyanobacterium Synechocystis PCC 6803 Young Hye Kim a, Kyu Hwan Park a, Se-Young Kim a, Eun Sun Ji a, Jin Young Kim a, Sang Kwang Lee a, Jong Shin Yoo a,b, Hyun Sik Kim a,⇑, Young Mok Park a,b,⇑ a b

Mass Spectrometry Research Center, Korea Basic Science Institute, Ochang 363-883, South Korea Graduate School of Analytical Science and Technology, Chungnam National University, Daejeon, 305-333, South Korea

a r t i c l e

i n f o

Article history: Received 16 November 2010 Available online 3 December 2010 Keywords: Synechocystis sp. PCC 6803 Pilin Post-translational modification Trimethylation

a b s t r a c t Various post-translational modifications (PTMs) of pilin in Synechocystis sp. PCC 6803 have been proposed. In this study, we investigated previously unidentified PTMs of pilin by mass spectrometry (MS). MALDI-TOF MS and TOF/TOF MS showed that the molecular mass of the C-terminal lysine of pilin was increased by 42 Da, which could represent acetylation (DM = 42.0470) or trimethylation (DM = 42.0106). To discriminate between these isobaric modifications, the molecular mass of the C-terminal tryptic peptide was measured using 15T Fourier transform ion cyclotron resonance (FT-ICR) MS. The high magnetic field FT-ICR provided sub-ppm mass accuracy, revealing that the C-terminal lysine was modified by trimethylation. We could also detect the existence of mono- and di-methylation of the C-terminal lysine. Cells expressing a pilin point mutant with glutamine replacing the C-terminal lysine showed dramatically reduced motility and short pili. These findings suggest that trimethylation of pilin at the C-terminal lysine may be essential for the biogenesis of functional pili. Ó 2010 Elsevier Inc. All rights reserved.

1. Introduction Post-translational modifications (PTMs) can alter the structures, molecular interactions, activities, and localizations of proteins in a cell. A wide variety of PTMs give rise to high complexity of proteins and delicate regulation of proteomes. Therefore, the identification of PTMs is important for understanding the physiological functions of proteins and the dynamics of proteomes. As the PTM of a protein results in a molecular mass higher than the theoretical mass calculated from the amino acid sequence, efforts to identify PTMs have been based on the measurement of the increase in mass, primarily by mass spectrometry (MS). Tremendous advances in PTM research have been achieved with the development of MS-based proteomics [1]. However, owing to their complexity, low abundance, and dynamic nature, PTMs can be difficult to identify, making high sensitivity, accuracy, and resolution desirable for MS-based proteomics. High-field Fourier transform ion cyclotron resonance (FT-ICR) MS is one of the most powerful analytical technologies and provides high resolution and accuracy of mass measurement. FT-ICR MS can monitor subtle mass changes in large biomolecules and has been used

⇑ Corresponding authors. Address: Mass Spectrometry Research Center, Korea Basic Science Institute, 804-1 Yangchung-ri, Ochang-eup, Chungbuk 363-883, South Korea (Y.M. Park). Fax: +82 43 240 5159. E-mail addresses: [email protected] (H.S. Kim), [email protected] (Y.M. Park). 0006-291X/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2010.11.133

to resolve challenging puzzles in life science, such as protein interactions as well as PTMs [2–4]. The unicellular cyanobacterium Synechocystis sp. PCC 6803 (hereafter referred to as Syn6803) displays thick and thin pili, which are fibrous organelles, on its cell surface. The gene pilA1 encodes pilin, the structural component of the thick pili, and the correct biogenesis of these pili is essential for phototactic motility of the cells [5]. Thick pili, referred to as type IV pili, are common in various Gram-negative bacteria, where they function as adhesion points to mediate bacterial interactions with the environment and host cells [6]. Thick pili are considered virulence factors of pathogenic bacteria and have been extensively studied for the development of vaccines and therapies [7]. Recent advances in the PTM analysis of pilin have provided further clarification of pathogenic mechanisms. In pathogenic bacteria such as Neisseria and Pseudomonas, several pilin PTMs have been identified, including N-terminal methylation of mature pilin [8], glycosylation of pilin from several Neisseria and Pseudomonas species [9–11], a-glycerophosphation of pilin from Neisseiria species [12], and phosphoethanolamine and phosphocholine modification of pilin from N. gonorrhoeae [13]. These PTMs may create structural and functional diversification of pilin. For example, glycosylation is required for antigenic variation and bacterial interactions with host cells [9–11]], and the addition of glycerophosphate at Ser-93 of Neisseial pilin may be needed to anchor the assembled pilus fiber to the outer membrane [12]. The complexity of the virulence factor is increased by the modification of pilin with phosphoethanolamine

