- Email: [email protected]
IFNβ Treatment Inhibits Nerve Injury-induced Mechanical Allodynia and MAPK Signaling By Activating ISG15 in Mouse Spinal Cord
Journal Pre-proof
IFNβ treatment inhibits nerve injury-induced mechanical allodynia and MAPK signaling by activating ISG15 in mouse spinal cord Su Liu , Stephen Karaganis , Ru-Fan Mo , Xiao-Xiao Li , Ruo-Xin Wen , Xue-Jun Song PII: DOI: Reference:
S1526-5900(19)30869-7 https://doi.org/10.1016/j.jpain.2019.11.010 YJPAI 3820
To appear in:
Journal of Pain
Received date: Revised date: Accepted date:
29 May 2019 15 October 2019 11 November 2019
Please cite this article as: Su Liu , Stephen Karaganis , Ru-Fan Mo , Xiao-Xiao Li , Ruo-Xin Wen , Xue-Jun Song , IFNβ treatment inhibits nerve injury-induced mechanical allodynia and MAPK signaling by activating ISG15 in mouse spinal cord, Journal of Pain (2019), doi: https://doi.org/10.1016/j.jpain.2019.11.010
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © Published by Elsevier Inc. on behalf of the American Pain Society
IFNβ treatment inhibits nerve injury-induced mechanical allodynia and MAPK signaling by activating ISG15 in mouse spinal cord
Su Liu1,2, Stephen Karaganis1,3, Ru-Fan Mo1, Xiao-Xiao Li2, Ruo-Xin Wen1, Xue-Jun Song1† 1
SUSTech Center for Pain Medicine and Medical School, Southern University of Science and
Technology, Shenzhen, Guangdong, China 2
Department of Anesthesiology, Xuzhou Medical University, Xuzhou, Jiangsu, China
3
Department of Life, Earth and Environmental Sciences, West Texas A&M University, Amarillo,
Texas, USA
†
Correspondence: Xue-Jun Song, Southern University of Science and Technology, Shenzhen,
Guangdong, China. Email: [email protected]
Animal Species Used: FVB mice (wild type and UBP43-/-)
Disclosures: Supported by National Nature Science Foundation of China (NSFC#81320108012 and #NSFC81671086) and SUSTech Res Fund (Y01416102). The authors declare that there is no conflict of interest regarding the publication of this article. Highlights Intrathecal IFNβ attenuates mechanical allodynia without behavioral deficits
ISG15 is induced by IFNβ in the spinal cord and mediates analgesic effects
IFNβ mediated analgesia and induction of ISG15 is potentiated in UBP43-/- mice
IFNβ treatment inhibits MAPK signaling by ISG15 activation
1
Abstract Neuropathic pain is difficult to treat and remains a major clinical challenge worldwide. While the mechanisms which underlie the development of neuropathic pain are incompletely understood, interferon signaling by the immune system is known to play a role. Here, we demonstrate a role for IFN in attenuating mechanical allodynia induced by the spared nerve injury in mice. The results show that intrathecal administration of IFNβ (dosages up to 5000U) produces significant, transient, and dose-dependent attenuation of mechanical allodynia without observable effects on motor activity or feeding behavior, as is common with IFN administration. This analgesic effect is mediated by the ubiquitin-like protein ISG15, which is potently induced within the spinal cord following intrathecal delivery of IFN. Both free and conjugated ISG15 are elevated following IFNtreatment, and this effect is increased in UBP43-/- mice lacking a key deconjugating enzyme.
The IFN-mediated
analgesia reduces MAPK signaling activation following nerve injury, and this effect requires induction of ISG15.
These findings highlight a new role for IFN, ISG15 and MAPK signaling in
immunomodulation of neuropathic pain and may lead to new therapeutic possibilities. Perspective: Neuropathic pain is frequently intractable in a clinical setting, and new treatment options are needed. Characterizing the anti-nociceptive potential of IFN and the associated downstream signaling pathways in preclinical models may lead to the development of new therapeutic options for debilitating neuropathies.
2
Keywords IFNβ; ISG15; MAPK Signaling; UBP43 mutation; Neuropathic pain.
