Identification of two isoforms of CYP4 in Marsupenaeus japonicus and their mRNA expression profile response to benzo[a]pyrene

Marine Environmental Research 112 (2015) 96e103

Contents lists available at ScienceDirect

Marine Environmental Research journal homepage: www.elsevier.com/locate/marenvrev

Identification of two isoforms of CYP4 in Marsupenaeus japonicus and their mRNA expression profile response to benzo[a]pyrene Jinbin Zheng, Yong Mao*, Yin Qiao, Zhuangzhuang Shi, Yongquan Su, Jun Wang College of Ocean and Earth Sciences, Xiamen University, Xiamen 361102, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 7 July 2015 Received in revised form 23 September 2015 Accepted 27 September 2015 Available online 9 October 2015

CYP4 enzymes are essential components of cellular detoxification systems and play important roles in monitoring persistent organic pollutants in marine environments. However, there are few studies on CYP4 in shrimp. In this study, two CYP4 isoforms, CYP4V28 and CYP4V29, were cloned from Marsupenaeus japonicus for the first time, and the tissue distributions and mRNA expression profile in response to benzo[a]pyrene (B[a]P) were analyzed by quantitative real-time PCR (QRT-PCR). The full lengths of CYP4V28 and CYP4V29 were 1771 bp and 1647 bp respectively, with deduced amino acid sequences of 511 and 515 amino acids. The two CYP4s were predominantly expressed in the hepatopancreas and weakly expressed in other six tested tissues. As demonstrated by QRT-PCR, the mRNA levels of the two CYP4s show both a time- and dose-dependent response to B[a]P. The mRNA expression levels of CYP4V28 and CYP4V29 peaked at 12 h and 6 h respectively, and the peak level exhibited a tendency of positive correlation with the concentration of B[a]P. This study provides clues for further elucidating the function and regulation mechanisms of the two CYP4s in M. japonicas and evaluating of the biomarker potential of the two CYP4 isoforms. © 2015 Elsevier Ltd. All rights reserved.

Keywords: Marsupenaeus japonicus CYP4 PAHs Benzo[a]pyrene Detoxification Biomarker

1. Introduction The kuruma shrimp Marsupenaeus japonicus is widely distributed throughout the Indo-Western Pacific. It is one of the important species in shrimp fisheries and aquaculture in China, Australia and many Southeast Asian countries (Tsoi et al., 2005 Feng et al., 2014). For the seedling breeding industry in China, the broodstock used for generating larvae are mainly obtained from the wild, especially from Taiwan Strait. However, with the rapid development of the Chinese economy, the strait has become an important ocean route, and the maritime transportation, oil production and military activities along the coast of Taiwan Strait have been very active. Oils spilled from these activities have created serious petroleum pollution in the Taiwan Strait and poses a significant threat to the genetic resources of M. japonicus and the sustainable healthy development of the Chinese shrimp industry (Chiau, 2005; Lin et al., 2013; Ren et al., 2014). Amongst petroleum pollutants, polycyclic aromatic hydrocarbons (PAHs) have received increased attention and have been discussed in many studies (Soclo et al.,

* Corresponding author. College of Ocean and Earth Sciences, Xiamen University, South Xiangan Road, 361102 Xiamen, China. E-mail address: [email protected] (Y. Mao). http://dx.doi.org/10.1016/j.marenvres.2015.09.012 0141-1136/© 2015 Elsevier Ltd. All rights reserved.

2000; Srogi, 2007; Shimada, 2006; Incardona et al., 2004). PAHs are aromatic hydrocarbons with two or more fused benzene rings (Haritash and Kaushik, 2009). Most such compounds show high carcinogenic and mutagenic activities (Pauzi Zakaria et al., 2001) and lead to oxidative stress, reproductive impairment, growth inhibition and locomotion difficulties (Silva et al., 2013). Benzo[a]pyrene (B[a]P), a model PAHs compound containing five fused benzene rings (Juhasz and Naidu, 2000), has been identified as being highly carcinogenic (Kuo et al., 1998; Wang et al., 2002). B[a]P is commonly found in marine environments, especially after oil spills accidents (Banni et al., 2010), and is ultimately deposited in the sediment, leading to a much higher sediment concentration (12.2e96.8 mg/L) in the sediment (Bo et al., 2014). The primary biological system for detoxifying/biotransforming PAHs is the cytochrome P450 (CYP) system, which constitutes a superfamily of heme enzymes that can bind and activate two atoms of oxygen from the substrate molecule and utilize one of their oxygen atoms for monooxygenation (Guengerich, 2001; Nebert and Dalton, 2006; Nelson et al., 2013). The CYP family 4 (CYP4) is among the oldest CYP families (Simpson, 1997), and CYP4 enzymes share a highly conserved sequence of 13 residues with the function of proton transfer, which play an important role in monooxygenation (Rewitz et al., 2004). The primary functions of the

J. Zheng et al. / Marine Environmental Research 112 (2015) 96e103

97

Table 1 PCR primers for cloning and qRT-PCR. Primers

Sequence (50 e30 )

Sequence information

Amplicon length

Primer efficiency

R2

CYP4V28-F CYP4V28-R CYP4V29-F CYP4V29-R CYP4V28-30 CYP4V29-30 CYP4V28-50 -Outer CYP4V28-50 -Inner CYP4V29-50 -Outer CYP4V29-50 -Inner CYP4V28-RT-F CYP4V28-RT-R CYP4V29-RT-F CYP4V29-RT-R EF1-a-F EF1-a-R

