- Email: [email protected]
Identifying virulence factor genes in E. coli in animal houses and their transmission to outside environments
Journal of Aerosol Science xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Journal of Aerosol Science journal homepage: www.elsevier.com/locate/jaerosci
Identifying virulence factor genes in E. coli in animal houses and their transmission to outside environments Bo Wua,c,1, Huiyong Duana,b,1, Qin Qid, Yumei Caia, Zhaobing Zhonga, Tongjie Chaia,
⁎
a
College of Veterinary Medicine, Shandong Agricultural University, Sino-German Cooperative Research Centre for Zoonosis of Animal Origin Shandong Province, 61 Daizong Road, Tai’an 271000, Shandong Province, China Department of Biotechnology Engineering, Taishan Polytechnic, Tai’an 271000, Shandong Province, China c Collaborative Innovation Centre for the Origin and Control of Emerging Infectious Diseases of Taishan Medical College, Tai’an 271000, Shandong Province, China d Taian Central Hospital, Tai’an 271000, Shandong Province, China b
AR TI CLE I NF O
AB S T R A CT
Keywords: Virulence factor genes E. coli Multiplex PCR Animal houses Transmission
Escherichia coli is a common bacterium in the air; it can affect the health of humans and animals. The carrying status of five primary virulence factor genes in E. coli (i.e., STa, STb, LTa, stx1, and stx2/stx2e) in various animal houses and their spread to the outside environment were investigated by comparing the air inside animal houses with that outside the houses. Multiplex polymerase chain reaction detection of the five genes was performed on samples from five chicken houses, and 117 E. coli isolates were obtained. From five swine houses, 120 were obtained, and from six cow houses, 143 were obtained. Results reveal that E. coli virulence genes derived from animal houses can be propagated via gas exchange from the inside to the outside and, depending on weather conditions, across some distance, resulting in biological pollution and the spread of pathogenic microorganisms. This study of the transmission of environmental microbial aerosols in animal houses has great significance in public health and epidemiology.
1. Introduction Although air is vital for humans and other animals to survive, in most cases, the microbes that affect human and animal health and production performance are airborne. Accordingly, measuring microbial air contamination is essential for gauging air quality. At the same time, microbes are a chief factor of environmental pollution in animal houses, where pollution can cause the spread of a number of infectious diseases. Airborne bacteria in animal houses include pathogenic, conditionally pathogenic, and nonpathogenic bacteria (Dowes, Thorne, Pearce, & Heederik, 2003) that can cause infection among both animals and animal breeders (Dutkiewicz, Pomorski, & Sitkowska, 1994; Fiegel, Clarke, & Edwards, 2006). Even a small amount of pathogenic bacteria can cause respiratory tract infections, especially in the lower respiratory tract (Donaldson, 1999; Fiegel et al., 2006). Therefore, microbial aerosol pollution not only affects human and animal health, but also results in the spread of infectious zoonotic pathogens among humans and animals (Duan, 2005; Dutkiewicz, 1994). A commensal bacterium in the intestinal tracts of humans and animals (Schroeder, White, & Meng, 2004), Escherichia coli can cause colibacillosis under certain conditions, and it contaminates the environment via fecal excretion (Beutin, Steinrück, Krause, Steege, & Haby, 2007; Jackson, Blair, McDowell, Kennedy, & Bolton, 2007; Somarelli, Makarewicz, Sia, & Simon, 2007). Moreover, it
⁎
Corresponding author. E-mail address: [email protected] (T. Chai). 1 Bo Wu and Huiyong Duan contributed equally in this paper. https://doi.org/10.1016/j.jaerosci.2017.11.009 Received 18 July 2017; Received in revised form 19 November 2017; Accepted 23 November 2017 0021-8502/ © 2017 Elsevier Ltd. All rights reserved.
Please cite this article as: Wu, B., Journal of Aerosol Science (2017), https://doi.org/10.1016/j.jaerosci.2017.11.009
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
is a common bacterium in the air, especially in animal houses and their surrounding environments. Escherichia. coli is therefore an important pathogenic bacteria in water, food, and other agricultural and environmental forms of pollution (Duan, Chai, Wang, Müller, & Zucker, 2006; Zucker, Trojan, & Muller, 2000). Pathogenic E. coli must first be localized in the settlement and breeding and then invade the body or produce toxins. Not all virulence factors of the various pathogenic E. coli are the same. For example, ST and LT enterotoxins, as well as others, can change the absorption and secretion functions of intestinal cells, resulting in large water and electrolyte flows to the intestine–the clinical manifestation of watery diarrhea–or vascular endothelial cell damage, resulting in piglet diarrhea and edema disease. The most potent placental immunogen and mucosal immune adjuvant is LT, and it can effectively start the body's local and systemic humoral immunity and cellular immunity. On the other hand, Stx has strong cytotoxic, enterotoxic, and neurotoxic effects, which cause different clinical manifestations. Aerosols composed of microbes and their metabolites in and around animal houses cause environmental pollution (Gross, 1994), influence animal health and productivity, and prompt the spread of infectious airborne diseases (Brown & Hovmoller, 2002; Lv et al., 2015). Research on the spread of microbial aerosols in animal breeding environments has focused on changes in bacterial concentrations (Hwang, Yoon, Ryu, Paik, & Cho, 2010; Kim & Kim, 2007), bacterial resistance, and the content of certain pathogenic bacteria (Cattoir, Poirel, Rotimi, Soussy, & Nordmann, 2007; Ibenyassine, AitMhand, Karamoko, Cohen, & Nennaji, 2006); however, studies conducted in the field from a molecular biology perspective are rare (Gao et al., 2015). In response, we examined the carrying situations of five primary virulence factor genes in E. coli inside and outside various animal houses. We also investigated the spread of the genes to the outside of the houses by performing comparative detection analyses on the genes found inside and outside the houses. The spread and infection of E. coli microbial aerosols present a great threat to the health of residents around poultry houses, especially those downwind. This study has strong public health and epidemiological significance.
2. Materials and methods 2.1. Animal house situations Sampling sites were at several farms in the cities of Taian, Laiwu, Jinan, and ZiBo, China. Samples were taken from five chicken houses, five swine houses, and six cow houses, each house utilizing a different structure type. Wind speed, temperature, and relative humidity were measured at the beginning, middle, and end of the sampling period. Table 1 presents detailed information about the animal houses.
Table 1 Description of the animal houses. Animal houses
Chicken houses
A B C D E
Swine houses
Cow houses
A' B' C' D' E' A′′ B′′ C′′ D′′ E′′′ F′′
Sampling sites
Chicken farm in Ningyang Fangcun, Taian 1 Fangcun, Taian 2 Mazhuang, Taian Xuezhuang, Taian Taian 1 Niuquan, Laiwu Mazhuang, Feicheng Taian 2 Taian 3 Cow farm in Taian 1 Cow farm in Taian 2 Jinan Gaoqing, Zibo 1 Gaoqing, Zibo 2 Cow farm in Taian 3
Total number
Breeding ways
Inside houses
Outside houses
Temperature (°C)
Humidity (%)
Wind speed (m/s)
Temperature (°C)
Humidity (%)
Wind speed (m/s)
6000
closed
26
40
0
21
50
1–3
2200
caged
26
34
0
29
50
1–3.1
3000
half-closed
31
44
0
35
36
1.5–3
3500
half-closed
31
60
0
32
75
0–1.5
4500
caged
30
70
0
31
65
0–2
150 500 600
closed half-closed half-closed
7 12 28
81 65 67
0 0 0
4 8 35
78 60 58
0–0.6 1.4–5 0–1.5
360 280 1000
half-closed half-closed half-closed
20 22 30
67 65 65
0 0 0
22 24 32
70 70 60
0–1.5 0–1.5 0–1.5
450
half-closed
24
65
0
26
60
1–5
300 520 600 500
open half-closed half-closed open
22 20 19 16
67 63 63 58
0 0 0 0
24 21 20 18
65 60 62 52
0–1.5 0–2.5 0–1.5 0–2
2
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
2.2. Sampling Air samples were collected by using six-stage Andersen microbial samplers and LWC-I microbial samplers. In all cases, the sampling flow rate was 28.3 L/min taken 50–80 cm above ground level. Air samples were collected for 1–5 min from windward gusts inside and outside the animal houses (10 and 50 m) and leeward gusts 10, 50, 100, 200, and 400 m outside the animal houses, collecting approximately 30 to 300 colonies per class. Three sampling sites were determined for each animal house, and five samples were taken from each site. Simultaneously, 10–15 feces samples were collected at random from inside each animal house. 2.3. Calculating the separation, identification, and concentration of E. coli in air samples Samples collected (i.e., the panels and test strips) were cultured using MacConkey agar no. 3 for 24 h at 37 ℃. All red bacterial colonies were assessed for KHO response as a substitute for Gram staining, then pure cultures of all gram-negative Brevibacillus brevis colonies were isolated in MacConkey agar and identified using common biochemical tests. For other E. coli strains, API 20 E (BioMérieux, Marcy–I′Etoile, France) was used for identification. They were then counted, and content (CFU/m3) was calculated. (1) where Q1 is the sum of the adjusted number of colonies at all six stages, and t is the sampling time in minutes. Lastly, the broth culture containing 20% glycerol was refrigerated at −20 ℃. 2.4. Calculating the separation, identification, and concentration of E. coli in feces Feces samples of roughly 0.5 g were collected into small bottles containing 4.5 mL sterilized diluent. Samples were progressively diluted 10 times, reaching a concentration 10−6 that of the original sample. They were then dropped onto MacConkey agar, upon which three plates were set using a Transferpettor (50 µL). Each plate contained three dilutions, each of which were dropped into a 3 × 3 matrix at a certain distance. After culturing at 37 ℃ for 18–20 h, the colony numbers in the three sample drops of the same dilution were counted using the countability principle allowing selection of the proper dilution. The number of bacteria per gram of sample was calculated:
Number of bacteria (CFU)/g = Sum of colonies in 3 drops of sample/0.005 mL *dilution
(2)
Using the method described by Lim et al. (2007), the dilution was first inoculated in an EMB (Tianhe, Hangzhou) culture medium and cultured at 37 ℃ for 18–20 h. Black colonies that showed metallic glittering were selected and inoculated on MacConkey nutrition agar (OXOID) and cultured at 37 ℃ for 18–20 h. Then, one or two typical red colonies were selected, identified, and preserved according to the method described in Section 2.3. 2.5. Culturing E. coli and extracting template DNA 2.5.1. Culturing E. coli After isolation and purification, the bacteria preserved in Experiment 1 were inoculated on MacConkey nutrition agar and cultured at 37 ℃ for 24 h. Single pink colonies that resulted were inoculated in LB broth and cultured at 37 ℃ for 24 h. 2.5.2. Preparing templates Escherichia coli were inoculated in 5 mL culture medium and cultured by vibration for 18 h. A 1.5-mL portion of the culture medium was retrieved and centrifuged at 10,000 rpm for 2 min. Once the supernatant was discarded, the remainder was washed twice using 100 µL TE buffer. Then, 100 L TE buffer suspension precipitation was boiled at 100 ℃ for 10 min, quickly cooled in icewater for 5 min, and centrifuged at 12,000 rpm for 2 min. This supernatant was preserved as a back-up template at −20 ℃. Reference bacteria C83600 (STb and LTa), C83710 (STa), H30 (stx1), SDZ21 (LTa and stx2), and SDZ15 (stx2) were preserved in our lab. 2.6. Polymerase chain reaction 2.6.1. Synthesis of primers Primers were synthesized by Shanghai Biological Engineering Co., Ltd. Table 2 presents the primers and their sequences. 2.6.2. Reaction conditions Multiplex polymerase chain reaction (PCR) was performed using 1× buffer, 200 µM dNTPs, 1.5 U Taq DNA polymerase, 1.5 mM MgCl2 (TaKaRa), five pairs of primers at 25 pmol each, and 2 µL of template DNA. This mixture was diluted to 25 µL using distilled water. An initial denaturation was performed by holding the mixture for 3 min at 95 ℃ followed by 32 cycles at 94 ℃ for 30 s. It was reduced to 58–54 ℃ (decreased every two cycles) for 1 min, then sustained at 72 ℃ for 1 min. The reaction was terminated at 72 ℃ for 10 min. Before electrophoresis, all products were preserved at 4 ℃. 3
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
Table 2 Primers and their sequences used in this experiment (Cheng, et al., 2006). Virulence factor genes STa STb LTa Stx1 Stx2/Stx2e
Sequences（5’−3’）
Location (accession number)
Amplified bands size range (bp)
F R F R F R F R F
GGGTTGGCAATTTTTATTTCTGTA ATTACAACAAAGTTCACAGCAGTA ATGTAAATACCTACAACGGGTGAT TATTTGGGCGCCAAAGCATGCTCC TAGAGACCGGTATTACAGAAATCTGA TCATCCCGAATTCTGTTATATATGTC ATTCGCTGAATGTCATTCGCT ACGCTTCCCAGAATTGCATTA TTTCTTCGGTATCCTATTCCC
183
R
GATGCATCTCTGGTCATTGTA
298–321 (M25607) 457–480 (M25607) 1–20 (M35729) 334–357 (M35729) 579–604 (AB011677) 835–860 (AB011677) 110–130 (AB030485) 753–773 (AB030485) 222–242 (Z50754), 288–308 (M21534) 685–705 (Z50754), 751–771 (M21534)
360 282 664 484
2.6.3. Electrophoresis All PCR products were electrophoresed on a 1.2% (w/v) agarose gel containing 1 × TAE and 0.5 mg mL−1 ethidium bromide along with the DL2000 DNA markers (TaKaRa) for 1–2 h. Results of electrophoresis were photographed using an ultraviolet analyzer.
3. Results 3.1. Concentrations of airborne E. coli in various animal houses The E. coli concentrations in the five chicken houses were 15–81 CFU/m3 air, and the concentrations of respirable E. coli were 9–55 CFU/m3. The concentrations in the 5 swine houses were 20–52 CFU/m3, and concentrations of respirable E. coli were 14–37 CFU/m3. The concentrations in the 6 cow houses were 11–56 CFU/m3, and concentrations of respirable E. coli were 8–39 CFU/ m3 (see Table 3). The aerosol E. coli (Fig. 1) was distributed primarily at the 3–6 level using the Andersen samplers with an aerodynamic diameter < 6.0 µm. Furthermore, the largest number of particles was collected at the third level (3.0–6.0 µm) followed by those at the first level (> 8.2 µm).
Table 3 Concentrations of airborne E. coli in different animal houses.
chicken houses
3
concentration ( CFU/m )
Total
☆
Respirable
★
Ratio（%）
swine houses
concentration ( CFU/m3)
Total
☆
Respirable
★
Ratio（%）
cow houses
concentration ( CFU/m3)
Total
☆
★
Ratio（%）
Respirable
Max. Min. Mean Max. Min. Mean Max. Min. Mean Max. Min. Mean Max. Min. Mean Max. Min. Mean Max. Min. Mean Max. Min. Mean Max. Min. Mean
Note: A,B,C,D,E,F represent animal house code.
4
A
B
C
D
E
F
134 7 33 a 85 7 27 a 100 63.2 81.0 a 47 6 20 a 29 6 14 a 100.0 62.5 80.8 a 60 20 36 a 54 12 24 a 80.0 50.0 66.4a
59 6 21 a 29 6 12 b 100 50.0 69.4 a 41 6 21 a 29 6 15 a 100.0 60.0 79.6 a 177 0 41 a 143 0 28 a 75.0 0 62.4 a
71 0 22 a 47 0 13 b 66.7 0 40.0 b 120 14 48 b 85 14 34 b 100.0 62.5 75.0 a 154 0 56 a 78 0 39 a 75.0 0 62.9 a
236 12 81 b 153 6 55 c 83.3 50.0 68.4 127 14 52 b 92 7 37 b 80.0 50.0 67.9 47 0 11 b 34 0 8b 75.0 0 66.1
35 0 15 a 18 0 9b 100 0 55.0 a 113 7 38 b 85 7 27 b 100.0 50.0 70.3 a 141 0 34 a 121 0 26 a 75.0 0 64.2 a
98 12 48 a 76 0 37 a 100.0 62.5 78.6 a
a
a
a
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
Fig. 1. Multiplex PCR detection of five virulence factor genes in Escherichia coli (Lanes: 1, Escherichia coli C83600; 2, Escherichia coli C83710; 3, Escherichia coli C83600; 4, Escherichia coli isolated from air; 5, Escherichia coli SDZ21; 6, Escherichia coli SDZ15; 7, Escherichia coli H30; 8 and 9, Escherichia coli isolated from air; N, negative control; M, DL2000 DNA Marker).
3.2. Detection results of the five primary virulence factor genes in E. coli in chicken houses, swine houses and cow houses Fig. 2 illustrates the results of the five virulence factor genes found under the same PCR conditions. The genes could amplify their own bands, which ranged in size; STa, STb, LTa, stx1, and stx2/stx2e were 183, 360, 282, 664, and 484 bp, respectively. Fig. 3 shows the multiplex PCR detection of five virulence factor genes in E. coli. 3.3. Detection results of the five primary virulence factor genes in E. coli in chicken houses, swine houses and cow houses Of the 117 E. coli samples tested from five chicken houses, 9.40% (11/117) of the bacteria carried only the LTa gene, 12.82% (15/ 117) the STa and LTa genes, 11.97% (14/117) the STa, STb, and LTa genes, 2.56% (3/117) the STa, LTa, and stx1 genes, and 10.26% (12/117) the STa, STb, LTa, and stx1 genes. Bacteria carrying the stx2/stx2e gene were not found, and in 54 (46.15%) of the E. coli samples, none of the five genes were found. Results provided evidence that bacteria carrying the LTa gene were the most abundant (53.85%) followed by those with the STa gene (37.61%; see Table 4). Of the 120 E. coli samples tested from five swine houses, many bacteria carried only one type of gene: 11.67% (11/117) carried the LTa gene, 17.50% (21/120) the STb gene, 1.67% (2/120) the STa gene, and 5.00% (6/120) the stx2/stx2e gene. Some bacteria carried two or more genes: STa combined with STb, STa combined with STb and LTa, or STb combined with LTa and stx1, accounting for 3.33% (4/120); 6.67% (8/120) carried the STa and LTa genes, 5.83% (7/120) the LTa and stx2/stx2e genes, 1.67% (2/120) the STa, LTa, and stx1 genes, and 2.50% (3/120) the STa, STb, LTa, and stx1 genes. In 37.50% (45/120) of E. coli samples, all five genes were found (see Table 5). Of 143 E. coli samples tested from six cow houses, 18.88% (27/143) of the bacteria carried only the LTa gene and 4.90% (7/143) only the STb gene. Most bacteria carried two or more genes: 6.99% (10/143) carried the STa and LTa genes, 4.20% (6/143) the LTa and stx1 genes, 6.29% (9/143) the STb and LTa genes, 2.80% (4/143) the STa, STb, and LTa genes, 8.39% (12/143) the STa, LTa, and stx1 genes, 2.10% (3/143) the STb, LTa, and stx1 or the STa, STb, LTa, and stx1 genes, 1.40% (2/143) the LTa, stx1, and stx2/stx2e genes, and 0.70% (1/143) the STa, LTa, stx1, and stx2/stx2e genes. Another 41.26% (9/143) of the E. coli samples did not carry any of the genes. Result show that the number of bacteria carrying the LTa gene ranked first, accounting for 51.75% (74/143), followed
Fig. 2. Size distribution of airborne E. coli according to stage of Andersen sampler.