Introduction Interferons (IFNs) are a class of cytokines originally detected in immunological cells, but have since been shown to be produced during non-immunological responses of both central and peripheral origins. IFNs regulate antiviral and immunomodulatory responses as well as cell growth in immune cells (lymphocytes and macrophages) and non-immune target cells from epithelial and nervous tissues.10,12,34,61,62 There are two major types of IFNs: type I consists chiefly of IFNα and IFNβ, and also IFNω, IFNδ, and IFNτ, whereas type II consists of a single type, IFNγ.47 While type I IFNs are ubiquitous and may be expressed by any cell type as an innate antiviral response, type II IFNs are synthesized and secreted in a cell-specific manner by macrophages, monocytes, T lymphocytes, and NK cells, as well as non-immune glial and neuronal cell types.10,33,47,62
IFN receptors are also
expressed in each of these cell types,7 although type I IFNs activate different receptors (IFNAR1/2) than IFN does (IFNGR1/2).47 Currently, IFNs are the major treatment modality for hematological malignancies and several non-malignant diseases, including multiple sclerosis and hepatitis B and C.1,9,23,29,50,64 However, studies have provided evidence that IFNs can directly modulate neuronal activity and opioid signaling in the CNS.7,32,40 IFNα administration has been shown to alter neuronal activity in brain regions underlying opioid signaling either in the presence of opioid or when given alone.5 Also, spinal injection of IFNα can reverse CFA-induced hyperalgesia.58 IFNβ shares about 60% homology with IFNα, and both classes of IFN exhibit many additional similarities.7 In humans, IFNβ is the predominant IFN subtype, being produced by a variety of non-lymphoid cells.22 However, whether IFNβ can regulate pain sensitivity is still unknown.
3
IFN treatment induces a variety of cellular changes and alters the expression of over 1000 genes in human HT1080 cells.14 Interferon-stimulated gene 15 (ISG15), which belongs to the family of ubiquitin-like modifiers,8,66 is induced by IFNs and is one of the most abundant gene products expressed following stimulation by type I IFNs.39
Protein modification with ISG15 is termed
ISGylation, and is regulated in a manner analogous to the ubiquitin modification pathway, requiring a series of three enzymatically catalyzed steps (activation, conjugation and ligation). A number of ISGylation-specific regulatory enzymes have been identified, and there is also some degree of convergence with the ubiquitin pathway, such that ligation of both ISG15 and ubiquitin are catalyzed by E2 UBCH8.8,66 ISG15 deconjugation (or de-ISGylation) is analogous to deubiquitination, and is catalyzed by the ubiquitin specific protease (UBP43).8,66
It has been reported that proteasome
inhibitors, such as MG132, increase the level of ISG15 conjugates37, and can prevent or reduce neuropathic pain.41,45
We hypothesized that spinal administration of IFNβ has anti-nociceptive
potential, and characterized the associated downstream signaling pathways in rodents expressing neuropathic pain after nerve injury. Our findings have demonstrated that spinal administration of IFNβ can robustly attenuate mechanical allodynia in nerve-injured mice with no observable behavioral deficits at dosages of up to 5000U. Such analgesic effects of IFNβ treatment may be mediated by ISG15 in the spinal cord, where ISG15 may also mediate IFNβ-induced inhibition of MAPK signaling. This study elucidates a new role for IFNβ, ISG15 and MAPK signaling in regulating neuropathic pain, and advances understanding of neuroimmunological processes that may lead to new therapeutic strategies. Methods Animals, anesthesia, drugs and administration. All animals were used in accordance with the regulations of the ethics committee of the International Association for the Study of Pain, and all
4
protocols were approved by the Institutional Animal Care and Use Committee. Adult, male, wild type FVB mice (The Jackson Laboratory, Bar Harbor, Maine) and UBP43-/- mice (kindly provided by professor Donger Zhang from University of California at Dan Diego), of ages of 6-8 weeks and weighing 20-22 grams were used in this study. The animals were housed and caged in a pathogen-free standard university facility and maintained at 21C under a 12h:12h light/dark cycle with free access to food and water. Animals were randomly divided into different experimental groups as described further in the results. All surgeries were done under anesthesia with pentobarbital (50 mg/kg, i.p.). Choice of anesthetic, route and dose were based on current ILAR guidelines.19 Interferon β (IFNβ) (Sigma-Aldrich, St. Louis, MO) was administered by intrathecal injection (i.t., in volume of 10 µl). The experimenters who performed behavioral testing were blinded to allocation of animal surgery and/or drug administration groups.
Neuropathic pain model. The spared nerve injury (SNI) model was used to produce neuropathic pain in mice.31 SNI was performed as previously described.13 Briefly, under anesthesia, the sciatic nerve and its three terminal branches (tibial, common peroneal and sural nerves) were carefully exposed and separated at the mid-thigh. The tibial and common peroneal nerves were individually ligated with 5.0 silk and then distally cut, as described elsewhere.3,13,46,55,67 The sural branch was left intact and thus comprised the ‘spared’ portion of the sciatic nerve. The muscle and skin incisions were closed separately using silk sutures. Animals in the sham group received surgery identical to that described in SNI but without nerve injury. Behavioral testing. Mechanical allodynia was determined by measuring incidence of foot withdrawal in response to mechanical indentation of the plantar surface of each hindpaw with a sharp, cylindrical probe with a uniform tip diameter of approximately 0.2 mm provided by an Electronic von Frey
5
Anesthesiometer (ALMEMO 2390-5 Anesthesiometer, IITC Life Science Inc., Woodland Hills, CA). Similar to methods used in previous studies,4,13,46 the probe was applied to six designated loci distributed over the plantar surface of the foot with five minute intervals between each measurement. The minimal force (in grams) that induced paw withdrawal was read off the display. The threshold of mechanical withdrawal in each animal was calculated by averaging the six measurements and the force was converted into millinewtons (mN). For open-field testing, mice were individually placed in an open field (80cm×80cm) with the floor divided into 4×4 squares. Mice were placed in one corner of the arena and allowed to freely explore the space for 5 min. The time spent in the inner 2×2 squares and the number of squares crossed was recorded. Food intake was measured manually. Mice were given a pre-weighed amount of food, and 24 h later the food was re-weighed before refeeding. All behavioral testing procedures were carried out between 14:00-18:00 on the specified day.