ACCAGCAAGTTGGGTGAAG GCGTAAGGATGCCTGTGTT GCAGGAAGCACGACCACT GAATGTCACTCTCCACGC ACCAGCAAGTTGGGTGAAG GCAGGAAGCACGACCACT CACTTGCTTCCTGTGGCTGTCA GTCGGCATAAAACCAATCCAGA GTGGATGACCTTGACGCAGTGG CGCACACAGGGGTGATGTAATG CAGAGGGGCAGAGGCTATTC CTTGCTTCCTGTGGCTGTCA GCGGTATTCCAAGGCTCG GGATGCGGTAGTTTTTGATTTG GGAACTGGAGGCAGGACC AGCCACCGTTTGCTTCAT

cDNA fragment cDNA fragment cDNA fragment cDNA fragment 30 -RACE PCR 30 -RACE PCR 5-RACE PCR 50 -RACE PCR 50 -RACE PCR 50 -RACE PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR internal control internal control

1122bp 1122bp 732bp 732bp 1499bp 857bp 455bp 323bp 825bp 628bp 112bp 112bp 160bp 160bp 248bp 248bp

/ / / / / / / / / / 101.07% 101.07% 109.65% 109.65% 101.18% 101.18%

/ / / / / / / / / / 0.998 0.998 0.994 0.994 0.999 0.999

vertebrate CYP4 enzymes are catalyzing the metabolism of fatty acids and eicosanoids (Kikuta et al., 2002; Kirischian and Wilson, 2012). Studies on the CYP4s in marine invertebrates indicated that they respond to exogenous compounds in a dose- and timedependent manner and show potential as biomarkers in marine environment monitoring (Rewitz et al., 2004, 2006; Pan et al., 2011; Li et al., 2004). In this study, two isoforms of CYP4 in M. japonicus were cloned and characterized for the first time, and their tissue distributions and mRNA expression profiles in response to B[a]P were clarified by QRT-PCR. The current study provided basic data for the further studies evaluating the biomarker potential of the two CYP4 isoforms to monitor PAHs pollution in marine environments. 2. Materials and methods 2.1. Animals and samples All M. japonicus prawns (Variety I, 6.53 ± 1.80 g in body weight) were obtained from an aquaculture farm in Dongshang (Zhangzhou, Fujian, China), and acclimated in environmentally controlled flat-bottomed rectangular tanks (70 cm
50 cm
40 cm) with aerated seawater at 22  C and a salinity of 28 parts per thousand (ppt) prior to the experiment. The seawater was renewed daily, and prawns were fed twice daily with commercial pellets (41% protein, 6.0% fat, 5.0% fiber and 16% ash). After the acclimatization period, the prawns were randomly divided into five tanks with 100 L test solution, each tanks containing 40 individuals. The exposure experiment was conducted as described by Zhang et al. (2012) with slight modification. We prepared 0.5 mg/L, 5 mg/L and 50 mg/L B[a]P (analytical purity, CAS number 50-32-8, J&K Scientific, China) stock solution using 1% DMSO (analytical purity, CAS number 67-68-5, J&K Scientific, China) as the solvent. The prawns were treated with B[a]P at final concentrations of 0.5 mg/L, 5 mg/L and 50 mg/L. These concentrations of B[a]P have been previously reported in the coastal waters of southeast China (Wu et al., 2011; Zhang et al., 2004). Prawns cultured in normal filtered sea water (FSW) and FSW containing 0.001% DMSO (v/v) were used as the blank and control groups, respectively. The toxicant-laden seawater was renewed daily, and the prawns were not fed during exposure. The hepatopancreas of five individuals from each treatment was randomly sampled after exposure for 0 h, 6 h, 12 h, 24 h, 48 h and 96 h respectively to measure the expression patterns of the two CYP4s in response to B[a]P exposure. The hepatopancreas, gill, muscle, heart, stomach, intestine and eyestalk from five untreated

prawns were also collected to determine the tissue distribution of the two CYP4s. All the samples were immediately frozen at 80  C until the extraction of total RNA for analysis. 2.2. Full-length cDNA cloning and sequence analysis 2.2.1. Total RNA extraction and cDNA synthesis Total RNA was extracted using RNAiso Plus (TaKaRa, Dalian China) following the manufacturer's instructions. The purity of the total RNA was detected by a Nanodrop 1000 (Thermo-scientific, USA) at A260 nm and A280 nm, and the integrity was ensured through analysis on a 1.0% (w/v) agarose gel. Reverse transcription was conducted using TransScript II First-Strand cDNA Synthesis SuperMix (TransGen Biotech, BeiJing, China) following the manufacturer's instructions. The reverse transcription product was stored at 20  C for subsequent PCR-based procedures as the newly synthesized first-strand cDNA. Table 2 Identity (%) of the deduced AA sequences of the CYP4V28 and CYP4V29 in M. japonicas with other reported CYP4s. CYP4s

M. japonicas CYP4V28

M. japonicas CYP4V29

M. japonicas CYP4V28 M. japonicas CYP4V29 F. chinensis CYP4V19 L. vannamei CYP4V18 P. trituberculatus CYP4C C. maenas CYP4C39 E. carinicauda CYP4C M. nipponense CYP4V20 O. limosus CYP4C15 C. quadricarinatus CYP4 D. melanogaster CYP4C3 D. magna CYP4 G. gallus CYP4V2 D. rerio CYP4V8 B. mori CYP4G23 H. sapiens CYP4F8 R. norvegicus CYP4F1 B. Taurus CYP4B1

/ 52.3 51.7 62.1 57.1 56.9 56.5 55.3 53.3 50.0 44.6 44.4 44.2 41.9 34.8 31.6 31.2 30.6

52.3 / 85.0 57.0 56.3 54.6 54.0 52.0 58.1 47.6 42.9 44.6 43.2 42.3 34.6 30.0 29.7 29.6

The GenBank accession numbers of the sequences used in the table are as follows: F. chinensis CYP4V19(ACZ48687.1); L. vannamei CYP4V18 (ADD63783.1); P. trituberculatus CYP4C (AFH35031.1); C. maenas CYP4C39; E. carinicauda CYP4C (AFM82473.1); M. nipponense CYP4V20 (AFA26603.1); O. limosus CYP4C15(AAF09264.1); C. quadricarinatus CYP4 (AAL56662.1); D. melanogaster CYP4C3 (NP_524598.1); D. magna CYP4 (BAF35771.1); G. gallus CYP4V2 (NP_001001879.1); D. rerio CYP4V8 (NP_001071070.1); B. mori CYP4G23; H. sapiens CYP4F8 (NP_009184.1); R. norvegicus CYP4F1(NP_062569.2); B. Taurus CYP4B1(NP_001069670.1).