588

Y.H. Kim et al. / Biochemical and Biophysical Research Communications 404 (2011) 587–592

and phosphocholine [15]. A previous study by our group demonstrated that glycosylation of a pilin isoform is essential for cell motility in Syn6803 [14]. In addition, the pilin proteins of Syn6803 exhibited different molecular weights and pI values on 2-D gels, suggesting the existence of other PTMs in addition to glycosylation [15]. This study aimed to reveal previously unidentified PTMs of pilin protein in Syn6803, using MS. Highly accurate mass measurements of pilin tryptic peptides using 15T FT-ICR MS identified trimethylation at the C-terminal lysine, which was not observed by conventional MS. The biological implications of the modification in the motility of Syn6803 were investigated using site-directed mutation of pilin.

2. Materials and methods 2.1. Bacterial strains and culture conditions Syn6803 was acquired from the Pasteur Culture Collection, and a clone showing active motility was selected as a parent strain. Cells were grown in BG11 medium at 30 °C under incandescent light (30 lmol m2 s1) until late log phase (A750 0.8–0.9) and then spread onto BG11 solid medium containing 1.5% (w/v) agar. Cultures for protein purification were incubated under unidirectional light (10 lmol m2 s1) for 7 days. For motility assays and transmission electron microscopy (TEM), cells were grown for 3 days on 0.4% (w/v) agar-solidified BG11 containing 10 mM glucose. 2.2. In-gel digestion of pilin Total and surface protein fractions of Syn6803 were prepared as previously described [15]. Surface protein samples (3 lg) were electrophoresed and stained with Coomassie Brilliant Blue. A gel slice containing the pilin protein was excised, and the protein in the gel slice was digested with trypsin as previously described [15]. 2.3. MALDI-TOF and TOF/TOF MS The tryptic peptides of pilin were dissolved in 0.5% trifluoroacetic acid (TFA), desalted on ZipTipC18 (Millipore, Bedford, MA, USA), and eluted directly onto a matrix-assisted laser desorption/ionization (MALDI) plate using a-cyano-4-hydroxycinnamic acid (CHCA) in 0.5% TFA/acetonitrile (ACN) (1:1, v/v). All mass spectra were acquired in the reflection mode using a 4700 Proteomics Analyzer with TOF/TOF optics (Applied Biosystems, Framingham, MA, USA). Peptide peaks were identified by MASCOT searches of the MS/MS data against the Syn6803 sequence database (CyanoBase). MASCOT was used with a precursor mass error of 1 Da and a fragment ion mass error of 0.7 Da. Phosphorylation, methionine oxidation, and cysteine carbamidomethylation were chosen as variable modifications. 2.4. FT-ICR MS FT-ICR MS was performed in a broadband mode by a 15T FT-ICR MS (ApexQe; Bruker Daltonics, Bremen, Germany). For electrospray ionization (ESI), the pilin tryptic peptides were dissolved in 0.1% formic acid/50% ACN and infused into the 15T FT-ICR MS at a flow rate of 500 nL/min. The parameters applied for positive ion ESI MS were capillary voltage of 2100 V, transient length of 0.7 s, skimmer 1 voltage of 40 V, and sinebell window function. External calibration of the ESI mass spectra with ESI tuning MIX solution (Agilent Technologies, Palo Alto, CA, USA) showed 0.37 ppm mass accuracy in the range of 622–2722 m/z. Charge deconvolution was performed by Data Analysis ver. 3.4 with de-