Small interfering RNA (siRNA) delivery. The siRNA specifically targeting the cDNA sequence of mouse ISG15 (5’- CCAUGACGGUGUCAGAACUUU-3’) (GenBank accession NM_015783), as well as a scrambled control (5’- GGGUGACCUCGCAUAGAAUUU -3’), were purchased from Invitrogen (Waltham, MA). The siRNA was mixed with branched polyethyleneimine (PEI, Sigma-Aldrich, St. Louis, MO) for 10 min at room temperature before intrathecal administration in order to increase cell membrane penetration and reduce degradation. PEI was dissolved in 5% glucose, and 1 μg of siRNA was mixed with 0.18 μl of PEI solution. 1 μg of siRNA was administered (i.t. route) daily for four consecutive days as follows: at one day before surgery, on the day of surgery (immediately prior to the procedure), and one and two days after surgery. A mismatch siRNA (misiRNA) was used as control.
6
Western blot. The L4-L5 segments of the spinal cord were quickly removed from deeply anesthetized mice and stored at -80°C. Sequential precipitation procedures were used on the tissue samples that were lysed in ice-cold (4oC) NP-40 or RIPA lysis buffer containing a cocktail of protease inhibitor, phosphatase inhibitors, and phenylmethylsulfonyl fluoride (Sigma-Aldrich, St. Louis, MO).
The
protein concentrations of the lysates were estimated using the BCA method (Pierce, Rockford, IL) and the total protein content between samples was equalized. The total protein from each sample was separated by SDS-PAGE and transferred to 0.2 µm nitrocellulose or PVDF membrane (both from BioRad Laboratories, Hercules, CA). The following primary antibodies were used: anti-ISG15 (0.5 g/ml; cat. no. 2743), anti-p-ERK1/2 (1:1000; cat no. 9101), anti-ERK1/2 (1:1000; cat no. 9102), anti-p-JNK (1:1000; cat no. 9211), anti-JNK (1:1000; cat no. 3708), anti-p-P38 (1:1000; cat no. 9251), anti-P38 (1:1000; cat no. 9212) (Cell Signaling Tech, Beverly, MA), anti-GAPDH (1:5000~35000; cat no. AMAB91152), anti-IB4 (1:100; cat no. L2895) (Sigma-Aldrich, St. Louis, MO), anti-CGRP (1:200; cat no. ab81887), anti-GFAP (1:200; cat no. ab53554), anti-Iba1 (1:400; cat no. ab5076) (Abcam, Cambridge, UK), and NeuN (1:200; cat no. MAB377, Merk Millipore, Darmstadt, Germany). The membranes were then developed by enhanced chemiluminescence reagents (PerkinElmer, Waltham, MA) using horseradish peroxidase-conjugated secondary antibodies (R&D Systems, Minneapolis, MN). Data were analyzed with a Molecular Imager ChemiDoc XR System (Bio-Rad Laboratories) and the associated software Quantity One-4.6.5 (Bio-Rad Laboratories). For western blot analysis, ISG15 protein was normalized to GAPDH, which served as a loading control. Phosphorylated proteins (MAPK pathway) were normalized to total levels of each protein.
Statistics. SPSS Rel 15 (SPSS Inc., Chicago, IL, USA) was used to conduct all statistical analyses. Alterations of protein expression profiles and the behavioral responses among groups to mechanical
7
stimuli over time were tested with one-way and two-way ANOVA with repeated measures followed by Bonferroni post hoc tests, respectively. For Western blot data, individual t-tests were used to test specific hypotheses regarding differences between each surgical or drug-treated group and its corresponding control group. All data are presented as mean S.E.M. The criterion for statistical significance was set at p < 0.05. Results
Spinal administration of IFNβ inhibits mechanical allodynia in nerve-injured mice SNI produced mechanical allodynia manifested as the significantly decreased mechanical threshold to the von Frey filament stimulation. Spinal administration of IFNβ significantly suppressed SNI-induced mechanical allodynia in a dose-dependent manner, and the inhibition lasted for 2-3 days following a single injection. The lowest dose (500U) used in this experiment produced no analgesic effects. The higher doses (1000U, 5000U, and 10000U) significantly reduced SNI-induced allodynia (Fig. 1A).