98

J. Zheng et al. / Marine Environmental Research 112 (2015) 96e103

J. Zheng et al. / Marine Environmental Research 112 (2015) 96e103

2.2.2. Cloning and sequencing of partial cDNA fragment For this purpose, cDNA fragments of the two CYP4 isoforms were PCR-amplified with the primer pairs described in Table 1. Primers were designed based on the partial sequence of the two CYP4 isoforms identified from the transcriptome sequencing analysis of M. japonicus by the Primer Premier 5.0 software (Ren et al., 2004). PCR amplification was performed as follows: one initial denaturing step of 5 min at 95  C, followed by 30 cycles of 95  C for 30 s, 55  C for 30 s, 72  C for 1 min 30 s, and a final extension at 72  C for 10 min. Amplification products were ligated into pMD19-T vector (Takara, Dalian, China) and sequenced in both directions. The sequences were identified using the BLAST program (http://www.ncbi.nlm.gov/blast).

2.2.3. Rapid amplification of cDNA ends (RACE) After determination of the partial cDNA sequences, RACE-PCR was performed to obtain the full-length cDNA. All primers are described in Table 1. The 30 -RACE and 50 -RACE reactions were conducted using the 30 -Full RACE Core Set with PrimeScript™ RTase (TaKaRa, Dalian China) and the 50 -Full RACE Kit with TAP (TaKaRa, Dalian China) according to the manufacturer's protocols, respectively. The 30 -RACE reaction was conducted in the following conditions: 94  C for 3 min, followed by 30 cycles of 94  C for 30 s, 60  C for 30 s, and 72  C for 1 min 30 s, and a final extension at 72  C for 10 min. The first round of the 50 -RACE reaction was conducted in the following conditions: 95  C for 5 min, followed by 30 cycles of 95  C for 30 s, 63.4/64.8  C for 30 s, 72  C for 1 min, and a final extension at 72  C for 10 min. A secondary nested PCR was then conducted using the primary PCR product as the template with the following amplification profile: 95  C for 5 min, followed by 30 cycles of 95  C for 30 s, 61.6 C/63.4  C for 30 s, 72  C for 1 min, and a final extension at 72  C for 10 min. Both the 50 -RACE and 30 -RACE products were cloned into pMD19-T vector (Takara, Dalian, China) and sequenced and identified as previously described. The fulllength cDNA of CYP4V28 and CYP4V29 was obtained by splicing the mid-fragment, 50 -end and 30 -end.

99

2.3. Tissue expression analysis in normal M. japonicus and mRNA expression modulation under B[a]P exposure of the two CYP4 isoforms The tissue distributions and expression levels of the two CYP4s transcript after B[a]P exposure were measured by SYBR Green quantitative real-time PCR (QRT-PCR) performed on an Applied Biosystems 7500 fast Real-time PCR System (Applied Biosystems, USA). The specific primers (Table 1) were designed based on the full-length cDNA sequence of the two CYP4s. A pair of elongation factor 1-a (EF1-a) primers (Table 1) served as the reference for internal standardization (Zhang et al., 2013). The real-time PCR was conducted in a total volume of 20 ml, containing 10 ml SYBR® Premix ExTaqⅡ(2
) (TaKaRa, Japan), 0.6 ml of each of primers (10 mM), 0.4 ml Rox Reference DyeⅡ(50
), 2 ml cDNA, and 6.4 ml DEPC-treated water. The PCR cycling conditions were as follows: 95  C for 30 s, followed by 40 cycles of 95  C for 3 s, 60  C for 30 s and 72  C for 30 s. Melting curve analysis was performed at the end of the reaction to confirm that only one PCR product was amplified and detected. Tissues including the hepatopancreas, gill, muscle, heart, stomach, intestine and eyestalk from five untreated prawns were individually tested and each sample assayed in triplicate. We first calculated the slopes and regression curve of the standard curves to determine the efficiency of the PCR reaction with 7 tenfold dilutions of template. The PCR efficiency (E) was calculated according to the equation E ¼ 10(1/slope) 1. The 2DDCt method was used to estimate the relative mRNA expression level as previously described (Livak and Schmittgen, 2001). The relative expression level of the two CYPs was 2DDCt where DDCT ¼ DCT, test sample  CT,baseline sample, and DCT ¼ CT, target gene  CT, internal control gene. Multiple comparisons of the relative level of mRNA between tissues were performed using one-way analysis of variance (ANOVA) followed by multiple comparison testing with the LSD-t test using the SPSS 17.0 software. P-values less than 0.01 were considered to represent statistically significant difference of expressions. 3. Results 3.1. Full-length cDNA and deduced amino acid sequences of the two CYP4 isoforms in M. japonicus

2.2.4. Sequence analysis The Open Reading Frames (ORFs) of the cDNA of the two CYP4s in M. japonicus were predicted using the ORF Finder (http://www. ncbi.nlm.nih.gov/gorf/gorf.html). The amino acid sequences were deduced by the DNAMAN software (Lynnon Biosoft, Quebec, Canada). The protein molecular mass and isoelectric point (pI) were predicted using the ProtParam program (http://web.expasy.org/ protparam/). The AA % identity between CYP4s was determined using BioEdit (Hall, 2004). The PROSITE program was used to analyze the functional sites of the deduced amino acid sequences (http://www.expasy.org/prosite). Multiple alignments were performed using ClustalW (Zhang et al., 2012) and the multiple alignment display program ESPript3.0 (http://espript.ibcp.fr/ ESPript/ESPript/). A neighbor-joining phylogenetic tree was constructed by MEGA 5.05 (Ku et al., 2014) with 1000 bootstrap replicates.

