Identification of two functional nuclear localization signals in the capsid protein of duck circovirus

Virology 436 (2013) 112–117

Contents lists available at SciVerse ScienceDirect

Virology journal homepage: www.elsevier.com/locate/yviro

Identification of two functional nuclear localization signals in the capsid protein of duck circovirus Qi-Wang Xiang a,b, Jin-Feng Zou a,b, Xin Wang a,b, Ya-Ni Sun c, Ji-Ming Gao a,b, Zhi-Jing Xie a,b, Yu Wang d, Yan-Li Zhu a,b, Shi-Jin Jiang a,b,n a

Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Shandong Agricultural University, Shandong, Taian 271018, China Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong, Taian 271018, China c College of Veterinary Medicine, Northwest A & F University, Shanxi, Yangling 712100, China d Department of Basic Medical Sciences, Taishan Medical College, Shandong, Taian 271000, China b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 18 September 2012 Accepted 29 October 2012 Available online 20 November 2012

The capsid protein (CP) of duck circovirus (DuCV) is the major immunogenic protein and has a high proportion of arginine residues concentrated at the N terminus of the protein, which inhibits efficient mRNA translation in prokaryotic expression systems. In this study, we investigated the subcellular distribution of DuCV CP expressed via recombinant baculoviruses in Sf9 cells and the DNA binding activities of the truncated recombinant DuCV CPs. The results showed that two independent bipartite nuclear localization signals (NLSs) situated at N-terminal 1–17 and 18–36 amino acid residue of the CP. Moreover, two expression level regulatory signals (ELRSs) and two DNA binding signals (DBSs) were also mapped to the N terminus of the protein and overlapped with the two NLSs. The ability of CP to bind DNA, coupled with the karyophilic nature of this protein, strongly suggests that it may be responsible for nuclear targeting of the viral genome. & 2012 Elsevier Inc. All rights reserved.

Keywords: Duck circovirus (DuCV) Capsid protein (Cap) Nuclear localization signal (NLS) DNA binding assay

Introduction Duck circovirus (DuCV), a new member of the genus Circovirus of the Circoviridae family, was first found out by Hattermann (Hattermann et al., 2003). The ducks infected with DuCV showed feathering disorders, poor body condition, and low weight. Histopathologic examination of the bursa of Fabricius demonstrated lymphocyte depletion, necrosis, and histiocytosis (Soike et al., 2004). DuCV infection often accompanied with Riemerella anatipestifer, Escherichia coli (E. coli), P. multocida, duck hepatitis virus type 1 (DHV-1), etc (Fringuelli et al., 2005; Chen et al., 2006; Banda et al., 2007; Jiang et al., 2008; Zhang et al., 2009). The DuCV virion is icosahedral, nonenveloped, and 15–16 nm in diameter (Hattermann et al., 2003). The genome of DuCV is a single-stranded circular DNA of about 1.99 kb. Three major open reading frames (ORFs), ORF1, ORF2 and ORF3, have been recognized for DuCV (Hattermann et al., 2003; Xiang et al., 2012). ORF1, called the rep gene, is located in the viral strand and encodes a replication-associated protein (Rep) of 33.6 kDa. ORF2, called the cap gene, is located in the complementary strand and encodes the major immunogenic capsid protein (CP) of 29.7 kDa (Hattermann n Corresponding author at: Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Shandong Agricultural University, Shandong, Taian 271018, China. Fax: þ 86 538 824 5799. E-mail address: [email protected] (S.-J. Jiang).

0042-6822/$ - see front matter & 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.virol.2012.10.035

et al., 2003; Liu et al., 2010). ORF3 is located in the complementary strand of ORF1 and encodes the ORF3 protein with apoptotic activity (Xiang et al., 2012). For lacking an autonomous DNA polymerase, the de novo DNA synthesis of circoviruses are dependent on the host cell’s replication machinery (Meerts et al., 2005). Rep can initialize viral replication, but continuation of the replication is dependent on cellular enzymes expressed during S phase and commences only after the host cell has passed through mitosis (Tischer et al., 1987). DNA replication of DNA viruses usually occurs in the nucleus of infected cells, so the viral DNA needs to cross the nuclear envelope with assistance from nuclear transport apparatus before establishing a productive infection. As aqueous channels in the nuclear envelope, nuclear pore complexes (NPCs) allow the free diffusion of small molecules, but there is a permeability barrier for larger molecules (Fabre and Hurt, 1997; Stoffler et al., 1999). Active transport through the NPC is a selective process triggered by specific transport signals (Mattaj ¨ and Englmeier, 1998; Gorlich and Kutay, 1999). For larger molecules such as viral genomes, protein-mediated nuclear transport has been demonstrated in several viruses (Clever et al., 1991; Liu et al., 1999; Heath et al., 2006; Lin et al., 2009). Proteins are directed in the nucleus via nuclear localization signals (NLSs). In 90% of karyophilic proteins that possess both DNA binding and NLS activities, the NLS sequences usually overlap with the DNA binding domains (Cokol et al., 2000). It has been