Previous reports indicate that administration of IFNα, another class of type I IFN,
diminishes motor activity and food intake in mammals.16,48,49,54 We thus examined whether IFNβ administration could induce unexpected side effects. Our results showed that i.t. delivery of IFNβ at 500U, 1000U and 5000U did not affect open-field motor activity or food intake. However, at the highest dosage (10000U) i.t. IFNβ did change the pattern of the open-field activity for total travel distance (Fig. 1B, P<0.05), but did not significantly affect the number of squares crossed (Fig. 1C), time spent in the inner area (Fig. 1D), or food intake (Fig. 1E). Data are summarized in Fig. 1B-E. Therefore, in subsequent experiments we administered IFNβ at a dosage of 5000U, which produced the maximal analgesic effect without obvious side effects.
8
At all times, both prior to and throughout the period of experimentation, the animals exhibited normal health status as evaluated by general observation. In brief, all mice appeared in good health throughout the study. They gained weight during the test period, were well groomed, and exhibited no self-inflicted wounds. No abnormal gait or posture was observed in the sham-operation control group. However, after SNI, all mice showed development of varying degrees of abnormality in gait and posture. One mouse died during SNI surgery, most likely due to the anesthesia; all other mice were included in this study.
IFNβ treatment induces increase in expression of ISG15 in the spinal cord ISG15 is a ubiquitin-like protein. Similar to ubiquitin, ISG15 post-translationally modifies proteins by covalent conjugation with its targets, a process referred to as ISGylation.8,66 In both sham and SNI groups, expression of free ISG15 as well as the conjugated form was at very low levels. However, following spinal administration of IFNβ (5000U), expression of both free and conjugated ISG15 was significantly increased in sham and SNI animals. Such increases in SNI animals were larger than those in the sham controls. Representative Western blot bands and data summary are shown in Fig. 2A. As it is well known that UBP43 is a major ISG15-specific protease in mammals8,66, we further examined IFNβ’s effects in UBP43 knockout (UBP43-/-) mice. Our results show that expression of both free and conjugated ISG15 in the spinal cord of UBP43-/- mice was significantly elevated compared to that in the wild type spinal cord.
Following IFNβ treatment, expression of both ISG15 forms was
significantly increased in wild type and UBP43-/-mice. Notably, the IFNβ-induced increase of ISG15 conjugates in UBP43-/- mouse spinal cord was about 2.5x higher than that in wild type mice, and about 6x higher compared to levels in the wild type control (saline) group. Representative Western blots and data summary are shown in Fig. 2B. Further, we performed additional experiments in naïve animals
9
testing effects of ISG15-targeting siRNA and its control misRNA on the expression of free- and conjugated-ISG15. The results showed that the IFNβ-induced increases of both ISG15 conjugates and free ISG15 in the spinal cord were suppressed by siRNA treatment (Fig. 2C). These results indicate that i.t. delivery of IFNβ can induce expression of both ISG15 conjugates and free ISG15 in the spinal cord in a wild type background, and that such effects are significantly amplified after nerve injury and UBP43 gene mutation, respectively.
The expression of ISG15 conjugates can be even further
increased in nerve-injured UBP43-/- mice. In addition, by means of immunohistochemistry, we examined the distribution of IFNβ-induced ISG15 expression in the spinal dorsal horn in wild type background.
The results showed that
intrathecal administration of IFNβ (5000U) significantly increased expression of ISG15. The increased expression of ISG15 was predominantly distributed in the superficial layers of the dorsal horn (Fig. 3A) and colocalized mostly with neurons and astrocytes, with only a small amount of immunoreactivity observed in microglial cells (Fig. 3B-F).
IFNβ treatment inhibits nerve injury-induced mechanical allodynia mediated by ISG15 Activity Given that IFNβ treatment can significantly inhibit nerve injury-induced pain and greatly increase expression of free and conjugated ISG15 in the spinal cord and that UBP43 knockout can further increase ISG15 level and result in greater sensitivity of ISG15 to IFNβ treatment, we further examined the possible roles of ISG15 in IFNβ-induced analgesia using pharmacological and molecular knockdown approaches. Our results showed that spinal administration of a single dose of IFNβ at 5000U was sufficient to completely suppress SNI-induced allodynia (100% inhibition) in UBP43-/mice, and, moreover, this potent analgesic effect lasted for 3-4 days before regressing toward the pretreatment baseline by the 4th test day. Meanwhile, the same IFNβ treatment reduced SNI-induced
10
allodynia by approximately 60% in wild type mice, but never produced total inhibition like that observed in the SNI-UBP43-/- mice (Fig. 4A). In contrast, spinal pretreatment of ISG15-targeting siRNA, but not the control misiRNA, significantly prevented IFNβ-induced inhibition of mechanical allodynia in wild type SNI mice (Fig. 4B). These findings indicate that ISG15 activity is necessary for IFNβ treatment-induced analgesia. In addition, we found that a single dose of IFNβ at 5000U increased the mechanical threshold in both wild type and UBP43-/- mice (Fig. 4C). These behavioral results are consistent with the neurochemical findings shown in Fig. 2, and further corroborate the idea that activity of ISG15 is critical in IFNβ-induced analgesia.