5
Fig. 3. Multiplex PCR detection of five virulence factor genes in Escherichia coli (Lanes: 1–40, Escherichia coli isolated from animal house; N, negative control; M, DL2000 DNA Marker).
B. Wu et al.
Journal of Aerosol Science xxx (xxxx) xxx–xxx
6
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
Table 4 Multiplex PCR detection of five virulence factor genes in Escherichia coli isolated from 5 chicken houses. Virulence factor genes
Number
Percentage (%)
LTa STa+LTa LTa+STx1 STa+STb+LTa STa+LTa+STx1 STa+STb+LTa+STx1 Stx2/Stx2e Not detected Total
11 15 8 14 3 12 0 54 117
9.40 12.82 6.84 11.97 2.56 10.26 0.00 46.15
Table 5 Multiplex PCR detection of five virulence factor genes in Escherichia coli isolated from 5 swine houses. Virulence factor genes
Number
Percentage (%)
LTa STb STa Stx2/Stx2e STa+LTa STa+STb LTa+ Stx2/Stx2e STa+STb+LTa STa+LTa+STx1 STb+LTa+STx1 STa+STb+LTa+STx1 Not detected Total
14 21 2 6 8 4 7 4 2 4 3 45 120
11.67 17.50 1.67 5.00 6.67 3.33 5.83 3.33 1.67 3.33 2.50 37.50
by those carrying the STa gene, accounting for 20.98% (30/143). The numbers of bacteria carrying the STb and stx1 genes were similar, accounting for 18.18% (26/143) and 18.88% (7/143), respectively. Bacteria carrying the stx2/stx2e gene were the scarcest, accounting for 2.10% (3/143; see Table 6). Detecting virulence factor genes in E.coli in various animal houses and the surrounding environments showed that the number of bacteria carrying the LTa gene were the most abundant. Most E. coli carried two or more genes, the fewest bacteria carried stx2/stx2e and they were not found in chicken houses. 3.4. Outspread of five main virulence factor genes in E. coli in animal houses Taking Chicken House A as an example, the outspread of the five primary virulence factor genes in E. coli in animal houses were examined. The feces carried Virulence Factor Genes in E. coli could be aerosolized, first spread in the air inside the house,then spread to the outside environment through the exchange of air inside and outsidehouse, depending on the weather conditions spread to a certain distance. Such as, Lta and STa could spread from Feces to Indoor air, Downwind different distance. Microbial pollution of the surrounding environment thus occurred to some degree(see Table 7). Table 6 Multiplex PCR detection of five virulence factor genes in Escherichia coli isolated from 6 cow houses. Virulence factor genes
Number
Percentage (%)
LTa STb STa+LTa STb+LTa LTa+STx1 STa+STb+LTa STa+LTa+STx1 STb+LTa+STx1 LTa+STx1+ Stx2/Stx2e STa+STb+LTa+STx1 STa+LTa+STx1+ Stx2/Stx2e Not-detected Total
27 7 10 9 6 4 12 3 2 3 1 59 143
18.88 4.90 6.99 6.29 4.20 2.80 8.39 2.10 1.40 2.10 0.70 41.26
7
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
Table 7 Analysis of five virulence factor genes in Escherichia coli (which similarity ≥90% analyzed using Multiplex-PCR) isolated from chicken house A. Name of bacteria
Feces−2 Feces−6 Feces−8 Feces−9 Indoor−1 Indoor−2 Indoor−6 Indoor−7 Indoor−8 Downwind10m−1 Downwind10m−3 Downwind50m−1 Downwind100m−1 Downwind200m−1
virulence factor genes LTa
STa
STb
STx1
Stx2/Stx2e
+ + – + + + + + – + + + + +
+ + – + + + + + – + + + + +
– – – – – – – – – – – + – –
+ – – + – – – – – – – – + –
– – – – – – – – – – – – – –
“+” represents positive; “-”represents negative.
4. Discussion Escherichia coli is a major pathogen that causes diarrhea and death in animals. Since Kaufmann (21 Century 5 O's) established the serotype classification system of E. coli, serum type has been used as the basis for identifying pathogenic E. coli and for epidemiological investigation. Escherichia coli has been used as an indicator of air quality at livestock and poultry houses (Hojovec, Fiser, & Kubicek, 1977), where it has a variety of serotypes represented in a small number of pathogenic bacteria. Most pathogenic E. coli can pass through the digestive tract, contact infections, and be infected by airborne respiratory infections (Mueller, Dossow, & Dinter, 1988). The pathogens of E.coli in various serotypes also differ in the pathogenesis of toxins. In poultry, it can cause various avian diseases such as septicemia, swollen head syndrome, umbilical cord inflammation, yolk peritonitis, and chronic respiratory disease. (Dho-Moulin & Fairbrother, 1999; Xie, Kim, & Kim, 2004), causing huge economic losses. For humans, a small number of E. coli can cause a variety of human diseases such as hemolytic uremia, thrombocytopenic purpura, hemolytic enteritis, neonatal meningitis, and bloody diarrhea (Strachan, Doyle, Kasuga, Rotariu, & Ogden, 2005; Vidotto, Queiroz, Lima, & Gaziri, 2007). The virulence of E. coli is typically determined by whether it carries the corresponding virulence factor genes, meaning that the detection of toxins is important proof for identifying pathogenic E. coli. In1988, polymerase chain reaction (PCR), Great innovations have taken place in the field of Microbiology (Saik et al., 1988). It can allow a very small amount of target DNA to be specifically amplified by million times, thus substantially enhancing the detection of DNA molecules,can detect nonculturable microbiology. For the detection of biological aerosol, PCR detection method has the greatest accuracy, and is quick and cost effective. This study adopted multi-PCR, which allowed several virulence factor genes to be amplified in the same reaction system with multiple primer pairs. This setup simplified the process, shortened the time required, and accelerated gene typing. The gene-specific primer of the five kinds of E. coli enterotoxins was designed according to the literature (Cheng et al., 2006), which established the multi-PCR method for molecular epidemiological investigation of virulence factor genes in E. coli and supported the investigation of the spread of those genes in animal houses. Results provide evidence that the established multi-PCR method could not only identify the five types of virulence factor genes in E. coli (i.e., LTa, STa, STb, stx1, and stx2/stx2e), but also test for any type of combination. PCR reactions are easy to execute, relatively inexpensive, and highly reliable. Such a process is beneficial for achieving a rapid census of E. coli toxin types and provides certain insights into clinical diagnosis. Bioaerosols has caused many adverse health effects, even severe casualties when pathogenic microbial species are involved (Xu et al. (2011). Respiratory tract is an important way of aerosol transmission (Martins et al., 2015), many studies have demonstrated that many diseases could aerosol transmission through coughing, breathing, and so on (Lindsley, Reynolds, Szalajda, Noti, & Beezhold, 2013)，and spread to different distances according to the conditions (Seaver, Eversole, Hardgrove, Cary, and Roselle (1999)). According to previous studies (Griffin (2007); Goudie (2014)), opportunistic human pathogens, such as Aspergillus fumigatus, Aspergillus niger, Staphylococcus gallinarum and Gordonia terrae, bioaerosol could be spread. In the hospital environment, many bacteria and viruses can be transmitted to health care workers through aerosols (Yeh et al., 1995). This study show that virulence factor genes inside chicken houses (i.e., in animal feces and the indoor air environment) and their surrounding environments (i.e., 10 and 50 m windward and 10, 50, 100, 200, and 400 m leeward), especially in the leeward direction, are of the same type. Escherichia coli therefore apparently spread from the inside to the outside of the chicken houses (Liu et al., 2012), probably prompting certain pollutants in the environments surrounding farms, therefore threatening the health of chickens or nearby residents (Gao et al., 2015). The degree of influence and the mechanism need further investigation. The occurrence and spread of E.coli aerosols carrying virulence genes, indicate the model of airborne transmission of pathogenic microorganisms. Airborne microbes released from animal house may pose health risks to exposed animals and human beings, especially farm workers. The feces carried Virulence Factor Genes in E. coli was found aerosolized and spread to outdoor air, especially to the downwind air of the animal houses via air exchange (Duan et al., 2009). It could not build a residential area within 500 m of the animal house, and the type of animal house can impact the level 8
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
of microbial aerosol transmission. Using E. coli as a bacterial indicator for studying the spread of microbial aerosols from animal houses to surrounding environments has strong public health and epidemiological significance. Acknowledgments This work was supported by the National Natural Science Foundation of China [31270172], Shandong “Double Tops” Program (SYL2017YSTD11). Conflict of interest statement The authors have not conflict of interest to declare. Author contribution statement Tongjie Chai designed experiments; Huiyong Duan, Yumei Cai,Zhaobing Zhong carried out experiments; Bo Wu,Qin Qi analyzed experimental results. Bo Wu wrote the manuscript. Appendix 1. Sampling equipment and some sampling of animal homes situation