Q.-W. Xiang et al. / Virology 436 (2013) 112–117

113

demonstrated that the CPs of porcine circovirus (PCV) and beak and feather disease virus (BFDV) could be transported into the nucleus of infected cells through NPCs mediated by their bipartite NLSs situated at the N terminus of the CPs, and the NLSs overlap the DNA binding regions (DBRs) of the CPs (Liu et al., 2001; Finsterbusch et al., 2005; Heath et al., 2006). The DuCV capsid protein is the major immunogenic protein and has a high proportion of arginine residues concentrated at the N terminus of the protein, which inhibits efficient mRNA translation in prokaryotic expression systems (Liu et al., 2010). Using the online computer program PROSITE (http://prosite.expasy.org/), the CP of DuCV was analyzed and two representative bipartite NLSs were found in the N terminus of the DuCV CP. In order to gain insight into the role of the CP in the life cycle of DuCV, we have investigated the physical interactions of the DuCV CP with the viral DNA. Due to lack of cell culture propagation system for DuCV, the Bac-to-Bac baculovirus expression system was used to express the recombinant CPs of DuCV. The intracellular localization of the DuCV CP is shown to be directed by two NLSs situated at the N terminus of the protein. A DBR has been mapped at the N terminus of the protein, which falls within the two NLSs region.

Results Expression of truncated and EGFP-tagged recombinant DuCV capsid proteins There is a high proportion of basic amino acids at the N termini of different circoviruses’ CPs (Niagro et al., 1998). It is known that the nuclear localization of the CPs of PCV1, PCV2 and BFDV is directed by two or three NLSs located in the N termini of the proteins (Liu et al., 2001; Heath et al., 2006; Shuai et al., 2008). Using the online computer program PROSITE (http://www. expasy.org/prosite), two potential bipartite NLSs, positioned between amino acid residues 2 and 36 of the DuCV CP, were identified (Fig. 1). To test whether these potential NLSs were functional, we constructed a series of plasmids, sequentially deleting N-terminal portions between residues 1 and 36 of the DuCV CP (Fig. 1). Insect cells were infected with recombinant baculoviruses expressing the individual DuCV CP variants. Various proteins in cell lysates were analyzed by Western blot with DuCV-positive sera. While no protein was observed in Sf9 cells infected with wild-type baculovirus (data not shown), various specific protein bands were visualized in the cells infected with various recombinant baculoviruses (Fig. 2). Interestingly, we found that various proteins were expressed at different levels when they were detected in the same conditions. Recombinant protein CP DC36 (with a 36-amino-acid C-terminal deletion) was expressed at a similar level to that of the wt CP, meanwhile recombinant proteins CP DN17 and CP DN18–36 were expressed at another similar level, which was significantly higher than the expression level of the wt CP and notably lower than that of recombinant protein CP DN36 (Fig. 2A). The similar phenomenon was also observed in the co-expression of CP and EGFP (Fig. 2B). DuCV capsid protein is localized to the nucleus To confirm whether the two clusters of basic amino acids at N terminus of DuCV CP were functional NLSs, a series of truncated CPs containing putative NLS were co-expressed with the EGFP. The results showed that EGFP expressed alone was distributed throughout the cytoplasm of infected Sf9 cells, while EGFP-tagged wt CP was observed exclusively in the nuclei of infected cells, and

Fig. 1. Schematic representation of the gene structure of DuCV and the capsid protein derivatives used in this study. (A) Expression of truncated EGFP-tagged recombinant DuCV CPs. (B) Expression of truncated recombinant DuCV CPs. The CPs (gray boxes) had a His6 affinity and the TEV protease recognition site (white boxes) fused to their N termini. The section of CP corresponding to the putative NLSs is indicated by a solid black box. Residues constituting the potential NLSs are concretely indicated. Thin black lines represent the deleted sections in each of the truncated derivatives. The green boxes represent the EGFP fused to the C termini.