fault parameters for peptides/small molecules. The masses and abundances of the isotopes used for theoretical mass calculations were taken from the National Institute of Standards and Technology (http://www.nist.gov/physlab/data/comp.cfm). For MALDI, the pilin tryptic peptides were dissolved in 0.1% TFA/33% ACN and mixed with the same volume of CHCA in 0.1% TFA/33% ACN prior to MALDI MS. The obtained positive ion MALDI spectra were externally calibrated with a standard peptide mixture (#206195; Bruker Daltonics). The achieved mass accuracy was better than 0.32 ppm in the range of 1046–3147 m/z. 2.5. Generation of pilin mutants To generate a pilA1 gene-deleted mutant, three separate PCR syntheses of the 50 - and 30 -regions of the pilA1 gene (463 and 541 bp, respectively) and a spectinomycin marker cassette were performed. Using genomic DNA as a template, the pilA1 gene was amplified with the following primers (50 ? 30 ): 50 -region, UF (GCATCCCCAACCAGAATCTGC) and UR-272 (GAGCATCGTTTGTTC GCCCAGCGCCCCT CATTTGCCTATCAC); and 30 -region, DF-272 (TAATGTCTAACAATTCG TTCAAGCTTGAGTGGTGCGGGAATGATG) and DR (TGCTGTTTGTC TCGGCTGGAA). The spectinomycin marker cassette was amplified with the primers SM-F (CTGGGCGAACAAACGATGCT) and SM-R (GCTTGAACGAATTGTTAGACA). The pilA1 gene-deleted mutant construct was prepared by fusion PCR using the three PCR amplicons and the UF and DR primers [16]. The resultant PCR amplicon was purified and inserted into pGEM-T Easy Vector (Promega, Madison, WI, USA) to create pGEM-pilA1U_SM_pilA1D, which was used to transform motile wild-type Syn6803 cells. One of the spectinomycin-resistant transformants was selected and named DpilA1. Complete segregation of the mutation was confirmed by PCR. The C-terminal lysine residue of pilin was substituted with glutamine by site-directed mutagenesis. A PCR amplicon corresponding to the full-length pilA1 gene and its upstream region was generated using primers that also introduced artificial restriction endonuclease recognition sites (bold) (50 ? 30 ): L1694F (GAGCTCG CATCCCCAACCAGAATCTGC) and L1694R (GGTACCCCACTCAAAACA TAATAGGGTCCT). The PCR amplicon was inserted into pGEM-T Easy Vector. This construct was used as a template with MUT1 (50 -TGTGGTGGTGCTGAAGTAATTCAATAGGACCCTATTATG-30 ) as a primer to generate a pilin mutant with glutamine replacing the C-terminal lysine, using a Gene Tailor site-directed mutagenesis system (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The resultant construct was inserted into the KpnI and SacI sites of plasmid pIGA [17], and the plasmid was introduced into the pilA1 gene-deleted mutant by electroporation, allowing homologous recombination. Transformed cells were resistant to spectinomycin and kanamycin. 2.6. Immunoblot analysis Samples of total proteins (10 lg) and surface proteins (0.5 lg) were separated in 15% SDS–polyacrylamide gels and subjected to immunoblot analysis as previously described [15]. 2.7. Transmission electron microscopy For TEM, a copper grid was floated on a drop of cell suspension, and cells were allowed to adhere for 2 min. The grid was removed, and excess liquid was drained by blotting the grid edges with filter paper. For negative staining of cells, the grid was floated on a drop of 0.4% phosphotungstic acid for 2 min and washed briefly with deionized distilled water prior to examination under a Tecnai G2 Spirit transmission electron microscope (FEI Co., Hillsboro, OR, USA).

589

Y.H. Kim et al. / Biochemical and Biophysical Research Communications 404 (2011) 587–592

Fig. 1B, was not identified by peptide mass fingerprinting and was subjected to MS/MS sequencing. The collision-induced dissociation of the precursor ion (m/z 2442.18) yielded a series of y fragment ions with integral mass increases of 42 or 99 Da and revealed that the precursor ion peak corresponds to the 9th tryptic peptide (T9), with an integral mass increase of 99 Da (Fig. 1C). This is indicative of the presence of a PTM in the peptide. The tryptic peptides had been alkylated with iodoacetamide during in-gel digestion, and the resultant carboxyamidomethyl cysteine in peptide T9 would account for an integral mass increase of 57 Da [18]. Therefore, the real mass difference between the analyzed and expected masses of the peptide is 42 Da. This is also supported by the fact that the series of y ions from y1 to y7 show integral mass increases of 42 Da, instead of 99 Da. Moreover, the C-terminal lysine residue was shown to be the possible modification site.