9
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
References Dowes, J., Thorne, P., Pearce, N., & Heederik, D. (2003). Bio-aerosol health effects and exposure aassessment: Progress and prospects. Annals of Occupation, 47(3), 187–200. http://dx.doi.org/10.1093/annhyg/meg032. Dutkiewicz, J., Pomorski, Z. J. H., & Sitkowska, J. (1994). Airborne microorganisms and endotoxin in animal houses. Grana, 33(2), 85–90. http://dx.doi.org/10.1080/ 00173139409427837. Fiegel, J., Clarke, R., & Edwards, D. A. (2006). Airborne infectious disease and the suppression of pulmonary bioaerosols. Drug Discovery Today, 11(1/2), 51–57. http:// dx.doi.org/10.1016/ S1359- 6446(05)03687-1. Donaldson, A. (1999). Airborne spread of foot-and-mouth disease. Microbiology Today, 26, 18–119. Dutkiewicz, J. (1994). Bacteria, fungi, and endotoxin as potential agents of occupational hazard in a potato processing plant. American Journal of Medicine, 25, 43–46. http://dx.doi.org/10.1002/ajim. 4700250111. Duan, H. Y. (2005). Detection of airborne microbiological aerosol in rabbit stables. China Herbivores, 25, 41–43. Schroeder, C. M., White, D. G., & Meng, J. (2004). Retail meat and poultry as a reservoir of antimicrobial-resistant Escherichia coli. Food Microbiology, 21, 249–255. http://dx.doi.org/10.1016/ S0740-0020(03)00074-1. Somarelli, J. A., Makarewicz, J. C., Sia, R., & Simon, R. (2007). Wildlife identified as major source of Escherichia coli in agriculturally dominated water-sheds by BOX A1R-derived genetic fingerprints. Journal of Environment Management, 82, 60–65. http://dx.doi.org/10.1016/j.jenvman.2005.12.013. Jackson, V., Blair, I. S., McDowell, D. A., Kennedy, J., & Bolton, D. J. (2007). The incidence of significant foodborne pathogens in domestic refrigerators. Food Control, 18, 346–351. http://dx.doi.org/10.1016/j.foodcont.2005.10.018. Beutin, L., Steinrück, H., Krause, G., Steege, K., Haby, S., et al. (2007). Comparative evaluation of the Ridascreen Verotoxin enzyme immunoassay for detection of Shiga-toxin producing strains of Escherichia coli (STEC) from food and other sources. Journal of Applied Microbiology, 102, 630–639. http://dx.doi.org/10.1111/j. 1365-2672.2006.03139.x. Zucker, B. A., Trojan, S., & Muller, W. (2000). Airborne gram-negative bacterial flora in animal houses. Journal of Veterinary Medicine Series-B, 47(1), 37–46. http://dx. doi.org/10.1046/j.1439-0450.2000.00308.x. Duan, H. Y., Chai, T. J., Wang, Y. X., Müller, W., & Zucker, B. A. (2006). Concentration to airborne endotoxins and airborne bacteria in Chinese rabbitries. Berl Münch Tier ärztl Wochenschr, 119(1/2), 40–44. Gross, W. B. (1994). Diseases due to Esherichia coli in poultry. In C. L. Gyles (Ed.). Escherichia coli in domestic animals and humans (pp. 237–259). Walling-ford: CAB International. Brown, J. K. M., & Hovmoller, M. S. (2002). Aerial dispersal of pathogens on the global and continental scales and its impact on plant disease. Science, 297, 537–541. Lv, J., Wei, L. M., Yang, Y., Wang, B. X., Liang, W., Gao, Y. W., et al. (2015). Amino acid substitutions in the neuraminidaseprotein of an H9N2 avian influenza virus affect its airborne transmission in chickens. Veterinary Research, 46, 44. http://dx.doi.org/10.1186/s13567- 014-0142-3. Kim, K. Y., & Kim, C. N. (2007). Airborne microbiological characteristics in public buildings of Korea. Building and Environment, 42(5), 2188–2196. http://dx.doi.org/ 10.1016/j.buildenv.2006.04. 013. Hwang, S. H., Yoon, C. S., Ryu, K. N., Paik, S. Y., & Cho, J. H. (2010). Assessment of airborne environmental bacteria and related factors in 25 underground railway
10
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
stations in Seoul, Korea. Atmospheric Environment, 44, 1658–1662. http://dx.doi.org/10.1016/j.atmosenv.2010. 01.047. Ibenyassine, K., AitMhand, R., Karamoko, Y., Cohen, N., & Nennaji, M. M. (2006). Use of repetitive DNA sequences to determine the persistence of enteropathogenic Escherichia coli in vegetables and in soil grown in fields treated with contaminated irrigation water. Letters in Applied Microbiology, 43, 528–533. http://dx.doi. org/10.1111/j.1472-765X.2006.01997.x. Cattoir, V., Poirel, L., Rotimi, V., Soussy, C. J., & Nordmann, P. (2007). Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBLproducing enterobacterial isolates. Journal of Antimicrobial Chemotherapy, 60, 394–397. http://dx.doi.org/10.1093/jac/dkm204. Gao, L. L., Tan, Y. K., Zhang, X. D., Hu, J. Q., Miao, Z. M., & Wei, L. M. (2015). Emissions of Escherichia coli carrying extended-spectrum β-lactamase resistance from pig farms to the surrounding environment. International Journal of Environmental Reserach and Public Health, 12, 4203–4213. http://dx.doi.org/10.3390/ ijerph120404203. Hojovec, J., Fiser, A., & Kubicek, K. Z. (1977). Die Rolle von Indikator keimen fuer die Beurteilung der Stalluft. Mh Vet Med, 32, 766–769. Mueller, W., Dossow, V. A., & Dinter, P. S. (1988). Die Tenazitaet von Bakterien im luftgetragenen Zustand. V. Mitt.: Vergleich zwischen kaelber-und ferkelpathogenen E.coli Staemmen. Tieraerztl Umschau, 4, 258–262. Dho-Moulin, M., & Fairbrother, J. M. (1999). Avian pathogenic Escherichia coli (APEC). Veterinary Research, 30, 299–316. Xie, Y., Kim, K. J., & Kim, K. S. (2004). Current concepts on Escherichia coli K1 translocation of the blood-brain barrier. FEMS Immunology and Medical Microbiology, 42, 271–279. http://dx.doi.org/10.1016/ j.femsim.2004.09.001. Strachan, N. J. C., Doyle, M. P., Kasuga, F., Rotariu, O., & Ogden, I. D. (2005). Dose response modelling of Escherichia coli O157 incorporating data from foodborne and environmental outbreaks. International Journal of Food Microbiology, 103, 35–47. http://dx.doi.org/10.1016/j.ijfoodmicro.2004.11.023. Vidotto, M. C., Queiroz, M. B., Lima, N. C. S. D., & Gaziri, L. C. J. (2007). Prevalence of ibeA gene in avian pathogenic Escherichia coli (APEC). Veterinary Microbiology, 119, 88–89. http://dx.doi.org/10.1016/j.vetmic.2006.08.016. Saik, R., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., et al. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science, 239, 487–491. http://dx.doi.org/10.1126/science.2448875. Cheng, D. R., Sun, H. C., Xu, J. S., & Gao, S. (2006). PCR detection of virulence factor genes in Escherichia coli isolates from weaned piglets with edema disease and/or diarrhea in China. Veterinary Microbiology, 115, 320–328. http://dx.doi.org/10.1016/j.vetmic.2006.02.013. Xu, Z. Q., Wu, Y., Shen, F. X., Chen, Q., Tan, M. M., & Yao, M. S. (2011). Bioaerosol Science, technology, and engineering: Past, present, and future. Aerosol Science and Technology, 43, 1337–1349. http://dx.doi.org/10.1080/02786826.2013.803019. Martins, V., Minguillón, M. C., Moreno, T., Querol, X., Miguel, D. E., Capdevila, M., ... Lazaridis, M. (2015). Deposition of aerosol particles from a subway micro environment in the human respiratory tract. Journal of Aerosol Science, 90, 103–113. http://dx.doi.org/10.1016/j.jaerosci.2015.08.008. Lindsley, W. G., Reynolds, J. S., Szalajda, J. V., Noti, J. D., & Beezhold, D. H. (2013). A cough aerosol simulator for the study of disease transmission by human coughgenerated aerosols. Aerosol Science and Technology, 47, 937–944. http://dx.doi.org/10.1080/02786826.2013.803019. Seaver, M., Eversole, J. D., Hardgrove, J. J., Cary, W. K., & Roselle, D. C. (1999). Size and fluorescence measurements for field detection of biological aerosols. Aerosol Science and Technology, 30, 174–185. http://dx.doi.org/10.1080/02786826.2013.803019. Griffin, D. W. (2007). Atmospheric movement of microorganisms in clouds of desert dust and implications for human health. Clinical Microbiology Reviews, 20, 459–477. http://dx.doi.org/10.1128/CMR.00039-06. Goudie, A. S. (2014). Desert dust and human health disorders. Environment International, 63, 101–113. http://dx.doi.org/10.1016/j.envint.2013.10.011. Yeh, H. C., Turner, R. S., Jones, R. K., Muggenburg, B. A., Lundgren, D. L., & Smith, J. P. (1995). Characterization of aerosols produced during surgical procedures in hospitals. Aerosol Science and Technology, 22(2), 151–161. http://dx.doi.org/10.1080/02786829408959736. Liu, D. J., Chai, T. J., Xia, X. Z., Gao, Y. M., Cai, Y. M., Li, X. X., et al. (2012). Formation and transmission of Staphylococcus aureus (including MRSA) aerosols carrying antibiotic-resistant genes in a poultry farming environment. Science of The Total Environment, 426(1), 139–145. http://dx.doi.org/10.1016/j.scitotenv. 2012.03.060. Lim, S. K., Lee, H. S., Nam, H. M., et al. (2007). Antimicrobial resistance observed in Escherichia coli strains isolated from fecal samples of cattle and pigs in Korea during 2003–2004. International Journal of Food Microbiology, 116, 283–286. Duan, H. Y., Chai, T. J., Liu, J. Z., Zhang, X. X., Qi, C. H., Gao, J., ... Schlenker, G. (2009). Source identification of airborne Escherichia coli of swine house surroundings using ERIC-PCR and REP-PCR. Environmental Research, 109, 511–517. http://dx.doi.org/10.1016/j.envres.2009.02.014.