fluorescence was generally distributed evenly throughout the nucleus but occasionally appeared around the perinuclear region (Fig. 3A). Partial removal of the putative NLSs did not significantly alter the localization of the fusion proteins, with CP DN17-EGFP and CP DN18–36-EGFP similarly restricted to the nuclei of infected cells as wt CP-EGFP (Fig. 3B). However, CP DN36-EGFP uniformly distributed throughout the cytoplasm of infected Sf9 cells as EGFP, which indicated that deletion of the 36 N-terminal amino acid residues completely abolished translocation of the fusion protein into the nuclei of infected cells (Fig. 3B). A construct carrying the 36 carboxy-terminal residues of CP removal clearly exhibited nuclear import, confirming that the karyophilic activity of the protein is associated with the N-terminal portion of the DuCV CP (Fig. 3B). The results indicated that the two NLSs located at 1–17 and 18–36 N-terminal amino acid residues had nuclear targeting activities respectively. Interestingly, during the metaphase, anaphase, and telophase of cell division, the wt CP located in the nucleus did not diffuse into the cytoplasm with the depolymerization of the nuclear membrane, while the CP DN36 did not diffuse into the nucleus (Fig. 3C). DuCV capsid protein binds DNA Using electrophoretic mobility shift analysis (EMSA), the ability of the DuCV CP to bind DNA was assessed by its ability to retard the electrophoretic movement of the genome DNA of DuCV. The purified wt CP strongly retarded the movement of the

114

Q.-W. Xiang et al. / Virology 436 (2013) 112–117

Fig. 2. Analysis of the expressed CPs in Sf9 cells by Western blotting using DuCV-positive sera. (A) The truncated recombinant DuCV CPs: protein molecular weight marker (lane M), wt CP (lane 1), CP DN17 (lane 2), CP DN18-36 (lane 3), CP DN36 (lane 4), CP DC36 (lane 5), negative control (lane 6). (B) The truncated CPs co-expressed with EGFP: protein molecular weight marker (lane M), the wt CP-EGFP (lane 1), CP DN17-EGFP (lane 2), CP DN17-36-EGFP (lane 3), CP DN36-EGFP (lane 4), CP DC36-EGFP (lane 5), negative control (lane 6).

Fig. 3. (A) Subcellular distribution of DuCV wt CP in Sf9 cells. Left row, EGFP-tagged CP was observed exclusively in the nuclei of infected cells; right row, EGFP expressed alone was distributed throughout the cytoplasm of infected cells. (B) Subcellular distribution of DuCV truncated CPs in Sf9 cells. The top two rows, partial removal of the putative NLSs (CP DN17 and CP DN18-36) similarly restricted the EGFP-tagged CPs in the nuclei of infected cells as wt CP; the third row, removal of the 36 carboxyterminal residues (CP DC36) clearly exhibited nuclear import as wt CP-EGFP; the lowest row, deletion of the 36 N-terminal amino acid residues completely abolished translocation of the fusion protein (CP DN36) into the nuclei of infected cells, resulting in distribution throughout the cytoplasm as EGFP. (C) Subcellular distribution of CP D36 N-EGFP and wt CP-EGFP when the cells were at metaphase, anaphase and telophase of cell division. D36 N-CP-EGFP, during the metaphase, anaphase and telophase of cell division, the CP DN36 did not diffuse into the nuclei of infected cells with the depolymerization of the nuclear membrane; CP-EGFP, during the metaphase, anaphase and telophase of cell division, the wt CP located in the nuclei of infected cells did not diffuse into the cytoplasm. Bars represent 10 mm.

Q.-W. Xiang et al. / Virology 436 (2013) 112–117

Fig. 4. Electrophoretic mobility shift analysis of the interaction of recombinant DuCV CPs with the genome of DuCV: DNA molecular weight marker (Lane M), DNA only (lane 1), DNA and wt CP (lane 2), DNA and wt CP treated with proteinase K (lane 3), DNA and CP DN17 (lane 4), DNA and CP DN18-36 (lane 5), DNA and CP DN36 (Lane 6), DNA and CP DC36 (lane 7).

whole genome DNA of DuCV, while the retardation was completely abolished when the duplicate sample was treated with proteinase K (Fig. 4), which indicated that the retardation was caused by the wt CP binding the genome DNA. To map the DBR of the DuCV CP, the abilities of the truncated CP variants to bind the double-stranded full-length DuCV genome DNA were assayed. CP DN17, CP DN18–36 and CP DC36 retarded the movement of the whole genome DNA of DuCV whereas the removal of the 36 Nterminal residues (CP DN36) completely abolished the retardation of the DuCV genome DNA (Fig. 4). The results suggested that the DBR of CP is situated at the N-terminal 36 amino acid residues and overlapped with the nuclear localization domain.