IFNβ treatment inhibits MAPK signaling mediated by activating ISG15 Nerve injury can elicit behaviorally expressed allodynia as well as neurochemical alterations including increased activity of the MAPK signaling pathway. Our Western blotting analysis further showed that the phosphorylation of ERK (pERK), JNK (pJNK), and p38 (pP38), but not their protein expression in the spinal cord, was significantly upregulated following SNI treatment in wild type and UBP43-/- mice. Such SNI-induced phosphorylation of ERK (pERK), JNK (pJNK), and p38 (pP38) was significantly reduced in wild type mice and completely suppressed in UBP43-/- mice following spinal administration of IFNβ (5000U) (Fig. 5A). Further, IFNβ treatment-induced inhibition of pERK, pJNK, and pP38 was successfully prevented by pretreatment with ISG15-targeting siRNA (Fig. 5B). A single dose of IFNβ treatment-induced inhibition of pERK, pJNK, and pP38 lasted for 2-3 days (Fig. 5C).
These findings support the idea that IFNβ-induced inhibition of MAPK signaling may be
mediated by ISG15 activation. Discussion
11
The present study investigated the analgesic potential of IFNβ in mice expressing neuropathic pain following spared nerve injury. The results have shown that spinal administration of IFNβ produces transient and dose-dependent attenuation of mechanical allodynia; such analgesic effects of IFNβ treatment may be mediated by ISG15 in the spinal cord; and ISG15 may also mediate IFNβ-induced inhibition of MAPK signaling. This study may lead to the development of new therapeutic options for debilitating neuropathies. IFNs serve as physiological modulators that facilitate convergent signaling between the immune, endocrine and central nervous systems.7 Currently, IFNs are used as immunologic therapy for various viral infections, autoimmune diseases and malignancies.18 While the roles IFNs play in the nervous system remain incompletely understood, there is significant and accumulating evidence that modulation of pain signaling is a major function of IFN signaling pathways. Whereas type II IFN () induces neuropathic pain,59,63 type I IFN has been demonstrated to promote analgesic effects. For instance, recent studies reported that IFNα can reverse CFA-induced hyperalgesia,58 and the antinociceptive effect is mediated by opioid receptor.35,58 Additionally, whereas microglial IFN sensitizes nociceptive afferents in the dorsal horn,63 astrocytic IFN suppresses afferent synaptic transmission, contributing to analgesic effects.36 However, while the pivotal role of IFNα in promoting antinociception within the CNS is clear, it is unclear whether IFNβ has a similar antinociceptive effect. In the present study, we found that spinal administration of IFNβ, another type I IFN, could significantly inhibit nerve injury-induced mechanical allodynia. Encouragingly, the analgesic dose we used did not induce obvious adverse behavioral effects as has been reported for IFN administration in rodents and humans.16,48,49,53 It has been reported that IFNα, but not IFNβ or IFNγ, binds to opioid receptors and shares some structural and pharmacological properties with opiates, including analgesic activity.2,6,25,28,30,32,40 So
12
how can IFNβ suppress neuropathic pain? Mechanistically, our data support a role for proteosomal regulation by the ubiquitin like factor ISG15 as a neuromodulator of pain signaling pathways in the CNS. Indeed, ISG15 is one of the most strongly induced genes following transcriptional activation by type I IFN, and ISG15 protein has significant sequence homology to ubiquitin, possessing two ubiquitin-like domains connected in tandem.8,66 In vivo, ISG15 exists in both free and conjugated forms.
Free ISG15 can function as a cytokine that modulates immune responses,11 whereas
conjugation of ISG15 to its target protein (ISGylation) can modify target functions either directly, such as by affecting subcellular localization, interactions or activity, or by competing for ubiquitin, thereby enhancing target stability.26,36,65 ISGylation can also inhibit activity of the ubiquitin modification pathway by interacting with the ubiquitin-conjugating enzymes (E2) Ubc13 and UbcH8.15,57 Recently, it was reported that the ubiquitin-proteasome system is required for maintenance of chronic neuropathic pain, and intrathecal or subcutaneous administration of proteasome inhibitors such as MG132 prevented or reversed the development of nerve injury-induced pain behavior.45 Moreover, MG132 administration increases the level of ISG15 conjugation in human fibrosarcoma cells in vitro.37 Collectively, these studies suggest that ISGylation may regulate pain processing pathways within the CNS. In the present study, both free and conjugated ISG15 were significantly increased by spinal administration of IFNβ, and this effect was significantly larger in the SNI group compared with sham controls.