11
Contents lists available at ScienceDirect
Journal of Aerosol Science journal homepage: www.elsevier.com/locate/jaerosci
Identifying virulence factor genes in E. coli in animal houses and their transmission to outside environments Bo Wua,c,1, Huiyong Duana,b,1, Qin Qid, Yumei Caia, Zhaobing Zhonga, Tongjie Chaia,
⁎
a
College of Veterinary Medicine, Shandong Agricultural University, Sino-German Cooperative Research Centre for Zoonosis of Animal Origin Shandong Province, 61 Daizong Road, Tai’an 271000, Shandong Province, China Department of Biotechnology Engineering, Taishan Polytechnic, Tai’an 271000, Shandong Province, China c Collaborative Innovation Centre for the Origin and Control of Emerging Infectious Diseases of Taishan Medical College, Tai’an 271000, Shandong Province, China d Taian Central Hospital, Tai’an 271000, Shandong Province, China b
AR TI CLE I NF O
AB S T R A CT
Keywords: Virulence factor genes E. coli Multiplex PCR Animal houses Transmission
Escherichia coli is a common bacterium in the air; it can affect the health of humans and animals. The carrying status of five primary virulence factor genes in E. coli (i.e., STa, STb, LTa, stx1, and stx2/stx2e) in various animal houses and their spread to the outside environment were investigated by comparing the air inside animal houses with that outside the houses. Multiplex polymerase chain reaction detection of the five genes was performed on samples from five chicken houses, and 117 E. coli isolates were obtained. From five swine houses, 120 were obtained, and from six cow houses, 143 were obtained. Results reveal that E. coli virulence genes derived from animal houses can be propagated via gas exchange from the inside to the outside and, depending on weather conditions, across some distance, resulting in biological pollution and the spread of pathogenic microorganisms. This study of the transmission of environmental microbial aerosols in animal houses has great significance in public health and epidemiology.
1. Introduction Although air is vital for humans and other animals to survive, in most cases, the microbes that affect human and animal health and production performance are airborne. Accordingly, measuring microbial air contamination is essential for gauging air quality. At the same time, microbes are a chief factor of environmental pollution in animal houses, where pollution can cause the spread of a number of infectious diseases. Airborne bacteria in animal houses include pathogenic, conditionally pathogenic, and nonpathogenic bacteria (Dowes, Thorne, Pearce, & Heederik, 2003) that can cause infection among both animals and animal breeders (Dutkiewicz, Pomorski, & Sitkowska, 1994; Fiegel, Clarke, & Edwards, 2006). Even a small amount of pathogenic bacteria can cause respiratory tract infections, especially in the lower respiratory tract (Donaldson, 1999; Fiegel et al., 2006). Therefore, microbial aerosol pollution not only affects human and animal health, but also results in the spread of infectious zoonotic pathogens among humans and animals (Duan, 2005; Dutkiewicz, 1994). A commensal bacterium in the intestinal tracts of humans and animals (Schroeder, White, & Meng, 2004), Escherichia coli can cause colibacillosis under certain conditions, and it contaminates the environment via fecal excretion (Beutin, Steinrück, Krause, Steege, & Haby, 2007; Jackson, Blair, McDowell, Kennedy, & Bolton, 2007; Somarelli, Makarewicz, Sia, & Simon, 2007). Moreover, it
⁎
Corresponding author. E-mail address: [email protected] (T. Chai). 1 Bo Wu and Huiyong Duan contributed equally in this paper. https://doi.org/10.1016/j.jaerosci.2017.11.009 Received 18 July 2017; Received in revised form 19 November 2017; Accepted 23 November 2017 0021-8502/ © 2017 Elsevier Ltd. All rights reserved.
Please cite this article as: Wu, B., Journal of Aerosol Science (2017), https://doi.org/10.1016/j.jaerosci.2017.11.009
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
is a common bacterium in the air, especially in animal houses and their surrounding environments. Escherichia. coli is therefore an important pathogenic bacteria in water, food, and other agricultural and environmental forms of pollution (Duan, Chai, Wang, Müller, & Zucker, 2006; Zucker, Trojan, & Muller, 2000). Pathogenic E. coli must first be localized in the settlement and breeding and then invade the body or produce toxins. Not all virulence factors of the various pathogenic E. coli are the same. For example, ST and LT enterotoxins, as well as others, can change the absorption and secretion functions of intestinal cells, resulting in large water and electrolyte flows to the intestine–the clinical manifestation of watery diarrhea–or vascular endothelial cell damage, resulting in piglet diarrhea and edema disease. The most potent placental immunogen and mucosal immune adjuvant is LT, and it can effectively start the body's local and systemic humoral immunity and cellular immunity. On the other hand, Stx has strong cytotoxic, enterotoxic, and neurotoxic effects, which cause different clinical manifestations. Aerosols composed of microbes and their metabolites in and around animal houses cause environmental pollution (Gross, 1994), influence animal health and productivity, and prompt the spread of infectious airborne diseases (Brown & Hovmoller, 2002; Lv et al., 2015). Research on the spread of microbial aerosols in animal breeding environments has focused on changes in bacterial concentrations (Hwang, Yoon, Ryu, Paik, & Cho, 2010; Kim & Kim, 2007), bacterial resistance, and the content of certain pathogenic bacteria (Cattoir, Poirel, Rotimi, Soussy, & Nordmann, 2007; Ibenyassine, AitMhand, Karamoko, Cohen, & Nennaji, 2006); however, studies conducted in the field from a molecular biology perspective are rare (Gao et al., 2015). In response, we examined the carrying situations of five primary virulence factor genes in E. coli inside and outside various animal houses. We also investigated the spread of the genes to the outside of the houses by performing comparative detection analyses on the genes found inside and outside the houses. The spread and infection of E. coli microbial aerosols present a great threat to the health of residents around poultry houses, especially those downwind. This study has strong public health and epidemiological significance.
2. Materials and methods 2.1. Animal house situations Sampling sites were at several farms in the cities of Taian, Laiwu, Jinan, and ZiBo, China. Samples were taken from five chicken houses, five swine houses, and six cow houses, each house utilizing a different structure type. Wind speed, temperature, and relative humidity were measured at the beginning, middle, and end of the sampling period. Table 1 presents detailed information about the animal houses.
Table 1 Description of the animal houses. Animal houses
Chicken houses
A B C D E
Swine houses
Cow houses
A' B' C' D' E' A′′ B′′ C′′ D′′ E′′′ F′′
Sampling sites
Chicken farm in Ningyang Fangcun, Taian 1 Fangcun, Taian 2 Mazhuang, Taian Xuezhuang, Taian Taian 1 Niuquan, Laiwu Mazhuang, Feicheng Taian 2 Taian 3 Cow farm in Taian 1 Cow farm in Taian 2 Jinan Gaoqing, Zibo 1 Gaoqing, Zibo 2 Cow farm in Taian 3
Total number
Breeding ways
Inside houses
Outside houses
Temperature (°C)
Humidity (%)
Wind speed (m/s)
Temperature (°C)
Humidity (%)
Wind speed (m/s)
6000
closed
26
40
0
21
50
1–3
2200
caged
26
34
0
29
50
1–3.1
3000
half-closed
31
44
0
35
36
1.5–3
3500
half-closed
31
60
0
32
75
0–1.5
4500
caged
30
70
0
31
65
0–2
150 500 600
closed half-closed half-closed
7 12 28
81 65 67
0 0 0
4 8 35
78 60 58
0–0.6 1.4–5 0–1.5
360 280 1000
half-closed half-closed half-closed
20 22 30
67 65 65
0 0 0
22 24 32
70 70 60
0–1.5 0–1.5 0–1.5
450
half-closed
24
65
0
26
60
1–5
300 520 600 500
open half-closed half-closed open
22 20 19 16
67 63 63 58
0 0 0 0
24 21 20 18
65 60 62 52
0–1.5 0–2.5 0–1.5 0–2
2
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
2.2. Sampling Air samples were collected by using six-stage Andersen microbial samplers and LWC-I microbial samplers. In all cases, the sampling flow rate was 28.3 L/min taken 50–80 cm above ground level. Air samples were collected for 1–5 min from windward gusts inside and outside the animal houses (10 and 50 m) and leeward gusts 10, 50, 100, 200, and 400 m outside the animal houses, collecting approximately 30 to 300 colonies per class. Three sampling sites were determined for each animal house, and five samples were taken from each site. Simultaneously, 10–15 feces samples were collected at random from inside each animal house. 2.3. Calculating the separation, identification, and concentration of E. coli in air samples Samples collected (i.e., the panels and test strips) were cultured using MacConkey agar no. 3 for 24 h at 37 ℃. All red bacterial colonies were assessed for KHO response as a substitute for Gram staining, then pure cultures of all gram-negative Brevibacillus brevis colonies were isolated in MacConkey agar and identified using common biochemical tests. For other E. coli strains, API 20 E (BioMérieux, Marcy–I′Etoile, France) was used for identification. They were then counted, and content (CFU/m3) was calculated. (1) where Q1 is the sum of the adjusted number of colonies at all six stages, and t is the sampling time in minutes. Lastly, the broth culture containing 20% glycerol was refrigerated at −20 ℃. 2.4. Calculating the separation, identification, and concentration of E. coli in feces Feces samples of roughly 0.5 g were collected into small bottles containing 4.5 mL sterilized diluent. Samples were progressively diluted 10 times, reaching a concentration 10−6 that of the original sample. They were then dropped onto MacConkey agar, upon which three plates were set using a Transferpettor (50 µL). Each plate contained three dilutions, each of which were dropped into a 3 × 3 matrix at a certain distance. After culturing at 37 ℃ for 18–20 h, the colony numbers in the three sample drops of the same dilution were counted using the countability principle allowing selection of the proper dilution. The number of bacteria per gram of sample was calculated:
Number of bacteria (CFU)/g = Sum of colonies in 3 drops of sample/0.005 mL *dilution
(2)
Using the method described by Lim et al. (2007), the dilution was first inoculated in an EMB (Tianhe, Hangzhou) culture medium and cultured at 37 ℃ for 18–20 h. Black colonies that showed metallic glittering were selected and inoculated on MacConkey nutrition agar (OXOID) and cultured at 37 ℃ for 18–20 h. Then, one or two typical red colonies were selected, identified, and preserved according to the method described in Section 2.3. 2.5. Culturing E. coli and extracting template DNA 2.5.1. Culturing E. coli After isolation and purification, the bacteria preserved in Experiment 1 were inoculated on MacConkey nutrition agar and cultured at 37 ℃ for 24 h. Single pink colonies that resulted were inoculated in LB broth and cultured at 37 ℃ for 24 h. 2.5.2. Preparing templates Escherichia coli were inoculated in 5 mL culture medium and cultured by vibration for 18 h. A 1.5-mL portion of the culture medium was retrieved and centrifuged at 10,000 rpm for 2 min. Once the supernatant was discarded, the remainder was washed twice using 100 µL TE buffer. Then, 100 L TE buffer suspension precipitation was boiled at 100 ℃ for 10 min, quickly cooled in icewater for 5 min, and centrifuged at 12,000 rpm for 2 min. This supernatant was preserved as a back-up template at −20 ℃. Reference bacteria C83600 (STb and LTa), C83710 (STa), H30 (stx1), SDZ21 (LTa and stx2), and SDZ15 (stx2) were preserved in our lab. 2.6. Polymerase chain reaction 2.6.1. Synthesis of primers Primers were synthesized by Shanghai Biological Engineering Co., Ltd. Table 2 presents the primers and their sequences. 2.6.2. Reaction conditions Multiplex polymerase chain reaction (PCR) was performed using 1× buffer, 200 µM dNTPs, 1.5 U Taq DNA polymerase, 1.5 mM MgCl2 (TaKaRa), five pairs of primers at 25 pmol each, and 2 µL of template DNA. This mixture was diluted to 25 µL using distilled water. An initial denaturation was performed by holding the mixture for 3 min at 95 ℃ followed by 32 cycles at 94 ℃ for 30 s. It was reduced to 58–54 ℃ (decreased every two cycles) for 1 min, then sustained at 72 ℃ for 1 min. The reaction was terminated at 72 ℃ for 10 min. Before electrophoresis, all products were preserved at 4 ℃. 3
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
Table 2 Primers and their sequences used in this experiment (Cheng, et al., 2006). Virulence factor genes STa STb LTa Stx1 Stx2/Stx2e
Sequences（5’−3’）
Location (accession number)
Amplified bands size range (bp)
F R F R F R F R F
GGGTTGGCAATTTTTATTTCTGTA ATTACAACAAAGTTCACAGCAGTA ATGTAAATACCTACAACGGGTGAT TATTTGGGCGCCAAAGCATGCTCC TAGAGACCGGTATTACAGAAATCTGA TCATCCCGAATTCTGTTATATATGTC ATTCGCTGAATGTCATTCGCT ACGCTTCCCAGAATTGCATTA TTTCTTCGGTATCCTATTCCC
183
R
GATGCATCTCTGGTCATTGTA
298–321 (M25607) 457–480 (M25607) 1–20 (M35729) 334–357 (M35729) 579–604 (AB011677) 835–860 (AB011677) 110–130 (AB030485) 753–773 (AB030485) 222–242 (Z50754), 288–308 (M21534) 685–705 (Z50754), 751–771 (M21534)
360 282 664 484
2.6.3. Electrophoresis All PCR products were electrophoresed on a 1.2% (w/v) agarose gel containing 1 × TAE and 0.5 mg mL−1 ethidium bromide along with the DL2000 DNA markers (TaKaRa) for 1–2 h. Results of electrophoresis were photographed using an ultraviolet analyzer.
3. Results 3.1. Concentrations of airborne E. coli in various animal houses The E. coli concentrations in the five chicken houses were 15–81 CFU/m3 air, and the concentrations of respirable E. coli were 9–55 CFU/m3. The concentrations in the 5 swine houses were 20–52 CFU/m3, and concentrations of respirable E. coli were 14–37 CFU/m3. The concentrations in the 6 cow houses were 11–56 CFU/m3, and concentrations of respirable E. coli were 8–39 CFU/ m3 (see Table 3). The aerosol E. coli (Fig. 1) was distributed primarily at the 3–6 level using the Andersen samplers with an aerodynamic diameter < 6.0 µm. Furthermore, the largest number of particles was collected at the third level (3.0–6.0 µm) followed by those at the first level (> 8.2 µm).
Table 3 Concentrations of airborne E. coli in different animal houses.
chicken houses
3
concentration ( CFU/m )
Total
☆
Respirable
★
Ratio（%）
swine houses
concentration ( CFU/m3)
Total
☆
Respirable
★
Ratio（%）
cow houses
concentration ( CFU/m3)
Total
☆
★
Ratio（%）
Respirable
Max. Min. Mean Max. Min. Mean Max. Min. Mean Max. Min. Mean Max. Min. Mean Max. Min. Mean Max. Min. Mean Max. Min. Mean Max. Min. Mean
Note: A,B,C,D,E,F represent animal house code.
4
A
B
C
D
E
F
134 7 33 a 85 7 27 a 100 63.2 81.0 a 47 6 20 a 29 6 14 a 100.0 62.5 80.8 a 60 20 36 a 54 12 24 a 80.0 50.0 66.4a
59 6 21 a 29 6 12 b 100 50.0 69.4 a 41 6 21 a 29 6 15 a 100.0 60.0 79.6 a 177 0 41 a 143 0 28 a 75.0 0 62.4 a
71 0 22 a 47 0 13 b 66.7 0 40.0 b 120 14 48 b 85 14 34 b 100.0 62.5 75.0 a 154 0 56 a 78 0 39 a 75.0 0 62.9 a
236 12 81 b 153 6 55 c 83.3 50.0 68.4 127 14 52 b 92 7 37 b 80.0 50.0 67.9 47 0 11 b 34 0 8b 75.0 0 66.1
35 0 15 a 18 0 9b 100 0 55.0 a 113 7 38 b 85 7 27 b 100.0 50.0 70.3 a 141 0 34 a 121 0 26 a 75.0 0 64.2 a
98 12 48 a 76 0 37 a 100.0 62.5 78.6 a
a
a
a
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
Fig. 1. Multiplex PCR detection of five virulence factor genes in Escherichia coli (Lanes: 1, Escherichia coli C83600; 2, Escherichia coli C83710; 3, Escherichia coli C83600; 4, Escherichia coli isolated from air; 5, Escherichia coli SDZ21; 6, Escherichia coli SDZ15; 7, Escherichia coli H30; 8 and 9, Escherichia coli isolated from air; N, negative control; M, DL2000 DNA Marker).
3.2. Detection results of the five primary virulence factor genes in E. coli in chicken houses, swine houses and cow houses Fig. 2 illustrates the results of the five virulence factor genes found under the same PCR conditions. The genes could amplify their own bands, which ranged in size; STa, STb, LTa, stx1, and stx2/stx2e were 183, 360, 282, 664, and 484 bp, respectively. Fig. 3 shows the multiplex PCR detection of five virulence factor genes in E. coli. 3.3. Detection results of the five primary virulence factor genes in E. coli in chicken houses, swine houses and cow houses Of the 117 E. coli samples tested from five chicken houses, 9.40% (11/117) of the bacteria carried only the LTa gene, 12.82% (15/ 117) the STa and LTa genes, 11.97% (14/117) the STa, STb, and LTa genes, 2.56% (3/117) the STa, LTa, and stx1 genes, and 10.26% (12/117) the STa, STb, LTa, and stx1 genes. Bacteria carrying the stx2/stx2e gene were not found, and in 54 (46.15%) of the E. coli samples, none of the five genes were found. Results provided evidence that bacteria carrying the LTa gene were the most abundant (53.85%) followed by those with the STa gene (37.61%; see Table 4). Of the 120 E. coli samples tested from five swine houses, many bacteria carried only one type of gene: 11.67% (11/117) carried the LTa gene, 17.50% (21/120) the STb gene, 1.67% (2/120) the STa gene, and 5.00% (6/120) the stx2/stx2e gene. Some bacteria carried two or more genes: STa combined with STb, STa combined with STb and LTa, or STb combined with LTa and stx1, accounting for 3.33% (4/120); 6.67% (8/120) carried the STa and LTa genes, 5.83% (7/120) the LTa and stx2/stx2e genes, 1.67% (2/120) the STa, LTa, and stx1 genes, and 2.50% (3/120) the STa, STb, LTa, and stx1 genes. In 37.50% (45/120) of E. coli samples, all five genes were found (see Table 5). Of 143 E. coli samples tested from six cow houses, 18.88% (27/143) of the bacteria carried only the LTa gene and 4.90% (7/143) only the STb gene. Most bacteria carried two or more genes: 6.99% (10/143) carried the STa and LTa genes, 4.20% (6/143) the LTa and stx1 genes, 6.29% (9/143) the STb and LTa genes, 2.80% (4/143) the STa, STb, and LTa genes, 8.39% (12/143) the STa, LTa, and stx1 genes, 2.10% (3/143) the STb, LTa, and stx1 or the STa, STb, LTa, and stx1 genes, 1.40% (2/143) the LTa, stx1, and stx2/stx2e genes, and 0.70% (1/143) the STa, LTa, stx1, and stx2/stx2e genes. Another 41.26% (9/143) of the E. coli samples did not carry any of the genes. Result show that the number of bacteria carrying the LTa gene ranked first, accounting for 51.75% (74/143), followed
Fig. 2. Size distribution of airborne E. coli according to stage of Andersen sampler.