3. Results and discussion 3.1. Identification of a post-translationally modified site in pilin from Syn6803 We previously suggested that Syn6803 pilin is modified with various PTMs, including glycosylation [14,15]. As PTMs of proteins are involved in the regulation of protein functions, identifying pilin PTMs can provide information about the physiological roles of pili. In this study, by combining MS and genetic analyses, previously unidentified PTMs of pilin have been identified and characterized, aiding in the understanding of pili-mediated biological functions. Surface proteins from Syn6803 were separated in 15% SDS– polyacrylamide gels. The band containing pilin was subjected to in-gel digestion and analyzed by MALDI-TOF MS to identify potential sites of PTM. The data were analyzed using MASCOT, and peptide ion peaks were assigned by comparison of the measured peptide masses to calculated peptide masses. In Fig. 1A, pilin tryptic peptides are numbered according to their occurrence in the mature protein and are labeled with the prefix ‘‘T’’. Each peptide assignment was also verified by MS/MS. The peak corresponding to the glycosylated T5 peptide was too small to be identified because of suppression by other unmodified peptide peaks (Fig. 1B). The peak at m/z 2442.18, labeled with the prefix ‘‘U’’ in

3.2. Determination of trimethylation on C-terminal lysine by high-accuracy mass spectrometry Two possible modifications, acetylation and trimethylation, could produce an integral mass difference of 42 Da. To distinguish between these isobaric modifications, high mass accuracy and high resolution MS is required. The mass accuracy of FT-ICR MS is typically sub-ppm level with 100-fold resolution, which is sufficient to

A

4700 Reflector Spec #1[BP = 1365.5, 13040]

% Intensity

B

100 90 T8 80 882.44 70 T4 60 831.46 50 40 30 20 10 0 799.0

T8

T7

U

(CAM)

1365.54

2442.18

939.46

T5 1071.49

T6

T7

(Gly76-Phe97)

(Oxy)

2363.04

1381.54

1139.2

1479.4

1819.6

2159.8

2500.0

Mass (m/z)

% Intensity

C 100 90

y1+42

80

189.1670

2.5E+4

70 60 50

Y8+42 y3+42

401.3141

y1*

1782.8381

Y16+42 Y9+42 y6+42 658.4072

40 130.1063 30 y2+42 y4+42 20 302.2493 530.3456 10 0 69.0

Y18+42

875.4485

570.4

y7+42

1584.7004

990.4668

Y17+42

y12+42

1681.7889

1232.5614

715.4242

Y19+42 1897.8594

y14+42

Y20+42

1386.6451

2026.9049

1071.8

1573.2

2074.6

2576.0

Mass (m/z) Fig. 1. MS and MS/MS results for pilin tryptic peptides. (A) Assignment map of pilin. Peptides identified by peptide mass fingerprinting and MS/MS are in bold type. The tryptic peptides are numbered according to their occurrence in the mature protein and are labeled with the prefix ‘‘T.’’ The signal peptide of premature pilin is enclosed in the box. (B) MALDI-TOF MS of wild-type (WT) pilin. The identified ion peaks are labeled. The letter ‘‘U’’ indicates an unidentified peptide peak. (C) Peptide sequencing of the unidentified ‘‘U’’ peptide by MALDI-TOF/TOF MS. The precursor ion at m/z = 2442.18 was chosen and sequenced by MALDI-TOF/TOF MS. The identified y ions are designated and y1⁄ indicates the neutral loss of trimethylamine from the trimethylated y1 ion. CAM-C indicates the carboxyamidomethyl cysteine generated by alkylation during in-gel digestion.