Ubiquitin-specific protease 18 (USP18/UBP43) is an ISG15-specific isopeptidase
responsible for removing ISG15 from its conjugated proteins38. The UBP43 knockout (UBP43-/-) mice exhibit higher constitutive and IFN-inducible levels of ISG15 conjugation38, and serves as a good model to study ISG15 functions.51 We found that ISG15 conjugates can be detected in the spinal cord of UBP43-/- mice even in the absence of exogenous IFNβ stimulation, and following IFNβ treatment,
13
the levels of ISG15 (especially ISG15 conjugates) were dramatically increased. Furthermore, the analgesic effects of IFNβ on UBP43-/- mice were even more pronounced compared with wild type mice, demonstrating that ISG15 may be a major mediator of IFNβ-induced antinociception. Another interesting finding in this study was that IFNβ administration alone was sufficient to increase paw withdrawal threshold in naïve mice, further pointing toward a direct analgesic role for IFNβ. To confirm the role of ISG15 in IFNβ-induced analgesia, we used siRNA to induce targeted knockdown of this protein. The results showed that IFNβ-induced anti-allodynia was prevented by intrathecal pretreatment with ISG15-targeting siRNA. Taken together, our data support an idea that spinal IFNβ administration can effectively relieve neuropathic pain, most likely via induced upregulation of ISG15. These findings uncovered a novel role for ISG15 in regulating IFNβ-induced analgesic effects; however, the mechanistic basis for how increased ISG15 could mediate such effects remains unknown. ISG15 is the first reported ubiquitin-like protein,21 and subsequently it was reported that a small ubiquitin-like factor can inhibit cAMP-mediated activation of the p38 MAPK pathway in Th2 lymphocytes.42 Type I IFN-induced ISGylation of the actin binding protein filamin B can promote dissociation of scaffold proteins RAC1, MEKK1 and MKK4, thereby terminating activation of the apoptotic JNK pathway.26 Thus, while the JAK/STAT signaling is the major pathway for ISGylation, there is evidence of convergence with MAPK signaling, which is the subject of investigation in the present study. Moreover, the role of MAPK signaling in inflammatory and neuropathic pain have been well established. Here we demonstrate that spinal administration of IFNβ can significantly inhibit SNI-induced phosphorylation of ERK, JNK and p38, and the extent of inhibition was even more obvious in UBP43-/- mice. However, siRNA-mediated knockdown of ISG15 blocked the effects of IFNβ on MAPK signaling, suggesting ISG15 functions as a regulator of IFNβ-induced MAPK
14
signaling inhibition. Nevertheless, we cannot rule out the possibility that off-target effects of RNAi may have contributed to this outcome or that other mechanisms may play a role in IFNβ-induced analgesia beyond induction of ISG15 expression. For instance, an earlier study reported that treatment of multiple sclerosis patients with IFNβ induced an elevation in β-endorphin levels within isolated peripheral blood mononuclear cells.20
This suggests endogenous opioid signaling may also be
involved in the antinociceptive mechanism of IFNβ. The precise cellular signaling pathways mediating IFNβ’s analgesic effects within the spinal cord merit further investigation. The histological organization of IFN signaling pathways is not fully characterized in the spinal cord, although IFNAR expression is ubiquitous, with widespread distribution observed in most cell types, including immune cells as well as neurons and glia in the spinal cord.24,44 Previous studies have shown that nerve injury can induce expression and activation of ERK, JNK or p38 in the spinal cord in different populations of glial cells, including astrocytes, oligodendrocytes and microglia.27,43 Moreover, our results show that increased expression of ISG15 following nerve injury is predominantly distributed in the superficial layers of the spinal dorsal horn and colocalized in the CGRP- and IB4positive neurons, astrocytes, and a few microglia. An additional interesting question is whether there are sex differences in pain modulation by IFN and MAPK signaling in rodents. As we used all male mice, we were not able to address this in the present study, however, this should be a topic of future investigation given that sexual dimorphism in neuroimmunity and pain signaling has been reported.52
For example, neuropathic pain is more
prevalent in females,17 activation of different immune cell populations occurs in males and females56, and many immune cells express receptors for sex hormones and exhibit differential responses to testosterone, estrogen and progesterone.52,56 Indeed, differences in neuropathic pain perception and p38 MAPK signaling following chronic constriction injury have been demonstrated in mice.60
15
In summary, we have demonstrated that intrathecal administration of IFNβ can effectively suppress mechanical allodynia caused by peripheral nerve injury in mice. The analgesic effect of IFNβ is mediated, at least in part, by induction of intracellular ISG15 expression, which may inhibit MAPK signaling. The present study provides experimental evidence for a novel analgesic role of IFNβ in neuropathic pain, and supports the possible clinical utility of IFNβ for the treatment of neuropathic pain due to injury, infection or malignant diseases. Further investigations are needed to verify if IFNβ can effectively regulate neuropathic pain in humans.