5
Fig. 3. Multiplex PCR detection of five virulence factor genes in Escherichia coli (Lanes: 1–40, Escherichia coli isolated from animal house; N, negative control; M, DL2000 DNA Marker).
B. Wu et al.
Journal of Aerosol Science xxx (xxxx) xxx–xxx
6
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
Table 4 Multiplex PCR detection of five virulence factor genes in Escherichia coli isolated from 5 chicken houses. Virulence factor genes
Number
Percentage (%)
LTa STa+LTa LTa+STx1 STa+STb+LTa STa+LTa+STx1 STa+STb+LTa+STx1 Stx2/Stx2e Not detected Total
11 15 8 14 3 12 0 54 117
9.40 12.82 6.84 11.97 2.56 10.26 0.00 46.15
Table 5 Multiplex PCR detection of five virulence factor genes in Escherichia coli isolated from 5 swine houses. Virulence factor genes
Number
Percentage (%)
LTa STb STa Stx2/Stx2e STa+LTa STa+STb LTa+ Stx2/Stx2e STa+STb+LTa STa+LTa+STx1 STb+LTa+STx1 STa+STb+LTa+STx1 Not detected Total
14 21 2 6 8 4 7 4 2 4 3 45 120
11.67 17.50 1.67 5.00 6.67 3.33 5.83 3.33 1.67 3.33 2.50 37.50
by those carrying the STa gene, accounting for 20.98% (30/143). The numbers of bacteria carrying the STb and stx1 genes were similar, accounting for 18.18% (26/143) and 18.88% (7/143), respectively. Bacteria carrying the stx2/stx2e gene were the scarcest, accounting for 2.10% (3/143; see Table 6). Detecting virulence factor genes in E.coli in various animal houses and the surrounding environments showed that the number of bacteria carrying the LTa gene were the most abundant. Most E. coli carried two or more genes, the fewest bacteria carried stx2/stx2e and they were not found in chicken houses. 3.4. Outspread of five main virulence factor genes in E. coli in animal houses Taking Chicken House A as an example, the outspread of the five primary virulence factor genes in E. coli in animal houses were examined. The feces carried Virulence Factor Genes in E. coli could be aerosolized, first spread in the air inside the house,then spread to the outside environment through the exchange of air inside and outsidehouse, depending on the weather conditions spread to a certain distance. Such as, Lta and STa could spread from Feces to Indoor air, Downwind different distance. Microbial pollution of the surrounding environment thus occurred to some degree(see Table 7). Table 6 Multiplex PCR detection of five virulence factor genes in Escherichia coli isolated from 6 cow houses. Virulence factor genes
Number
Percentage (%)
LTa STb STa+LTa STb+LTa LTa+STx1 STa+STb+LTa STa+LTa+STx1 STb+LTa+STx1 LTa+STx1+ Stx2/Stx2e STa+STb+LTa+STx1 STa+LTa+STx1+ Stx2/Stx2e Not-detected Total
27 7 10 9 6 4 12 3 2 3 1 59 143
18.88 4.90 6.99 6.29 4.20 2.80 8.39 2.10 1.40 2.10 0.70 41.26
7
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
Table 7 Analysis of five virulence factor genes in Escherichia coli (which similarity ≥90% analyzed using Multiplex-PCR) isolated from chicken house A. Name of bacteria
Feces−2 Feces−6 Feces−8 Feces−9 Indoor−1 Indoor−2 Indoor−6 Indoor−7 Indoor−8 Downwind10m−1 Downwind10m−3 Downwind50m−1 Downwind100m−1 Downwind200m−1
virulence factor genes LTa
STa
STb
STx1
Stx2/Stx2e
+ + – + + + + + – + + + + +
+ + – + + + + + – + + + + +
– – – – – – – – – – – + – –
+ – – + – – – – – – – – + –
– – – – – – – – – – – – – –
“+” represents positive; “-”represents negative.
4. Discussion Escherichia coli is a major pathogen that causes diarrhea and death in animals. Since Kaufmann (21 Century 5 O's) established the serotype classification system of E. coli, serum type has been used as the basis for identifying pathogenic E. coli and for epidemiological investigation. Escherichia coli has been used as an indicator of air quality at livestock and poultry houses (Hojovec, Fiser, & Kubicek, 1977), where it has a variety of serotypes represented in a small number of pathogenic bacteria. Most pathogenic E. coli can pass through the digestive tract, contact infections, and be infected by airborne respiratory infections (Mueller, Dossow, & Dinter, 1988). The pathogens of E.coli in various serotypes also differ in the pathogenesis of toxins. In poultry, it can cause various avian diseases such as septicemia, swollen head syndrome, umbilical cord inflammation, yolk peritonitis, and chronic respiratory disease. (Dho-Moulin & Fairbrother, 1999; Xie, Kim, & Kim, 2004), causing huge economic losses. For humans, a small number of E. coli can cause a variety of human diseases such as hemolytic uremia, thrombocytopenic purpura, hemolytic enteritis, neonatal meningitis, and bloody diarrhea (Strachan, Doyle, Kasuga, Rotariu, & Ogden, 2005; Vidotto, Queiroz, Lima, & Gaziri, 2007). The virulence of E. coli is typically determined by whether it carries the corresponding virulence factor genes, meaning that the detection of toxins is important proof for identifying pathogenic E. coli. In1988, polymerase chain reaction (PCR), Great innovations have taken place in the field of Microbiology (Saik et al., 1988). It can allow a very small amount of target DNA to be specifically amplified by million times, thus substantially enhancing the detection of DNA molecules,can detect nonculturable microbiology. For the detection of biological aerosol, PCR detection method has the greatest accuracy, and is quick and cost effective. This study adopted multi-PCR, which allowed several virulence factor genes to be amplified in the same reaction system with multiple primer pairs. This setup simplified the process, shortened the time required, and accelerated gene typing. The gene-specific primer of the five kinds of E. coli enterotoxins was designed according to the literature (Cheng et al., 2006), which established the multi-PCR method for molecular epidemiological investigation of virulence factor genes in E. coli and supported the investigation of the spread of those genes in animal houses. Results provide evidence that the established multi-PCR method could not only identify the five types of virulence factor genes in E. coli (i.e., LTa, STa, STb, stx1, and stx2/stx2e), but also test for any type of combination. PCR reactions are easy to execute, relatively inexpensive, and highly reliable. Such a process is beneficial for achieving a rapid census of E. coli toxin types and provides certain insights into clinical diagnosis. Bioaerosols has caused many adverse health effects, even severe casualties when pathogenic microbial species are involved (Xu et al. (2011). Respiratory tract is an important way of aerosol transmission (Martins et al., 2015), many studies have demonstrated that many diseases could aerosol transmission through coughing, breathing, and so on (Lindsley, Reynolds, Szalajda, Noti, & Beezhold, 2013)，and spread to different distances according to the conditions (Seaver, Eversole, Hardgrove, Cary, and Roselle (1999)). According to previous studies (Griffin (2007); Goudie (2014)), opportunistic human pathogens, such as Aspergillus fumigatus, Aspergillus niger, Staphylococcus gallinarum and Gordonia terrae, bioaerosol could be spread. In the hospital environment, many bacteria and viruses can be transmitted to health care workers through aerosols (Yeh et al., 1995). This study show that virulence factor genes inside chicken houses (i.e., in animal feces and the indoor air environment) and their surrounding environments (i.e., 10 and 50 m windward and 10, 50, 100, 200, and 400 m leeward), especially in the leeward direction, are of the same type. Escherichia coli therefore apparently spread from the inside to the outside of the chicken houses (Liu et al., 2012), probably prompting certain pollutants in the environments surrounding farms, therefore threatening the health of chickens or nearby residents (Gao et al., 2015). The degree of influence and the mechanism need further investigation. The occurrence and spread of E.coli aerosols carrying virulence genes, indicate the model of airborne transmission of pathogenic microorganisms. Airborne microbes released from animal house may pose health risks to exposed animals and human beings, especially farm workers. The feces carried Virulence Factor Genes in E. coli was found aerosolized and spread to outdoor air, especially to the downwind air of the animal houses via air exchange (Duan et al., 2009). It could not build a residential area within 500 m of the animal house, and the type of animal house can impact the level 8
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
of microbial aerosol transmission. Using E. coli as a bacterial indicator for studying the spread of microbial aerosols from animal houses to surrounding environments has strong public health and epidemiological significance. Acknowledgments This work was supported by the National Natural Science Foundation of China [31270172], Shandong “Double Tops” Program (SYL2017YSTD11). Conflict of interest statement The authors have not conflict of interest to declare. Author contribution statement Tongjie Chai designed experiments; Huiyong Duan, Yumei Cai,Zhaobing Zhong carried out experiments; Bo Wu,Qin Qi analyzed experimental results. Bo Wu wrote the manuscript. Appendix 1. Sampling equipment and some sampling of animal homes situation