The full-length cDNA sequences and the corresponding deduced amino acid (AA) sequences of the two CYP4 isoforms identified in M. japonicus were established for the first time (Supplementary Fig. 1). The sequences of the two CYP4 isoforms (GenBank accession number: KP234016 and KP234017) in M. japonicus were named CYP4V28 and CYP4V29 by the CYP Nomenclature Committee (Professor David Nelson, personal communication). The fulllength CYP4V28 cDNA was 1771 bp long with a 50 -untranslated region (UTR) of 57 bp (1e57 bp) and a 30 -UTR of 178 bp (1594e1771 bp). The open reading frame (ORF) was 1536 bp (58e1593 bp) encoding a polypeptide of 511 AA with the predicted molecular weight of 58.84 kDa and a theoretical pI of 8.28 (Supplementary Fig. 1A). The full-length CYP4V29 cDNA was 1647 bp long with a 50 - UTR of 57 bp (1e57 bp) and a 30 -UTR of 42 bp (1606e1647 bp). The ORF was 1548 bp (58e1605 bp),

Fig. 1. Multiple alignments of the deduced AA sequences of the two CYP4 isoforms in M. japonicus with other known CYP4s. Highly conserved AA residues are shown by the blue box and identical residues are shaded in red. The typical heme-binding and proton-transferring domains of CYP are underlined in black and red, respectively. The GenBank accession numbers of the sequences used in the figure are as follows: Fenneropenaeus chinensis CYP4V19 (ACZ48687.1); Litopenaeus vannamei CYP4V18 (ADD63783.1); Cherax quadricarinatus CYP4 (AAL56662.1); Exopalaemon carinicauda CYP4C (AFM82473.1); Macrobrachium nipponense CYP4V20 (AFA26603.1); Orconectes limosus CYP4C15(AAF09264.1) Portunus trituberculatus CYP4C (AFH35031.1); Carcinus maenas CYP4C39(AAQ93010.1) Daphnia magna CYP4 (BAF35771.1); Drosophila melanogaster CYP4C3 (NP_524598.1); Perinereis aibuhitensis CYP4 (AFK24489.1); Perna viridis CYP4 (ABZ81919.1); Danio rerio CYP4V8 (NP_001071070.1); Homo sapiens CYP4F8(NP_009184.1). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

100

J. Zheng et al. / Marine Environmental Research 112 (2015) 96e103

encoding a polypeptide of 515 AA with the predicted molecular weight of 59.86 kDa and a theoretical pI of 8.76 (Supplementary Fig. 1B). The CYP superfamily signature motif, a highly conserved heme-binding domain (FxxGxRxCxG), was located near the C-terminals of CYP4V28 and CYP4V29 (450e459 AA and 454e463 AA, respectively) serving as a ligand to the heme iron. The CYP4 signature motif, EVDTFMFEGHDTT, a characteristic conserved domain with the function of proton transfer during monooxygenation was present in CYP4V28 (312-324AA), while in CYP4V29, the AA sequence of the proton transfer domain was EVNTFMFAGHDTT (316-328AA) (Supplementary Fig. 1). 3.2. Multiple sequences alignment The AA % identity between the two CYP4s in M. japonicas and certain selected CYP4s from different animal groups indicated that the two CYP4 isoforms showed 52.3% identity with each other. CYP4V28 and CYP4V29 shared highest identity to Litopenaeus vannamei CYP4V18 (62.1%) and Fenneropenaeus chinensis CYP4V19 (85%), respectively (Table 2). Multiple alignments of CYP4s showed that the CYP heme-iron ligand signature and the proton transfer domain were highly conserved among different species (Fig. 1). 3.3. Phylogenetic analysis Phylogenetic trees were constructed to determine the relationship of the two CYP4 isoforms with other representative members of the CYP superfamily (Fig. 2). The phylogenetic tree formed four well-defined clades, namely Clan2, Clan3, Clan4 and the Mitochondrial Clan, as previously reported (Rewitz et al., 2006), and the nodes were supported by bootstrapping values of 100, 99, 100 and 94, respectively. The results showed that the two CYP4s of M. japonicus clustered with other CYP4s in Clan4 and shared the same branch with marine crustaceans, supported by bootstrapping values of 96. 3.4. Tissue distribution of the two CYP4 isoforms in M. japonicus The two CYP4s were expressed in all seven tested tissues and showed a similar tissue distribution. It was evident that the two CYP4s were mainly expressed in the hepatopancreas and weakly expressed in other six tested tissues at low levels of only 1/33 to 1/6 (P < 0.01) in comparison to the hepatopancreas (Fig. 3). 3.5. The time- and dose-dependent transcriptional patterns of the two CYP4 isoforms in response to B[a]P exposure As determined by QRT-PCR, the transcriptional profiles of the two CYP4 isoforms in the hepatopancreas of M. japonicus showed time-dependent patterns under B[a]P exposure (Fig. 4). The mRNA expression level of CYP4V28 peaked at 12 h for all concentrations (p < 0.01), followed by a decrease at 24 h. For the higher B[a]P exposure concentration (50 mg/L), the transcriptional level of CYP4V28 was significantly down-regulated (p < 0.01) from 24 h to 96 h, while for the lower exposure concentrations (0.5 mg/L and 5 mg/L), the transcriptional level gradually increased to basal level from 24 h to 96 h (Fig. 4A). CYP4V29 showed a similar expression trend to CYP4V28 under B[a]P exposure, but the peak time was at 6 h (Fig. 4B). Dose-dependent patterns of the two CYP4s in response to B[a]P exposure were also detected. The up-regulated levels of the two CYP4s exhibited a tendency toward positive correlation with the concentration of B[a]P. The transcriptional level of CYP4V28 achieved 1.6-fold, 2.0-fold and 2.9-fold increases (p < 0.01) when exposed to 0.5 mg/L, 5 mg/L and 50 mg/L B[a]P for 12 h, respectively