Discussion As the major immunogenic protein, the DuCV capsid protein has a high proportion of arginine residues at the N terminus of the protein, which inhibits efficient expression in prokaryotic expression systems (Liu et al., 2010). In this study, the wt CP of DuCV was successfully expressed in insect cells in vitro. Western blot assay showed that the purified CP could respond to DuCV-positive serum, which indicated that CP of DuCV had the specific immunogenicity in biological function. Interestingly, when the truncated CPs and EGFP-tagged proteins were expressed in infected Sf9 cells and analyzed by Western blot in the same conditions, the expression levels of the truncated CPs with removed first or second NLS region were higher than that of the wt CP, but were lower than that of the truncated CP with removed N-terminal 36 amino acid residues containing two NLSs (Fig. 2). The result indicated that the NLSs at N-termini of CP of DuCV regulated the expression level of this protein, which might result from the NLS sequences containing a high proportion of basic amino acids as BFDV (Heath et al., 2006). The NLS is exposed on the surface of the virion and is thus available for interaction with a putative NLS receptor (Leclerc et al., 1999). The CPs of several circoviruses containing two or more NLSs at their N termini had been identified, such as PCV1 (Shuai et al., 2008), PCV2 (Liu et al., 2001) and BFDV (Heath et al., 2006). Analyzed by the online computer program PROSITE, two putative NLSs were found at the N terminus of the CP of DuCV. To characterize the role of both the NLSs, the truncated CPs coexpressing with EGFP were expressed in insect cells and analyzed by fluorescence microscopy. The result showed that both the putative NLSs have the nuclear targeting activities and mutation of both the NLSs completely abolished the ability (Fig. 3B).

115

In higher eukaryotic cells the membranous organelle is completely disassembled at the onset of cell division (‘‘open’’ mitosis) (Georgatos et al., 1997). Nuclear envelope breakdown involves two temporally and mechanistically distinct processes: nuclear lamina depolymerization and fragmentation of the nuclear membrane (Newport and Spann, 1987; Peter et al., 1991). After nuclear envelope breakdown, the nucleolar matrix and the chromatin of the cell will be exposed to the cytoplasm. Interestingly, when the nuclear envelope disintegrated during cell division, the wt CP of DuCV located in the nuclei of infected cells did not diffuse into the cytoplasm, while the CP without both the NLSs did not diffuse into nuclear zone from the cytoplasm (Fig. 3C). The results indicated that there was a ‘‘system’’ which could limit the CPs in a certain region. However, the chromatin of the infected cells cannot form the ‘‘system’’ to impede the CP with both the NLSs knocked out diffusing into nuclear zone. So, we speculated that the nuclear skeleton most possibly is the ‘‘system’’ as a boundary between the cytoplasm zone and the nuclear zone in mitosis. It is in contradiction to the view that the cytoplasmic and nuclear compartments of animal cells mix during mitosis on disassembly of the nuclear envelope (Galy et al., 2008). The nuclear targeting region of CP is very important in the virus life cycle. It has been found that the viruses would lose or decrease the ability to infect the host cells by generating the nuclear targeting region-defective mutants or the nuclear targeting regionphosphorylated mutants on CPs (Kann and Gerlich, 1994; Liao and Ou, 1995; Leclerc et al., 1999). In the present study, the CP with both the NLSs knocked out did not diffuse into the nuclear zone with the depolymerization of the nuclear membrane, which suggested that the CP without NLPs could not make the protein adhesion to the nucleolar matrix (nuclear skeleton). Meanwhile, the wt CP did not diffuse into the cytoplasm when nuclear envelope broke down. These results strongly indicated that the NLS region of the protein should be responsible for nuclear matrix targeting. The viral genome is too large to easily enter the nucleus. For many viruses, such as influenza virus (Bui et al., 1996), adenovirus (Greber et al., 1996), SV40 (Wychowski et al., 1987) and HIV (Gallay et al., 1995a, 1995b; Fletcher et al., 1996), it has been shown that one or several viral proteins are used to mediate nuclear import of viral genomes (Leclerc et al., 1999). It was found that there was an overlap between the NLS and DNA-binding region for 90% of karyophilic protein (Cokol et al., 2000). In this study, the result of the DNA-binding assay showed that the utmost N-terminal 36 amino acid residues were essential for DNA binding activity of the DuCV CP, and both the DNA-binding signals (DBSs) overlapped with the two NLSs. This finding is consistent with BFDV (Heath et al., 2006). Interestingly, CP DN17 and CP DC36 exhibited similar retardation activities to the wt CP, while CP DN18-36 exhibited weaker ability to retard the DuCV genome DNA mobile than that of the wt CP (Fig. 4). This result indicated that the DBS situated at N-terminal 18–36 amino acid residue of DuCV CP had more strong binding DNA activity than the one situated at CP N1-17 amino acid residue. In the present study, we defined a segment located at N-terminal 36 amino acid residues of the CP of DuCV as NLSs, DBSs and expression level regulatory signals that mediates association of CP with the nuclear and the viral genome. The ability of CP to bind DNA, coupled with the karyophilic nature of this protein, strongly suggests that it may be responsible for nuclear targeting of the viral genome.