590

Y.H. Kim et al. / Biochemical and Biophysical Research Communications 404 (2011) 587–592

show isotopic fine structure and thereby reduce the number of candidates during target identification [19]. Peptide T9 was analyzed by 15T FT-ICR MS to identify the type of PTM. The theoretical monoisotopic masses of trimethylated T9 and acetylated T9 ions are 2442.108924 and 2442.072538 Da, respectively, which were calculated from the molecular formulae of the protonated ions (C100H161N28O41S1 for trimethylated T9 and C99H157N28O42S1 for acetylated T9). Thus, the mass difference between these two modified T9 peptides is 0.036386 Da. With the mass difference assigned evenly to both peaks, the required mass accuracy to identify one of the two peptides is at least 7.4 ppm (= 0.018193/2442.108924). A 15T FT-ICR ESI mass spectrum of the pilin peptide mixture (Fig. 2) showed 0.37 ppm mass accuracy by external calibration. From charge deconvolution of the ESI FT-ICR MS spectrum (Fig. 2), the monoisotopic mass of a T9 ion was observed at 2442.10860 Da with a well resolved isotopic pattern. If T9 were acetylated, the error of mass measurement would be 14.8 ppm, which is larger than 0.37 ppm and worse than the theoretically required accuracy; therefore, acetylation is unlikely. If T9 were trimethylated, the error would be 0.13 ppm, which is low enough to be acceptable. The high accuracy of 15T FT-ICR MS indicates that T9 was trimethylated, and not acetylated. The same result was obtained from a 15T FT-ICR MALDI mass spectrum. The monoisotopic mass of a T9 ion was 2442.10932 Da, and the difference of 0.15 ppm for trimethylated T9 was congruent with the ESI MS result (data not shown). Moreover, collision-induced dissociation yields a neutral loss of trimethylamine (MH+59) from trimethylated peptides or an ammonium ion at m/z 126 from acetylated peptides [20]. In the MALDI-TOF MS/MS spectrum (Fig. 1C), there is a fragment ion peak at m/z 130.1063, which indicates the neutral loss of trimethylamine from the trimethylated y1 ion (m/z 189.1670). Taken together, these data demonstrate that the C-terminal lysine of pilin is trimethylated. The ESI MS spectrum revealed that the T9 peptide peaks comprised a series of peaks with discrete integral mass differences of 14 Da (Fig. 2B). In general, a 14-Da mass difference can be considered as the addition of N (14.0031 Da), H14 (14.1095 Da), or CH2 (14.0157 Da), or a substitution such as N by a CO (+CO/N) (13.9918 Da), +CO/CH2 (13.9793 Da), +C2H4/N (14.0282 Da), C2H6/O (14.0520 Da), or +C2H6/NH2 (14.0282 Da). The high mass accuracy of 15T FT-ICR MS showed that the average of the mass differences in Fig. 2B is 14.0156 Da, corresponding to the addition of CH2 by methylation. This result is consistent with a previous report in which sequential 14-Da mass differences were considered as evidence of multiple methylations of lysine [21]. There was another peak at 2456.

12431 Da and this was considered as an acrylamide adduct (+71 Da) on the cysteine residue in the trimetylated T9 peptide [22]. Judging from this, the superior discriminability of FT-ICR MS would make it a conclusive tool for identifying a target molecule among candidates of very similar masses. 3.3. Substitution of the C-terminal lysine in pilin by site-directed mutagenesis To elucidate the physiological role of lysine trimethylation at the C-terminus of pilin, site-directed mutagenic analysis was conducted to generate a pilA1 gene-deleted mutant. The mutant construct created by fusion PCR was introduced into the chromosome of Syn6803 by natural transformation and homologous recombination. A transformant, named DpilA1, was selected and subjected to segregation under antibiotic selection pressure. Complete segregation of the mutation was confirmed by PCR. Loss of the pilA1 gene in the DpilA1 mutant was confirmed by sequencing (data not shown). Another pilin mutant was generated by replacing the C-terminal lysine with glutamine, which conserved the positive charge, to examine the effect specific to methylation [20]. The pilA1 gene with the C-terminal glutamine was inserted to pIGA vector, which can integrate into a neutral site on the Syn6803 chromosome [17]. The resultant construct was introduced into the pilin-negative DpilA1 strain by electroporation. An isolated transformant, named pilA1K168Q, was cultivated on BG11 agar plates under unidirectional light to induce expression of pilin as well as the motility phenotype of the cells. 3.4. Possible role of C-terminal lysine trimethylation of pilin in motility Using the pilin mutant pilA1K168Q, we investigated the role of trimethylation. As pilin is the component of type IV pili that is responsible for the gliding motility of Syn6803, the effect of the loss of methylation at the C-terminus of pilin on motility was determined. Cell suspensions were dotted onto plates and grown for 3 days under unidirectional light. Then phototactic gliding motility was compared between wild-type (WT) and mutant cells. The WT cells displayed gliding motility, but this was not observed in DpilA1 cells. The pilA1K168Q cells moved very slightly for 2 days, but no movement was seen at subsequent time points (Fig. 3A). Next, the possibility that the motility defect of pilA1K168Q cells was related to pili biogenesis was investigated. The expression of pilin in the mutant cells was examined by immunoblot analysis. Pilin proteins were detected as multiple bands in both the total and surface protein fractions of WT cells, as seen in data we had