(Fig. 4A). The expression levels of CYP4V29 increased 1.3-fold, 2.1fold and 2.5-fold (p < 0.01) at 6 h, respectively (Fig. 4B). 4. Discussion 4.1. Characteristics and phylogenetic analysis of the two CYP4 isoforms in M. japonicus CYP4 constitutes a family of monooxygenation domain proteins that play important roles in the biotransforming of xenobiotics (Snyder, 2000; Anzenbacher and Anzenbacherova, 2001; Guengerich, 2007). In this study, the full-length cDNA of two CYP4 isoforms in M. japonicus was identified and characterized for the first time. The CYP4V28 sequence contains 1771 bp encoding 511 AA, and the CYP4V29 sequence contains 1647 bp encoding 515 AA. Several highly conserved typical domains existing in most of the known CYP enzymes are present in the deduced amino acid sequences of the two CYP4s, such as the heme-binding domain (FxxGxRxCxG) and the proton transfer domain (EVDTFMFEGHDTT and EVNTFMFAGHDTT) (Supplementary Fig. 1). The AA sequence homology analysis suggested that the two CYP4s shared greater than 55% AA identity to known shrimp CYP4s, indicating that the two CYP4s belong to the CYP4V subfamily based on the nomenclature defined by Nelson (2006). Multiple alignment analysis showed that the two CYP4 AA sequences in M. japonica revealed high similarity to CYP4s from invertebrates and vertebrates, indicating that CYP4 genes appeared to be highly conserved during evolution (Miao et al., 2011). The signature motif (FxxGxRxCxG) of the CYP superfamily was absolutely conserved in both CYP4s AA sequences from M. japonicus which was consistent with studies in both invertebrate and vertebrate species. However, the proton transfer domain, previously reported as invariant in CYP4s from Perinereis aibuhitensis (Chen et al., 2012) and Ruditapes philippinarum (Pan et al., 2011), was less conserved in this study. For CYP4V28, the proton transfer domain was identical with most reported CYP4s, while for CYP4V29, the 13-residues motif was only identical with F. chinensis and showed differences at positions 318 (D was replaced by N) and 323 (E was replaced by A) to from CYP4s in other species (Fig. 1), indicating that this region was less conserved than previously thought (Londono et al., 2007). As the number of CYPs has exploded over the last few years, CYP families are structured into higher order-groups called Clans (Nelson, 1998, 1999). Clan 2 comprises CYP2 and related enzymes such as CYP1; Clan 3 includes CYP3 and closely related enzymes such as CYP6 and CYP9; Clan 4 comprises CYP4 and other closely related enzymes; and the Mitochondrial Clan consists of mitochondrial CYPs (Rewitz et al., 2006). In this study, the phylogenetic tree showed four distinct monophyletic clades, which was consistent with the higher order-groups of CYPs. Phylogenetic analysis showed that the two CYP4s in M. japonicas were grouped with all the other CYP4s from vertebrate to invertebrate in Clan 4, and the topology of this clustering seems to be determined partly by the taxa from which the various genes were isolated. The two CYP4s in M. japonicas clustered with other marine crustacean CYP4s in the same branch, revealing that they were more closely related to marine crustacean CYP4s than other species. 4.2. The two CYP4 isoforms were mainly expressed in hepatopancreas of M. japonicus In previous studies, CYP4s was mainly expressed in tissues processing food, e.g. the intestine of polychaetes, digestive gland of molluscs, hepatopancreas of crustaceans and pyloric caeca of asteroid echinoderms (Rewitz et al., 2006). In our study, the two CYP4 isoforms transcripts were found to be most abundantly

J. Zheng et al. / Marine Environmental Research 112 (2015) 96e103

101

Fig. 2. Phylogenetic analysis of the two CYP4 isoforms in M. japonicus. The tree topology was constructed by the neighbor-joining method and evaluated by 1000 replication bootstraps with MEGA 5.0 based on the deduced AA sequences alignments with clustalW. The numbers at the forks indicate the bootstrap proportions. The two CYP4s obtained in this study are shown in bold. The GenBank accession numbers of the sequences used in the figure are as follows: Xenopus laevis CYP2D6 (NP_001087043.1); D. melanogaster CYP4C3 (NP_524598.1); D. melanogaster CYP4D1 (AAB71167.1); D. melanogaster CYP6A2 (NP_523628.1); Bombyx mori CYP4G23 (BAM73906.1); B. mori CYP9A22 (BAI49180.1); Panulirus argus CYP2L1 (AAB03106.1); D. magna CYP4 (BAF35771.1); L. vannamei CYP4V18 (ADD63783.1); C. quadricarinatus CYP4 (AAL56662.1); E. carinicauda CYP4C (AFM82473.1); Orconectes limosus CYP4C15(AAF09264.1); Carcinus maenas CYP4C39 (AAQ93010.1); M. nipponense CYP4V20 (AFA26603.1); P. trituberculatus CYP4C (AFH35031.1); F. chinensis CYP4 (ACZ48687.1); H. sapiens CYP2A7 (AAI43326.1); H. sapiens CYP4F8 (NP_009184.1); Perna viridis CYP4 (ABZ81919.1); Mus musculus CYP2C37 (AAH57912.1); M. musculus CYP3A41 (NP_059092.2); D. rerio CYP1C1 (AAI65385.1); D. rerio CYP2K6 (AAI64859.1); D. rerio CYP3C1(AAS77822.1); D. rerio CYP4V8 (NP_001071070.1); G. gallus CYP1A4 (CAA67815.1); G. gallus CYP2C18 (XP_003641588.2) G. gallus CYP3A37 (CAB62060.1); G. gallus CYP4V2 (NP_001001879.1); B. mori CYP302A1 (BAD99022.1); Tigriopus. Japonicas CYP314A1 (AIL94172.1); Paracyclopina. nan CYP315A1(AKH03535.1); D. melanogaster CYP12B2 (AAF57642.2); D. melanogaster CYP49A1 (AAF58791.3).