Materials and methods Virus, cells, and sera DuCV strain FJ0601 (EF370476) was detected from the liver of a sick Muscovy duck in Fujian Province of China in 2006

116

Q.-W. Xiang et al. / Virology 436 (2013) 112–117

(Jiang et al., 2008). Grace’s medium and fetal calf serum were purchased from GIBCO BRL (Grand Island, NY, USA). Sf9 cells, DH10Bac cells, pFastBacHTB vector and Lipofectaine 2000 were obtained from Invitrogen (Carlsbad, USA). Horseradish peroxidase (HRP) labeled goat anti-duck antibody was purchased from KPL (Maryland, USA). DuCV-positive sera and DuCV-negative sera were stored in our laboratories, which were the mixtures of serum samples from 10 DuCV-positive ducks and 10 DuCV negative ducks, respectively (Liu et al., 2010). Restriction endonucleases and Taq DNA polymerase were purchased from TaKaRa Biotechnology Co. (TaKaRa, China). Proteinase K was obtained from Roche Applied Science (Penzberg, Germany). Construction of recombinant plasmids and generation of recombinant baculoviruses Based on the nucleotide sequence of DuCV FJ0601 strain (Jiang et al., 2008), two primers were designed to amplify the complete cap gene: wtCP-F (50 -TAAGAATTCATATGCGACGCAGCACCTA-30 ) wtCP-R (50 -ATACTGCAGAACTAGAACCCGGTGAAC-30 ). N-terminaltruncated CP ORFs were generated by amplifying various lengths of the wild-type (wt) CP with primer CPDN17-F (50 -ATAGAATTCATGGTCTACGTAGGAGAC-30 ; 17-amino-acid N-terminal deletion), CPDN36-F (50 -ATAGAATTCATTTTTCAGTAGTGAC-30 ; 36-amino-acid N-terminal deletion), or CPDN18-36-F (50 –ATAGAATTCATATGCGACGCAGCACCTATCGGCGTGCATATCGTGCTAGGAGGAGGAGGCGGTTTTCAGTAGTGACGTTC-30 ; 18–36-amino-acid N-terminal deletion) (sequence encoding 1–17-amino-acid N-terminal is indicated in boldface type, sequence encoding 37–42-amino-acid N-terminal is indicated in italics type), used in conjunction with primer wtCP-R. The PCR products were digested with EcoR I and Xho I and were inserted into corresponding region of pFastBacHTB, resulting in recombinant plasmids pF-CP, pF-CPDN17, pF-CPDN36, pF-CPDN1836, respectively. The pFastBac HT donor plasmid is designed to express a His6 sequence and the tobacco etch virus (TEV) proteinase cleavage site fused to the N terminus of the gene of interest. In addition to the wild-type and N-terminal-truncated CP ORFs, a fifth CP ORF, in which the 36 carboxy-terminal residues were removed, was amplified by PCR using primers wtCP-F and CPDC36R(50 -ATACTGCAGAAGAACTGACCTTTGTTCG-30 ). The PCR product also was digested with EcoR I and Xho I and was inserted into corresponding region of pFastBacHTB, yielding plasmid pFCPDC36. The integrity of the ORFs was verified by sequence analysis. Fig. 1A shows the truncated ORFs in relation to the wt CP. Meanwhile, the gene encoding enhanced green fluorescence protein (EGFP) was amplified by PCR using primers EGFP-F (50 ATTGCATGCATGGTGAGCAAGGGC-30 ) and EGFP-R (50 -CCGAAGCTTTTACTTGTACAGCTCGTC-30 ) used plasmid as template. The PCR product was digested with Sph I and Hind III and was inserted into corresponding region of pFastBacHTB, yielding plasmid pFEGFP. The whole CP gene, a series of N-terminal deletion (17amino-acid, 18–36-amino-acid and 36-amino-acid N-terminal deletion), and 36-amino-acid C-terminal deletion mutants were generated by PCR using various primers (the termination codon were excised). Then the PCR products were digested with EcoR I and Pst I and inserted into corresponding region of pF-EGFP, yielding plasmids pF-CP-EGFP, pF-CPDN17-EGFP, pF-CPDN18-36EGFP, pF-CPDN36-EGFP and pF-CPDC36-EGFP. Fig. 1B shows the truncated ORFs in relation to the wt CP. All the recombinant plasmids were verified by sequence analysis, and transformed into E. coli DH10Bac cells (Invitrogen), containing a helper vector which facilitates the transposition of the recombinant fragment into the baculovirus shuttle vector (bacmid). Sf9 cells were transfected with purified recombinant bacmid DNA by the use of Lipofectaine 2000 (Invitrogen) according to the manufacturer’s protocols. After incubation for 72 h at