Intensity [%] 1221.55901

100

2442.10860

T9 14.01598

charge deconvolution

80

T8 939.47167 60

14.01551 2456.12431

40 14.01524 2414.07710

20

2428.09262

2400.06186 0 800

1000

1200

1400

1600

1800

2000

2200

2400m/z

2390

2400

2410

2420

2430

2440

2450

m/z

Fig. 2. The 15T FT-ICR ESI MS spectrum of pilin tryptic peptides. Spectrum from charge deconvolution of ESI FT-ICR MS is shown and all labeled masses are monoisotopic. Several pilin peptide signals are labeled for convenience.

Y.H. Kim et al. / Biochemical and Biophysical Research Communications 404 (2011) 587–592

A

B

Total Proteins

Light W

T

8Q 16 1 1K ilA A l pi Δp

Surface Proteins

W

T

Q 68 K1 A1 A1 l i pil p Δ

150 100 75 50 37

25 20 15

pilA1K168Q

WT

Δ pilA1

Fig. 3. Phenotype of pilin mutants. (A) Gliding motility assay of wild-type and pilin mutant cells. Logarithmically growing cells (3 ll) were spotted onto 0.4% agarsolidified BG11 containing 10 mM glucose and grown under unidirectional light (indicated by arrow) of 10 lmol/m2/s for 3 days. The open dotted circles indicate the initial dotting points of cell suspension. (B) Detection of pilin by immunoblotting with anti-pilin antibody. Total proteins (10 lg) and surface proteins (0.5 lg) from wild-type (WT), pilA1K168Q, and DpilA1 cells were separated in 15% SDS– polyacrylamide gels.

previously reported [15]. The DpilA1 cells showed no pilin synthesis, as expected. In pilA1K168Q cells, when pilin was synthesized, less protein was produced (Fig. 3B), suggesting that the amount of pilin isoforms in pilA1K168Q was reduced owing to loss of the methylation site in pilin. Pilin is assembled into thick pili on Syn6803, and the pili on the cell surface were observed using TEM. The WT cells showed numerous thick pili on their surfaces, but the pilA1K168Q mutant cells had few thick pili. At higher magnification, the thick pili on the mutant cell surface were observed to be few in number and very short (Fig. 4). It is assumed that the short length of the pili contributes to the aberrant motility of the pilin point-mutant cells. This observation suggests that trimethylation of the C-terminal lysine of pilin is required for biogenesis of thick pili of sufficient length.

Fig. 4. Detection of pili on the cell surface by transmission electron microscopy. Logarithmically growing (A) wild-type (WT) and (B) pilA1K168Q cells. The arrows point to a thick pilus. Lower panels show higher magnifications of the same cells shown in the upper panels.

591

Although various PTMs have been reported for pilin proteins in several different bacteria, this study provides the first description of lysine methylation of cyanobacterial pilin. Methylation changes the positive charge of lysine and may thus influence protein activity. Lysine methylation occurs in various proteins such as histones [23], p53 [1,24], TAF10 [25], Rubisco [26], and retinoic acid receptor-a [20], ribosomal protein L11 [27] and its functions have been elucidated as follows (for review, see [28]). Methylated lysine can provide a docking site for the binding of effector proteins. The methylation can serve to inhibit alternative PTMs on the same lysine residue. Another role of lysine methylation is regulation of protein stability [29]. In this study, there is a possibility that the C-terminal lysine methylation may be involved in interaction among pilin proteins, which may subsequently be required for assembly into long thick pili. Furthermore, we cannot rule out the possibility that trimethylation might regulate the stability of pilin. Further investigation on effects of the C-terminal lysine methylation on stability of pilin or pili will be undertaken. In conclusion, it was demonstrated that the C-terminal lysine of pilin is post-translationally modified by trimethylation. The substitution of glutamine for the C-terminal lysine of pilin by site-directed mutagenesis resulted in defects in the biogenesis of thick pili of sufficient length, which subsequently affected the gliding motility of Syn6803.