expressed in the hepatopancreas and lower in the gill, muscle, heart, stomach, intestine and eyestalk (Fig. 3), which is consistent with previous studies in Chlamys farreri (Miao et al., 2011) and Ruditapes philippinarum (Pan et al., 2011). 4.3. Inducible expression pattern of the two CYP4 isoforms in response to B[a]P CYP enzymes play an important role in the metabolism of exogenous chemicals (Guengerich, 2001; Anzenbacher and Anzenbacherova, 2001). Recently, various kinds of CYP4s have

been identified and found to respond to PAHs (Pan et al., 2011; Li et al., 2004; Rewitz et al., 2004; Snyder, 1998; Miao et al., 2011). In this study, the expression of the two CYP4 isoforms displayed a dose- and time-dependent pattern under B[a]P exposure, as also observed in other benthic organisms such as Ruditapes philippinarum (Pan et al., 2011), Capitella capitata (Li et al., 2004), Nereis virens (Rewitz et al., 2004) and Perinereis aibuhitensis (Chen et al., 2012). The mRNA expression levels of CYP4V28 and CYP4V29 were significantly elevated (p < 0.01) after exposure to B[a]P at all concentrations for 12 h and 6 h respectively, showing varied sensitivity to B[a]P. In this study, the up-regulation and down-

102

J. Zheng et al. / Marine Environmental Research 112 (2015) 96e103

Fig. 3. Tissue distribution of CYP 4V28 and CYP 4V29 mRNA in M. japonicus detected by QRT-PCR. Expression levels in gill (G), muscle (S), stomach (S), heart (H), eyestalk (E) and intestine (I) are normalized to the hepatopancreas (Hp). Each bar represents the mean ± S.D (n ¼ 5). A significant difference between groups at p < 0.01 (n ¼ 5, ANOVA) is indicated by different letters above the bars.

regulation levels were more evident for CYP4V28 than CYP4V29. CYPs can be induced by PAHs via diverse receptors, such as the arylhydrocarbon receptor (AHR) (Tian et al., 2013; Zanette et al., 2013), nuclear transcription factor (the pregnane X receptor, PXR) (Kumagai et al., 2012) nd constitutive androstane receptor (CAR) (Zheng et al., 2011). In this study, the differences in induction of the two CYP4 expression levels were believed to be caused by the different receptor pathways (Skupinska et al., 2007), but which pathway was invoked cannot be demonstrated due to the lack of research on marine crustacean CYPs. It is noticeable that the transcription levels of CYP4V28 and CYP4V29 were sharply decreased at all concentrations at 24 h and 12h, respectively (Fig. 4), but the underlying mechanism between different concentrations may be different. CYP often catalyzes xenobiotics into more toxic metabolites, causing negative effects (Zheng et al., 2013). We speculated that when exposed to the higher B[a]P concentration (50 mg/L) for a long time, the organism cannot eliminate the xenobiotics in a timely manner, and thus the xenobiotics and their toxic metabolites accumulate destroying the detoxification system of the organism. Thus, the transcriptional level of the two CYP4s decreased sharply with increasing time. With regard to the lower exposure concentrations (0.5 mg/L and 5 mg/L), the inhibition of the two CYP4

Fig. 4. CYPV28 (A) and CYPV29 (B) mRNA expression in the hepatopancreas of M. japonicus exposed to different concentrations of B[a]P. Each bar represents the mean ± S.D (n ¼ 5). A significant difference between groups at p < 0.01(n ¼ 5, ANOVA) is indicated by different letters above the bars.

transcriptional levels may be explained by compensatory changes or auto-regulation through a feedback mechanism in the gene expression during the exposure period (Ku et al., 2014), and the transcriptional level gradually increased to the basal level after a temporary inhibition. However, the mechanism leading to the differentially decreased expression of the two CYP4 isoforms between higher (50 mg/L) and lower (0.5 mg/L and 5 mg/L) B[a]P concentrations remains to be established by further studies.

5. Conclusion In conclusion, the current study identified and characterized two complete cDNA sequences of CYP4 isoforms in M. japonicas and clarified their tissue distributions and expression patterns in response to B[a]P for the first time. The data showed that the deduced AA sequences of the two CYP4s shared high homology with other proteins of the CYP4 family. The two CYP4s were most abundantly expressed in the hepatopancreas and showed doseand time-dependent expression patterns in response to B[a]P. This study provides clues for further elucidating the function and regulation mechanism of the two CYP4s in M. japonicas.