27 1C, the supernatant containing recombinant viruses were harvested. Viral titer was determined by multiplicity of infection (MOI) assay. Expression and purification of recombinant proteins High-titer stocks of viruses were prepared by a single passage of infecting Sf9 cells with a MOI of 0.1. Recombinant proteins were extracted from cells infected viruses at a MOI of 5. Infected cells were harvested 72 h postinfection (hpi), collected into centrifuge tubes, and washed three times with phosphate buffered saline (PBS; 8.1 mM Na2HPO4, 1.5 mM KH2PO4, 140 mM NaC1, 3.0 mM KC1, pH 7.2). Extraction of proteomics was achieved using Nuclear and Cytoplasmic Extraction Kit (CWBIO, Beijing, China), according to the manufacturer’s protocols. The proteins of interest were purified from the proteomics by CsCl gradient centrifugation. Briefly, the proteomics were layered onto top of 40% (w/v) sucore cushion in PBS and centrifuged at 270000 g for 6 h at 18 1C. The supernatant was discarded and the pellet was resuspended in PBS and centrifuged to equilibrium in 37% CsCl in water at 270000 g for 48 h at 18 1C. The band of interest was collected and diluted in PBS followed by dialysis with three changes of the buffer, then the purified protein was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), Western blotting and DNA binding assay. SDS-PAGE and western blotting analysis of recombinant proteins Samples were diluted in sample treatment buffer, heated to 100 1C for 10 min, and subjected to electrophoresis on 12% denaturing SDS-polyacrylamide gels. Proteins were stained with Coomassie blue to visualize the bands. For Western blotting, proteins were electrotransferred onto PVDF membranes of 0.45 mm pore size (Millipore, USA) by using a Trans-Blot semidry transfer cell (Bio-Rad). After blocking the membranes by incubating with 1% bovine serum albumin (BSA) in PBS and washing with PBS containing 0.01% Tween-20 (PBST), membranes were cut to strips which were individually incubated at 37 1C for 2 h with DuCV-positive sera (1:100), diluted in blocking buffer for 2 h at room temperature. The membranes were washed three times with PBS plus 0.05% Tween 20 and incubated with HRPconjugated goat anti-duck IgG (1:1000). After washing five times, the substrate of diamino benzidine (DAB) was used to visualize the reaction. Fluorescence microscope (FM) At a confluence of 70%–80% on glass slides, Sf9 cells were infected with the recombinant baculoviruses (Bac-EGFP, Bac-CPEGFP, Bac-CPDN17-EGFP, Bac-CPDN18–36-EGFP, Bac-CPDN36EGFP and Bac-CPDC36-EGFP) at a MOI of 0.1. After 72 hpi, the Sf9 cells were washed, mounted and analyzed by fluorescence microscopy (Leica AF6000) to capture the images. The Sf9 cells infected with wild-type baculovirus at the same MOI were used as negative controls. DNA binding assay The ability of each variant of the DuCV CP to bind the DuCV genome DNA was assessed by EMSA. The plasmid pF-DuCV containing a tandem repeat of entire DuCV genome in pFastBacHTB vector was constructed, and digested with restriction enzymes EcoR I/Hind III. After purifying, the DuCV genome DNA product was diluted to 100 mg/ml in binding buffer (10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 1 mM MgCl2, 0.5 mM DTT, 50 mg/ml poly (dl-dC) and 4% glycerol). Purified proteins were diluted to 5 mg/ml

Q.-W. Xiang et al. / Virology 436 (2013) 112–117

in binding buffer and mixed with the DuCV genome DNA product at the appropriate proportions (10:1) in a final volume of 25 ml. In order to confirm that the observed retardation of the DNA fragment was indeed caused by the purified proteins, duplicate samples were treated with 1 mg/ml proteinase K. After incubation at 37 1C for 1 h, the samples were subjected to electrophoresis on 0.8% agarose gels. DNA was stained with 0.5 mg/ml ethidium bromide and visualized by UV illumination.