Acknowledgments This work was supported by a grant from the Korea Basic Science Institute (T30516 to Y.H.K.). We thank Dr. H.S. Kweon and H.J. Cho at KBSI for the TEM analysis. References [1] N.L. Young, M.D. Plazas-Mayorca, B.A. Garcia, Systems-wide proteomic characterization of combinatorial post-translational modification patterns, Expert Rev. Proteomics 7 (2010) 79–92. [2] D. Miura, Y. Tsuji, K. Takahashi, H. Wariishi, K. Saito, A strategy for the determination of the elemental composition by Fourier transform ion cyclotron resonance mass spectrometry based on isotopic peak ratios, Anal. Chem. 82 (2010) 5887–5891. [3] A. Schmidt, M. Karas, The influence of electrostatic interactions on the detection of heme–globin complexes in ESI-MS, J. Am. Soc. Mass Spectrom. 12 (2001) 1092–1098. [4] B.A. Garcia, J.J. Pesavento, C.A. Mizzen, N.L. Kelleher, Pervasive combinatorial modification of histone H3 in human cells, Nat. Methods 4 (2007) 487–489. [5] D. Bhaya, A. Takahashi, A.R. Grossman, Light regulation of type IV pilusdependent motility by chemosensor-like elements in Synechocystis PCC6803, Proc. Natl. Acad. Sci. USA 98 (2001) 7540–7545. [6] W. Shi, H. Sun, Type IV pilus-dependent motility and its possible role in bacterial pathogenesis, Infect. Immun. 70 (2002) 1–4. [7] L. Craig, N. Volkmann, A.S. Arvai, M.E. Pique, M. Yeager, E.H. Egelman, J.A. Tainer, Type IV pilus structure by cryo-electron microscopy and crystallography: implications for pilus assembly and functions, Mol. Cell 23 (2006) 651–662. [8] J.C. Pepe, S. Lory, Amino acid substitutions in PilD, a bifunctional enzyme of Pseudomonas aeruginosa. Effect on leader peptidase and N-methyltransferase activities in vitro and in vivo, J. Biol. Chem. 273 (1998) 19120–19129. [9] J. Chamot-Rooke, B. Rousseau, F. Lanternier, G. Mikaty, E. Mairey, C. Malosse, G. Bouchoux, V. Pelicic, L. Camoin, X. Nassif, G. Dumenil, Alternative Neisseria spp. type IV pilin glycosylation with a glyceramido acetamido trideoxyhexose residue, Proc. Natl. Acad. Sci. USA 104 (2007) 14783–14788. [10] F.E. Aas, A. Vik, J. Vedde, M. Koomey, W. Egge-Jacobsen, Neisseria gonorrhoeae O-linked pilin glycosylation: functional analyses define both the biosynthetic pathway and glycan structure, Mol. Microbiol. 65 (2007) 607–624. [11] S. Voisin, J.V. Kus, S. Houliston, F. St-Michael, D. Watson, D.G. Cvitkovitch, J. Kelly, J.R. Brisson, L.L. Burrows, Glycosylation of Pseudomonas aeruginosa strain Pa5196 type IV pilins with mycobacterium-like alpha-1,5-linked d-Araf oligosaccharides, J. Bacteriol. 189 (2007) 151–159. [12] E. Stimson, M. Virji, S. Barker, M. Panico, I. Blench, J. Saunders, G. Payne, E.R. Moxon, A. Dell, H.R. Morris, Discovery of a novel protein modification: alphaglycerophosphate is a substituent of meningococcal pilin, Biochem. J. 316 (Pt. 1) (1996) 29–33. [13] C.L. Naessan, W. Egge-Jacobsen, R.W. Heiniger, M.C. Wolfgang, F.E. Aas, A. Rohr, H.C. Winther-Larsen, M. Koomey, Genetic and functional analyses of PptA, a

592

[14]

[15]

[16]

[17]

[18] [19] [20]

[21]