J. Zheng et al. / Marine Environmental Research 112 (2015) 96e103

Acknowledgment This study was funded by the State 863 Project of China (Grant No. 2012AA10A409-03), the Project of China Agriculture Research System (Grant No. CARS-47) and the Xiamen Southern Ocean Research Center (Grant No. 14CZY033HJ07). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.marenvres.2015.09.012. References Anzenbacher, P., Anzenbacherova, E., 2001. Cytochromes P450 and metabolism of xenobiotics. Cell. Mol. Life Sci. CMLS 58 (5e6), 737e747. Banni, M., Negri, A., Dagnino, A., et al., 2010. Acute effects of benzo[a] pyrene on digestive gland enzymatic biomarkers and DNA damage on mussel Mytilus galloprovincialis. Ecotoxicol. Environ. Saf. 73 (5), 842e848. Bo, J., Gopalakrishnan, S., Chen, F.Y., et al., 2014. Benzo[a]pyrene modulates the biotransformation, DNA damage and cortisol level of red sea bream challenged with lipopolysaccharide. Mar. Pollut. Bull. 85 (2), 463e470. Chen, X., Zhou, Y., Yang, D., et al., 2012. CYP4 mRNA expression in marine polychaete Perinereis aibuhitensis in response to petroleum hydrocarbon and deltamethrin. Mar. Pollut. Bull. 64 (9), 1782e1788. Chiau, W.Y., 2005. Changes in the marine pollution management system in response to the Amorgos oil spill in Taiwan. Mar. Pollut. Bull. 51 (8), 1041e1047. Feng, W.R., Zhang, M., Su, Y.Q., et al., 2014. Identification and analysis of a Marsupenaeus japonicus ferritin that is regulated at the transcriptional level by WSSV infection. Gene 544 (2), 184e190. Guengerich, F.P., 2001. Common and uncommon cytochrome P450 reactions related to metabolism and chemical toxicity. Chem. Res. Toxicol. 14 (6), 611e650. Guengerich, F.P., 2007. Cytochrome p450 and chemical toxicology. Chem. Res. Toxicol. 21 (1), 70e83. Hall T. BioEdit version 7.0. 0[J]. Distributed by the author, website: www.mbio.ncsu. edu/BioEdit/bioedit.html, 2004. Haritash, A.K., Kaushik, C.P., 2009. Biodegradation aspects of polycyclic aromatic hydrocarbons (PAHs): a review. J. Hazard. Mater. 169 (1), 1e15. Incardona, J.P., Collier, T.K., Scholz, N.L., 2004. Defects in cardiac function precede morphological abnormalities in fish embryos exposed to polycyclic aromatic hydrocarbons. Toxicol. Appl. Pharmacol. 196 (2), 191e205. Juhasz, A.L., Naidu, R., 2000. Bioremediation of high molecular weight polycyclic aromatic hydrocarbons: a review of the microbial degradation of benzo[a] pyrene. Int. Biodeterior. Biodegrad. 45 (1), 57e88. Kikuta, Y., Kusunose, E., Kusunose, M., 2002. Prostaglandin and leukotriene u-hydroxylases. Prostagl. Other Lipid Mediat. 68, 345e362. Kirischian, N.L., Wilson, J.Y., 2012. Phylogenetic and functional analyses of the cytochrome P450 family 4. Mol. Phylogenetics Evol. 62 (1), 458e471. Ku, P., Wu, X., Nie, X., et al., 2014. Effects of Triclosan on detoxification system in the Yellow Catfish (Pelteobagrus fulvidraco): expressions of CYP and GST gene and corresponding enzymes activity in phase I, II and antioxidant system. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 166, 105e114. Kumagai, T., Suzuki, H., Sasaki, T., et al., 2012. Polycyclic aromatic hydrocarbons activate CYP3A4 gene transcription through human pregnane X receptor. Drug Metab. Pharmacokinet. 27 (2), 200e206. Kuo, C.Y., Cheng, Y.W., Chen, C.Y., et al., 1998. Correlation between the amounts of polycyclic aromatic hydrocarbons and mutagenicity of airborne particulate samples from Taichung City, Taiwan. Environ. Res. 78 (1), 43e49. Li, B., Bisgaard, H.C., Forbes, V.E., 2004. Identification and expression of two novel cytochrome P450 genes, belonging to CYP4 and a new CYP331 family, in the polychaete Capitella capitata sp.I. Biochem. Biophys. Res. Commun. 325 (2), 510e517. Lin, S.C., Shih, Y.C., Chiau, W.Y., 2013. An impact analysis of destructive fishing and offshore oil barges on marine living resources in Taiwan Strait. Ocean Coast. Manag. 80, 119e131. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCt method. Methods 25 (4), 402e408. Londono, D.K., Siqueira, H.A.A., Wang, H., et al., 2007. Cloning and expression of an atrazine inducible cytochrome P450, CYP4G33, from Chironomus tentans (Diptera: Chironomidae). Pesticide Biochem. Physiol. 89 (2), 104e110. Miao, J., Pan, L., Liu, N., et al., 2011. Molecular cloning of CYP4 and GSTpi homologues in the scallop Chlamys farreri and its expression in response to Benzo[a] pyrene exposure. Mar. Genom. 4 (2), 99e108. Nebert, D.W., Dalton, T.P., 2006. The role of cytochrome P450 enzymes in endogenous signalling pathways and environmental carcinogenesis. Nat. Rev. Cancer