References 1. Abraham AK, Ramanathan M, Weinstock-Guttman B, Mager DE: Mechanisms of interferonbeta effects on bone homeostasis. Biochem Pharmacol 77:1757-62, 2009 2. Blalock JE, Smith EM: Human leukocyte interferon: structural and biological relatedness to adrenocorticotropic hormone and endorphins. Proc Natl Acad Sci USA 77:5972-4, 1980 3. Chen Z, Doyle TM, Luongo L, Largent-Milnes TM, Giancotti LA, Kolar G, Squillace S, Boccella S, Walker JK, Pendleton A, Spiegel S, Neumann WL, Vanderah TW, Salvemini D: Sphingosine-1-phosphate receptor 1 activation in astrocytes contributes to neuropathic pain. Proc Natl Acad Sci USA 116:10557-62, 2019 4. Cichon J, Sun L, Yang G: Spared Nerve Injury Model of Neuropathic Pain in Mice. Bio Protoc 8:e2777, 2018 5. Dafny N, Reyes-Vazquez C: Three different types of alpha-interferons alter naloxone-induced abstinence in morphine-addicted rats. Immunopharmacology 9:13-7, 1985 6. Dafny N, Lee JR, Dougherty PM: Immune response products alter CNS activity: interferon modulates central opioid functions. J Neurosci Res 19:130-9, 1988 7. Dafny N, Yang PB: Interferon and the central nervous system. Eur J Pharmacol 31:1-15, 2005. 8. Dao CT, Zhang DE: ISG15: a ubiquitin-like enigma. Front Biosci 10:2701-22, 2005 9. Dargahi N, Katsara M, Tselios T, Androutsou ME, de Courten M, Matsoukas J, Apostolopoulos V: Multiple Sclerosis: Immunopathology and Treatment Update. Brain Sci 7:e78, 2017
16
10. Darwich L, Coma G, Peña R, Bellido R, Blanco EJ, Este JA, Borras FE, Clotet B, Ruiz L, Rosell A, Andreo F, Parkhouse RM, Bofill M: Secretion of interferon-gamma by human macrophages demonstrated at the single-cell level after costimulation with interleukin (IL)-12 plus IL-18. Immunology 126:386-93, 2009 11. D'Cunha J, Knight E Jr, Haas AL, Truitt RL, Borden EC: Immunoregulatory properties of ISG15, an interferon-induced cytokine. Proc Natl Acad Sci USA 93:211-5, 1996 12. De Simone R, Levi G, Aloisi F: Interferon gamma gene expression in rat central nervous system glial cells. Cytokine 10:418-22, 1998 13. Decosterd I, Woolf CJ: Spared nerve injury: an animal model of persistent peripheral neuropathic pain. Pain 87:149-58, 2000 14. Der SD, Zhou A, Williams BR, Silverman RH: Identification of genes differentially regulated by interferon alpha, beta, or gamma using oligonucleotide arrays. Proc Natl Acad Sci USA 95:15623-8, 1998 15. Desai SD, Haas AL, Wood LM, Tsai YC, Pestka S, Rubin EH, Saleem A, Nur-E-Kamal A, Liu LF: Elevated expression of ISG15 in tumor cells interferes with the ubiquitin/26S proteasome pathway. Cancer Res 66:921-8, 2006 16. Dunn AL, Crnic LS: Repeated injections of interferon-alpha A/D in Balb/c mice: behavioral effects. Brain Behav Immun 7:104-11, 1993 17. Fillingim RB, King CD, Ribeiro-Dasilva MC, Rahim-Williams B, Riley JL 3rd: Sex, gender, and pain: a review of recent clinical and experimental findings. J Pain 10:447-85, 2009 18. Friedman RM, Contente S: Interferons as Therapy for Viral and Neoplastic Diseases: From Panacea to Pariah to Paragon. Pharmaceuticals (Basel) 2:206-16, 2009 19. Gargiulo S, Greco A, Gramanzini M, Esposito S, Affuso A, Brunetti A, Vesce G: Mice anesthesia, analgesia, and care, Part I: anesthetic considerations in preclinical research. ILAR J 53: E55-69, 2012 20. Gironi M, Martinelli V, Brambilla E, Furlan R, Panerai AE, Comi G, Sacerdote P: Betaendorphin concentrations in peripheral blood mononuclear cells of patients with multiple sclerosis: effects of treatment with interferon beta. Arch Neurol 57:1178-81, 2000 21. Haas AL, Ahrens P, Bright PM, Ankel H: Interferon induces a 15-kilodalton protein exhibiting marked homology to ubiquitin. J Biol Chem 262:11315-23, 1987 22. Havell EA, Hayes TG, Vilcek J: Synthesis of two distinct interferons by human fibroblasts. Virology 89:330-4, 1978 23. Heim MH: Interferons and hepatitis C virus. Swiss Med Wkly 142:w13586, 2012