Acknowledgments This study was supported by the grant of Shandong Province Higher Educational Science and Technology Program (J08LF07) and the Science and Technology Commission of Shandong Province (2010GNC10914), China. References Banda, A., Galloway-Haskins, R.I., Sandhu, T.S., Schat, K.A., 2007. Genetic analysis of a duck circovirus detected in commercial pekin ducks in New York. Avian Dis. 51, 90–95. Bui, M., Whittaker, G., Helenius, A., 1996. Effect of M1 protein and low pH on nuclear transport of influenza virus ribonucleoproteins. J. Virol. 70, 8391–8401. Chen, C.L., Wang, P.X., Lee, M.S., Shien, J.H., Shien, H.K., Ou, S.J., Chen, C.H., Chang, P.C., 2006. Development of a polymerase chain reaction procedure for detection and differentiation of duck and goose circovirus. Avian Dis. 50, 92–95. Clever, J., Yamada, M., Kasamatsu, H., 1991. Import of simian virus 40 virions through nuclear pore complexes. Proc. Natl. Acad. Sci. USA 88, 7333–7337. Cokol, M., Nair, R., Rost, B., 2000. Finding nuclear localization signals. EMBO Rep. 1, 411–415. Fabre, E., Hurt, E., 1997. Yeast genetics to dissect the nuclear pore complex and nucleocytoplasmic trafficking. Annu. Rev. Genet. 31, 277–313. Finsterbusch, T., Steinfeldt, T., Caliskan, R., Mankertz, A., 2005. Analysis of the subcellular localization of the proteins Rep, Rep’ and Cap of porcine circovirus type 1. Virology 343, 36–46. Fletcher 3rd, T.M., Brichacek, B., Sharova, N., Newman, M.A., Stivahtis, G., Sharp, P.M., Emerman, M., Hahn, B.H., Stevenson, M., 1996. Nuclear import and cell cycle arrest functions of the HIV-1 Vpr protein are encoded by two separate genes in HIV-2/SIV(SM). EMBO J. 15, 6155–6165. Fringuelli, E., Scott, A.N., Beckett, A., McKillen, J., Smyth, J.A., Palya, V., Glavits, R., Ivanics, E., Mankertz, A., Franciosini, M.P., Todd, D., 2005. Diagnosis of duck circovirus infections by conventional and real-time polymerase chain reaction tests. Avian Pathol. 34, 495–500. Gallay, P., Swingler, S., Aiken, C., Trono, D., 1995a. HIV-1 infection of nondividing cells: C-terminal tyrosine phosphorylation of the viral matrix protein is a key regulator. Cell 80, 379–388. Gallay, P., Swingler, S., Song, J., Bushman, F., Trono, D., 1995b. HIV nuclear import is governed by the phosphotyrosine-mediated binding of matrix to the core domain of integrase. Cell 83, 569–576. Galy, V., Antonin, W., Jaedicke, A., Sachse, M., Santarella, R., Haselmann, U., Mattaj, I., 2008. A role for gp210 in mitotic nuclear-envelope breakdown. J. Cell Sci. 121, 317–328. Georgatos, S.D., Pyrpasopoulou, A., Theodoropoulos, P.A., 1997. Nuclear envelope breakdown in mammalian cells involves stepwise lamina disassembly and microtubule-drive deformation of the nuclear membrane. J. Cell Sci. 110, 2129–2140. ¨ Gorlich, D., Kutay, U., 1999. Transport between the cell nucleus and the cytoplasm. Annu. Rev. Cell Dev. Biol. 15, 607–660.