103

6 (12), 947e960. Nelson, D.R., 1998. Metazoan cytochrome P450 evolution. Comp. Biochem. Physiol. Part C Pharmacol. Toxicol. Endocrinol. 121 (1), 15e22. Nelson, D.R., 1999. Cytochrome P450 and the individuality of species. Arch. Biochem. Biophys. 369 (1), 1e10. Nelson, D.R., 2006. Cytochrome P450 Nomenclature, 2004. Cytochrome P450 Protocols. Humana Press, pp. 1e10. Nelson, D.R., Goldstone, J.V., Stegeman, J.J., 2013. The cytochrome P450 genesis locus: the origin and evolution of animal cytochrome P450s. Philos. Trans. R. Soc. B Biol. Sci. 368 (1612), 20120474. Pan, L., Liu, N., Xu, C., et al., 2011. Identification of a novel P450 gene belonging to the CYP4 family in the clam Ruditapes philippinarum, and analysis of basal-and benzo[a]pyrene-induced mRNA expression levels in selected tissues. Environ. Toxicol. Pharmacol. 32 (3), 390e398. Pauzi Zakaria, M., Okuda, T., Takada, H., 2001. Polycyclic aromatic hydrocarbon (PAHs) and hopanes in stranded tar-balls on the coasts of Peninsular Malaysia: applications of biomarkers for identifying sources of oil pollution. Mar. Pollut. Bull. 42 (12), 1357e1366. Ren, L., Zhu, B.Q., Zhang, Y.B., et al., 2004. The research of applying primer premier 5.0 to design PCR primer. J. Jinzhou Med. Coll. 25, 43e46. Ren, X., Pan, L., Wang, L., 2014. Metabolic enzyme activities, metabolism-related genes expression and bioaccumulation in juvenile white shrimp Litopenaeus vannamei exposed to benzo[a]pyrene. Ecotoxicol. Environ. Saf. 104, 79e86. Rewitz, K.F., Kjellerup, C., Jørgensen, A., et al., 2004. Identification of two Nereis virens (Annelida: Polychaeta) cytochromes P450 and induction by xenobiotics. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 138 (1), 89e96. Rewitz, K.F., Styrishave, B., Løbner-Olesen, A., et al., 2006. Marine invertebrate cytochrome P450: emerging insights from vertebrate and insect analogies. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 143 (4), 363e381. Shimada, T., 2006. Xenobiotic-metabolizing enzymes involved in activation and detoxification of carcinogenic polycyclic aromatic hydrocarbons. Drug Metab. Pharmacokinet. 21 (4), 257e276. Silva, C., Oliveira, C., Gravato, C., et al., 2013. Behaviour and biomarkers as tools to assess the acute toxicity of benzo[a]pyrene in the common prawn Palaemon serratus. Mar. Environ. Res. 90, 39e46. Simpson, A., 1997. E C M. The cytochrome P450 4 (CYP4) family. General Pharmacol. Vasc. Syst. 28 (3), 351e359. Skupinska, K., Misiewicz, I., Kasprzycka-Guttman, T., 2007. A comparison of the concentrationeeffect relationships of PAHs on CYP1A induction in HepG2 and Mcf7 cells. Arch. Toxicol. 81 (3), 183e200. Snyder, M.J., 1998. Cytochrome P450 enzymes belonging to the CYP4 family from marine invertebrates. Biochem. Biophys. Res. Commun. 249 (1), 187e190. Snyder, M., 2000. J. Cytochrome P450 enzymes in aquatic invertebrates: recent advances and future directions. Aquat. Toxicol. 48 (4), 529e547. Soclo, H.H., Garrigues, P.H., Ewald, M., 2000. Origin of polycyclic aromatic hydrocarbons (PAHs) in coastal marine sediments: case studies in Cotonou (Benin) and Aquitaine (France) areas. Mar. Pollut. Bull. 40 (5), 387e396. Srogi, K., 2007. Monitoring of environmental exposure to polycyclic aromatic hydrocarbons: a review. Environ. Chem. Lett. 5 (4), 169e195. Tian, S., Pan, L., Sun, X., 2013. An investigation of endocrine disrupting effects and toxic mechanisms modulated by benzo [a] pyrene in female scallop Chlamys farreri. Aquat. Toxicol. 144, 162e171. Tsoi, K.H., Wang, Z.Y., Chu, K.H., 2005. Genetic divergence between two morphologically similar varieties of the kuruma shrimp Penaeus japonicus. Mar. Biol. 147 (2), 367e379. Wang, X.L., Tao, S., Dawson, R.W., et al., 2002. Characterizing and comparing risks of polycyclic aromatic hydrocarbons in a Tianjin wastewater-irrigated area. Environ. Res. 90 (3), 201e206. Wu, Y.L., Wang, X.H., Li, Y.Y., et al., 2011. Occurrence of polycyclic aromatic hydrocarbons (PAHs) in seawater from the Western Taiwan Strait, China. Mar. Pollut. Bull. 63 (5), 459e463. Zanette, J., Jenny, M.J., Goldstone, J.V., et al., 2013. Identification and expression of multiple CYP1-like and CYP3-like genes in the bivalve mollusk Mytilus edulis. Aquat. Toxicol. 128, 101e112. Zhang, Z.L., Hong, H.S., Zhou, J.L., et al., 2004. Phase association of polycyclic aromatic hydrocarbons in the Minjiang River Estuary, China. Sci. Total Environ. 323 (1), 71e86. Zhang, L., Gan, J., Ke, C., et al., 2012. Identification and expression profile of a new cytochrome P450 isoform (CYP414A1) in the hepatopancreas of Venerupis (Ruditapes) philippinarum exposed to benzo[a]pyrene, cadmium and copper. Environ. Toxicol. Pharmacol. 33 (1), 85e91. Zhang, M., Su, Y.Q., Feng, W.R., et al., 2013. The full length cDNA cloning and expression analysis of catalase from the kuruma shrimp (Marsupenaeus japonicus). J. Xiamen Univ. Nat. Sci. 52 (6), 851e859. Zheng, S., Chen, B., Qiu, X., et al., 2013. Three novel cytochrome P450 genes identified in the marine polychaete Perinereis nuntia and their transcriptional response to xenobiotics. Aquat. Toxicol. 134, 11e22. Zheng, S., Qiu, X., Chen, B., et al., 2011. Toxicity evaluation of benzo [a] pyrene on the polychaete Perinereis nuntia using subtractive cDNA libraries. Aquat. Toxicol. 105 (3), 279e291.