Y.H. Kim et al. / Biochemical and Biophysical Research Communications 404 (2011) 587–592 phospho-form transferase targeting type IV pili in Neisseria gonorrhoeae, J. Bacteriol. 190 (2008) 387–400. Y.H. Kim, J.Y. Kim, S.Y. Kim, J.H. Lee, J.S. Lee, Y.H. Chung, J.S. Yoo, Y.M. Park, Alteration in the glycan pattern of pilin in a nonmotile mutant of Synechocystis sp. PCC 6803, Proteomics 9 (2009) 1075–1086. Y.H. Kim, Y.M. Park, S.J. Kim, Y.I. Park, J.S. Choi, Y.H. Chung, The role of Slr1443 in pilus biogenesis in Synechocystis sp. PCC 6803: involvement in posttranslational modification of pilins, Biochem. Biophys. Res. Commun. 315 (2004) 179–186. H. Kuwayama, S. Obara, T. Morio, M. Katoh, H. Urushihara, Y. Tanaka, PCRmediated generation of a gene disruption construct without the use of DNA ligase and plasmid vectors, Nucleic Acids Res. 30 (2002) E2. A. Kunert, M. Hagemann, N. Erdmann, Construction of promoter probe vectors for Synechocystis sp. PCC 6803 using the light-emitting reporter systems Gfp and LuxAB, J. Microbiol. Methods 41 (2000) 185–194. S. Sechi, B.T. Chait, Modification of cysteine residues by alkylation. A tool in peptide mapping and protein identification, Anal. Chem. 70 (1998) 5150–5158. T. Kind, O. Fiehn, Seven Golden Rules for heuristic filtering of molecular formulas obtained by accurate mass spectrometry, BMC Bioinform. 8 (2007) 105. M.D. Huq, N.P. Tsai, S.A. Khan, L.N. Wei, Lysine trimethylation of retinoic acid receptor-alpha: a novel means to regulate receptor function, Mol. Cell. Proteomics 6 (2007) 677–688. L. Yang, S. Tu, C. Ren, E.M. Bulloch, C.L. Liao, M.D. Tsai, M.A. Freitas, Unambiguous determination of isobaric histone modifications by reversed-

[22]

[23]

[24]

[25] [26]

[27]

[28] [29]

phase retention time and high-mass accuracy, Anal. Biochem. 396 (2010) 13– 22. D.L. Springer, R.J. Bull, S.C. Goheen, D.M. Sylvester, C.G. Edmonds, Electrospray ionization mass spectrometric characterization of acrylamide adducts to hemoglobin, J. Toxicol. Environ. Health 40 (1993) 161–176. V.G. Allfrey, R. Faulkner, A.E. Mirsky, Acetylation and methylation of histones and their possible role in the regulation of RNA synthesis, Proc. Natl. Acad. Sci. USA 51 (1964) 786–794. S. Chuikov, J.K. Kurash, J.R. Wilson, B. Xiao, N. Justin, G.S. Ivanov, K. McKinney, P. Tempst, C. Prives, S.J. Gamblin, N.A. Barlev, D. Reinberg, Regulation of p53 activity through lysine methylation, Nature 432 (2004) 353–360. A. Kouskouti, E. Scheer, A. Staub, L. Tora, I. Talianidis, Gene-specific modulation of TAF10 function by SET9-mediated methylation, Mol. Cell 14 (2004) 175–182. R.L. Houtz, J.T. Stults, R.M. Mulligan, N.E. Tolbert, Post-translational modifications in the large subunit of ribulose bisphosphate carboxylase/ oxygenase, Proc. Natl. Acad. Sci. USA 86 (1989) 1855–1859. H. Demirci, S.T. Gregory, A.E. Dahlberg, G. Jogl, Multiple-site trimethylation of ribosomal protein L11 by the PrmA methyltransferase, Structure 16 (2008) 1059–1066. J. Huang, S.L. Berger, The emerging field of dynamic lysine methylation of nonhistone proteins, Curr. Opin. Genet. Dev. 18 (2008) 152–158. S.P. Gaucher, A.M. Redding, A. Mukhopadhyay, J.D. Keasling, A.K. Singh, Posttranslational modifications of Desulfovibrio vulgaris Hildenborough sulfate reduction pathway proteins, J. Proteome Res. 7 (2008) 2320–2331.