117

Greber, U.F., Webster, P., Weber, J., Helenius, A., 1996. The role of the adenovirus protease on virus entry into cells. EMBO J. 15, 1766–1777. Hattermann, K., Schmmitt, C., Soike, D., Mankertz, A., 2003. Cloning and sequencing of duck circovirus (DuCV). Arch. Virol. 148, 2471–2480. Heath, L., Williamson, A.L., Rybicki, E.P., 2006. The capsid protein of beak and feather disease virus binds to the viral DNA and is responsible for transporting the replication-associated protein into the nucleus. J. Virol. 80, 7219–7225. Jiang, S.J., Zhang, X.X., Liu, S.N., Wang, Y., Kong, Y.B, Wei, X.L., Sun, Y.N, Zhao, Q., 2008. PCR detection and sequence analysis of duck circovirus in sick Muscovy ducks. Virol. Sin. 23, 265–271. Kann, M., Gerlich, W.H., 1994. Effect of core protein phosphorylation by protein kinase C on encapsidation of RNA within core particles of hepatitis B virus. J. Virol. 68, 7993–8000. Leclerc, D., Chapdelaine, Y., Hohn, T., 1999. Nuclear targeting of the cauliflower mosaic virus coat protein. J. Virol. 73, 553–560. Liao, W., Ou, J.H., 1995. Phosphorylation and nuclear localization of the hepatitis B virus core protein: significance of serine in the three repeated SPRRR motifs. J. Virol. 69, 1025–1029. Lin, W.L., Chien, M.S., Du, Y.M., Wu, P.C., Huang, C., 2009. The N-terminus of porcine circovirus type 2 replication protein is required for nuclear localization and ori binding activities. Biochem. Biophys. Res. Commun. 379, 1066–1071. Liu, H., Boulton, M.I., Thomas, C.L., Prior, D.A., Oparka, K.J., Davies, J.W., 1999. Maize streak virus coat protein is karyophyllic and facilitates nuclear transport of viral DNA. Mol. Plant Microbe Interact. 12, 894–900. Liu, Q., Tikoo, S.K., Babiuk, L.A., 2001. Nuclear localization of the ORF2 protein encoded by porcine circovirus type 2. Virology 285, 91–99. Liu, S.N., Zhang, X.X., Zou, J.F., Xie, Z.J., Zhu, Y.L., Zhao, Q., Zhou, E.M., Jiang, S.J., 2010. Development of an indirect ELISA for the detection of duck circovirus. Vet. Microbiol. 145, 41–46. Mattaj, I.W., Englmeier, L., 1998. Nucleocytoplasmic transport: the soluble phase. Annu. Rev. Biochem. 67, 265–306. Meerts, P., Misinzo, G., McNeilly, F., Nauwynck, H.J., 2005. Replication kinetics of different porcine circovirus 2 strains in PK-15 cells, fetal cardiomyocytes and macrophages. Arch. Virol. 150, 427–441. Newport, J., Spann, T., 1987. Disassembly of the nucleus in mitotic extracts: membrane vesicularization, lamin disassembly, and chromosome condensation are independent processes. Cell 48, 219–230. Niagro, F.D., Forsthoefel, A.N., Lawther, R.P., Kamalanathan, L., Ritchie, B.W., Latimer, K.S., Lukert, P.D., 1998. Beak and feather disease virus and porcine circovirus genomes: intermediates between the geminiviruses and plant circoviruses. Arch. Virol. 143, 1723–1744. Peter, M., Heitlinger, E., Haner, M., Aebi, U., Nigg, E.A., 1991. Disassembly of in vitro formed lamin head-to-tail polymers by CDC2 kinase. EMBO J. 10, 1535–1544. Shuai, J., Wei, W., Jiang, L., Li, X., Chen, N., Fang, W., 2008. Mapping of the nuclear localization signals in open reading frame 2 protein from porcine circovirus type 1. Acta. Biochim. Biophys Sin. (Shanghai) 40, 71–77. Soike, D., Albrecht, K., Hattermann, K., Schmitt, C., Mankertz, A., 2004. Novel circovirus in mulard ducks with developmental and feathering disorders. Vet. Rec. 154, 792–793. Stoffler, D., Fahrenkrog, B., Aebi, U., 1999. The nuclear pore complex: from molecular architecture to functional dynamics. Curr. Opin. Cell Biol. 11, 391–401. Tischer, I., Peters, D., Rasch, R., Pociuli, S., 1987. Replication of porcine circovirus: induction by glucosamine and cell cycle dependence. Arch. Virol. 96, 39–57. Wychowski, C., Benichou, D., Girard, M., 1987. The intranuclear localization of simian virus 40 polypeptides Vp2 and Vp3 depends on a specific amino acid sequence. J. Virol. 61, 3862–3869. Xiang, Q.W., Wang, X., Xie, Z.J., Sun, Y.N., Zhu, Y.L., Wang, S.J., Liu, H.J., Jiang, S.J., 2012. ORF3 of duck circovirus: a novel protein with apoptotic activity. Vet. Microbiol. 159, 251–256. Zhang, X., Jiang, S., Wu, J., Zhao, Q., Sun, Y., Kong, Y., Li, X., Yao, M., Chai, T., 2009. An investigation of duck circovirus and co-infection in Cherry Valley ducks in Shandong Province, China. Vet. Microbiol. 133, 252–256.