9
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
References Dowes, J., Thorne, P., Pearce, N., & Heederik, D. (2003). Bio-aerosol health effects and exposure aassessment: Progress and prospects. Annals of Occupation, 47(3), 187–200. http://dx.doi.org/10.1093/annhyg/meg032. Dutkiewicz, J., Pomorski, Z. J. H., & Sitkowska, J. (1994). Airborne microorganisms and endotoxin in animal houses. Grana, 33(2), 85–90. http://dx.doi.org/10.1080/ 00173139409427837. Fiegel, J., Clarke, R., & Edwards, D. A. (2006). Airborne infectious disease and the suppression of pulmonary bioaerosols. Drug Discovery Today, 11(1/2), 51–57. http:// dx.doi.org/10.1016/ S1359- 6446(05)03687-1. Donaldson, A. (1999). Airborne spread of foot-and-mouth disease. Microbiology Today, 26, 18–119. Dutkiewicz, J. (1994). Bacteria, fungi, and endotoxin as potential agents of occupational hazard in a potato processing plant. American Journal of Medicine, 25, 43–46. http://dx.doi.org/10.1002/ajim. 4700250111. Duan, H. Y. (2005). Detection of airborne microbiological aerosol in rabbit stables. China Herbivores, 25, 41–43. Schroeder, C. M., White, D. G., & Meng, J. (2004). Retail meat and poultry as a reservoir of antimicrobial-resistant Escherichia coli. Food Microbiology, 21, 249–255. http://dx.doi.org/10.1016/ S0740-0020(03)00074-1. Somarelli, J. A., Makarewicz, J. C., Sia, R., & Simon, R. (2007). Wildlife identified as major source of Escherichia coli in agriculturally dominated water-sheds by BOX A1R-derived genetic fingerprints. Journal of Environment Management, 82, 60–65. http://dx.doi.org/10.1016/j.jenvman.2005.12.013. Jackson, V., Blair, I. S., McDowell, D. A., Kennedy, J., & Bolton, D. J. (2007). The incidence of significant foodborne pathogens in domestic refrigerators. Food Control, 18, 346–351. http://dx.doi.org/10.1016/j.foodcont.2005.10.018. Beutin, L., Steinrück, H., Krause, G., Steege, K., Haby, S., et al. (2007). Comparative evaluation of the Ridascreen Verotoxin enzyme immunoassay for detection of Shiga-toxin producing strains of Escherichia coli (STEC) from food and other sources. Journal of Applied Microbiology, 102, 630–639. http://dx.doi.org/10.1111/j. 1365-2672.2006.03139.x. Zucker, B. A., Trojan, S., & Muller, W. (2000). Airborne gram-negative bacterial flora in animal houses. Journal of Veterinary Medicine Series-B, 47(1), 37–46. http://dx. doi.org/10.1046/j.1439-0450.2000.00308.x. Duan, H. Y., Chai, T. J., Wang, Y. X., Müller, W., & Zucker, B. A. (2006). Concentration to airborne endotoxins and airborne bacteria in Chinese rabbitries. Berl Münch Tier ärztl Wochenschr, 119(1/2), 40–44. Gross, W. B. (1994). Diseases due to Esherichia coli in poultry. In C. L. Gyles (Ed.). Escherichia coli in domestic animals and humans (pp. 237–259). Walling-ford: CAB International. Brown, J. K. M., & Hovmoller, M. S. (2002). Aerial dispersal of pathogens on the global and continental scales and its impact on plant disease. Science, 297, 537–541. Lv, J., Wei, L. M., Yang, Y., Wang, B. X., Liang, W., Gao, Y. W., et al. (2015). Amino acid substitutions in the neuraminidaseprotein of an H9N2 avian influenza virus affect its airborne transmission in chickens. Veterinary Research, 46, 44. http://dx.doi.org/10.1186/s13567- 014-0142-3. Kim, K. Y., & Kim, C. N. (2007). Airborne microbiological characteristics in public buildings of Korea. Building and Environment, 42(5), 2188–2196. http://dx.doi.org/ 10.1016/j.buildenv.2006.04. 013. Hwang, S. H., Yoon, C. S., Ryu, K. N., Paik, S. Y., & Cho, J. H. (2010). Assessment of airborne environmental bacteria and related factors in 25 underground railway
10
Journal of Aerosol Science xxx (xxxx) xxx–xxx
B. Wu et al.
stations in Seoul, Korea. Atmospheric Environment, 44, 1658–1662. http://dx.doi.org/10.1016/j.atmosenv.2010. 01.047. Ibenyassine, K., AitMhand, R., Karamoko, Y., Cohen, N., & Nennaji, M. M. (2006). Use of repetitive DNA sequences to determine the persistence of enteropathogenic Escherichia coli in vegetables and in soil grown in fields treated with contaminated irrigation water. Letters in Applied Microbiology, 43, 528–533. http://dx.doi. org/10.1111/j.1472-765X.2006.01997.x. Cattoir, V., Poirel, L., Rotimi, V., Soussy, C. J., & Nordmann, P. (2007). Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBLproducing enterobacterial isolates. Journal of Antimicrobial Chemotherapy, 60, 394–397. http://dx.doi.org/10.1093/jac/dkm204. Gao, L. L., Tan, Y. K., Zhang, X. D., Hu, J. Q., Miao, Z. M., & Wei, L. M. (2015). Emissions of Escherichia coli carrying extended-spectrum β-lactamase resistance from pig farms to the surrounding environment. International Journal of Environmental Reserach and Public Health, 12, 4203–4213. http://dx.doi.org/10.3390/ ijerph120404203. Hojovec, J., Fiser, A., & Kubicek, K. Z. (1977). Die Rolle von Indikator keimen fuer die Beurteilung der Stalluft. Mh Vet Med, 32, 766–769. Mueller, W., Dossow, V. A., & Dinter, P. S. (1988). Die Tenazitaet von Bakterien im luftgetragenen Zustand. V. Mitt.: Vergleich zwischen kaelber-und ferkelpathogenen E.coli Staemmen. Tieraerztl Umschau, 4, 258–262. Dho-Moulin, M., & Fairbrother, J. M. (1999). Avian pathogenic Escherichia coli (APEC). Veterinary Research, 30, 299–316. Xie, Y., Kim, K. J., & Kim, K. S. (2004). Current concepts on Escherichia coli K1 translocation of the blood-brain barrier. FEMS Immunology and Medical Microbiology, 42, 271–279. http://dx.doi.org/10.1016/ j.femsim.2004.09.001. Strachan, N. J. C., Doyle, M. P., Kasuga, F., Rotariu, O., & Ogden, I. D. (2005). Dose response modelling of Escherichia coli O157 incorporating data from foodborne and environmental outbreaks. International Journal of Food Microbiology, 103, 35–47. http://dx.doi.org/10.1016/j.ijfoodmicro.2004.11.023. Vidotto, M. C., Queiroz, M. B., Lima, N. C. S. D., & Gaziri, L. C. J. (2007). Prevalence of ibeA gene in avian pathogenic Escherichia coli (APEC). Veterinary Microbiology, 119, 88–89. http://dx.doi.org/10.1016/j.vetmic.2006.08.016. Saik, R., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., et al. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science, 239, 487–491. http://dx.doi.org/10.1126/science.2448875. Cheng, D. R., Sun, H. C., Xu, J. S., & Gao, S. (2006). PCR detection of virulence factor genes in Escherichia coli isolates from weaned piglets with edema disease and/or diarrhea in China. Veterinary Microbiology, 115, 320–328. http://dx.doi.org/10.1016/j.vetmic.2006.02.013. Xu, Z. Q., Wu, Y., Shen, F. X., Chen, Q., Tan, M. M., & Yao, M. S. (2011). Bioaerosol Science, technology, and engineering: Past, present, and future. Aerosol Science and Technology, 43, 1337–1349. http://dx.doi.org/10.1080/02786826.2013.803019. Martins, V., Minguillón, M. C., Moreno, T., Querol, X., Miguel, D. E., Capdevila, M., ... Lazaridis, M. (2015). Deposition of aerosol particles from a subway micro environment in the human respiratory tract. Journal of Aerosol Science, 90, 103–113. http://dx.doi.org/10.1016/j.jaerosci.2015.08.008. Lindsley, W. G., Reynolds, J. S., Szalajda, J. V., Noti, J. D., & Beezhold, D. H. (2013). A cough aerosol simulator for the study of disease transmission by human coughgenerated aerosols. Aerosol Science and Technology, 47, 937–944. http://dx.doi.org/10.1080/02786826.2013.803019. Seaver, M., Eversole, J. D., Hardgrove, J. J., Cary, W. K., & Roselle, D. C. (1999). Size and fluorescence measurements for field detection of biological aerosols. Aerosol Science and Technology, 30, 174–185. http://dx.doi.org/10.1080/02786826.2013.803019. Griffin, D. W. (2007). Atmospheric movement of microorganisms in clouds of desert dust and implications for human health. Clinical Microbiology Reviews, 20, 459–477. http://dx.doi.org/10.1128/CMR.00039-06. Goudie, A. S. (2014). Desert dust and human health disorders. Environment International, 63, 101–113. http://dx.doi.org/10.1016/j.envint.2013.10.011. Yeh, H. C., Turner, R. S., Jones, R. K., Muggenburg, B. A., Lundgren, D. L., & Smith, J. P. (1995). Characterization of aerosols produced during surgical procedures in hospitals. Aerosol Science and Technology, 22(2), 151–161. http://dx.doi.org/10.1080/02786829408959736. Liu, D. J., Chai, T. J., Xia, X. Z., Gao, Y. M., Cai, Y. M., Li, X. X., et al. (2012). Formation and transmission of Staphylococcus aureus (including MRSA) aerosols carrying antibiotic-resistant genes in a poultry farming environment. Science of The Total Environment, 426(1), 139–145. http://dx.doi.org/10.1016/j.scitotenv. 2012.03.060. Lim, S. K., Lee, H. S., Nam, H. M., et al. (2007). Antimicrobial resistance observed in Escherichia coli strains isolated from fecal samples of cattle and pigs in Korea during 2003–2004. International Journal of Food Microbiology, 116, 283–286. Duan, H. Y., Chai, T. J., Liu, J. Z., Zhang, X. X., Qi, C. H., Gao, J., ... Schlenker, G. (2009). Source identification of airborne Escherichia coli of swine house surroundings using ERIC-PCR and REP-PCR. Environmental Research, 109, 511–517. http://dx.doi.org/10.1016/j.envres.2009.02.014.
11