17
24. Heine S, Ebnet J, Maysami S, Stangel M: Effects of interferon beta on oligodendroglial cells. J Neuroimmunol 177:173–80, 2006 25. Hori T, Katafuchi T, Take S, Shimizu N: Neuroimmunomodulatory actions of hypothalamic interferon-alpha. Neuroimmunomodulation 5:172-7, 1998 26. Jeon YJ, Choi JS, Lee JY, Yu KR, Kim SM, Ka SH, Oh KH, Kim KI, Zhang DE, Bang OS, Chung CH: ISG15 modification of filamin B negatively regulates the type I interferon-induced JNK signalling pathway. EMBO Rep 10:374-80, 2009 27. Ji RR, Gereau RW 4th, Malcangio M, Strichartz GR: MAP kinase and pain. Brain Res Rev 60:135–48, 2009 28. Jörnvall H, Persson M, Ekman R: Structural comparisons of leukocyte interferon and proopiomelanocortin correlated with immunological similarities. FEBS Lett 137:153-6, 1982 29. Kalinke U, Prinz M: Endogenous, or therapeutically induced, type I interferon responses differentially modulate Th1/Th17-mediated autoimmunity in the CNS. Immunol Cell Biol 90:505– 9, 2012 30. Kay NE, Morley JE, Allen JI: Interaction between endogenous opioids and IL-2 on PHAstimulated human lymphocytes. Immunology 70:485-91, 1990 31. Kim SH, Chung JM: An experimental model for peripheral neuropathy produced by segmental spinal nerve ligation in the rat. Pain 50:355-63, 1992 32. Kobayashi T, Washiyama K, Ikeda K: Effects of interferon-alpha on cloned opioid receptors expressed in Xenopus oocytes. Life Sci 76:407-15, 2004 33. Kraaij MD, Vereyken EJ, Leenen PJ, van den Bosch TP, Rezaee F, Betjes MG, Baan CC, Rowshani AT: Human monocytes produce interferon-gamma upon stimulation with LPS. Cytokine 67:7-12, 2014 34. Le Page C, Génin P, Baines MG, Hiscott J: Interferon activation and innate immunity. Rev Immunogenet 2:374-86, 2000 35. Lee JK, Park SH, Sim YB, Jung JS, Suh HW: Interaction of supraspinally administered interferon-α with opioid system in the production of antinociception. Arch Pharm Res 33:1059-63, 2010 36. Liu CC, Gao YJ, Luo H, Berta T, Xu ZZ, Ji RR, Tan PH: Interferon alpha inhibits spinal cord synaptic and nociceptive transmission via neuronal-glial interactions. Sci Rep 6:34356, 2016 37. Liu M, Li XL, Hassel BA: Proteasomes modulate conjugation to the ubiquitin-like protein, ISG15. J Biol Chem 278:1594-602, 2003
18
38. Malakhov MP, Malakhova OA, Kim KI, Ritchie KJ, Zhang DE: UBP43 (USP18) specifically removes ISG15 from conjugated proteins. J Biol Chem 277:9976-81, 2002 39. Martensen PM, Justesen J: Small ISGs coming forward. J Interferon Cytokine Res 24:1-19, 2004 40. Menzies RA, Patel R, Hall NR, O'Grady MP, Rier SE: Human recombinant interferon alpha inhibits naloxone binding to rat brain membranes. Life Sci 50:PL227-32, 1992 41. Moss A, Blackburn-Munro G, Garry EM, Blakemore JA, Dickinson T, Rosie R, Mitchell R, Fleetwood-Walker SM: A role of the ubiquitin-proteasome system in neuropathic pain. J Neurosci 22:1363-72, 2002 42. Nakamura M, Tanigawa Y: Ubiquitin-like polypeptide inhibits cAMP-induced p38 MAPK activation in Th2 cells. Immunobiology 208:439-44, 2004 43. Obata K, Noguchi K: MAPK activation in nociceptive neurons and pain hypersensitivity. Life Sci 74:2643-53, 2004 44. Okada K, Kuroda E, Yoshida Y, Yamashita U, Suzumura A, Tsuji S: Effects of interferon-beta on the cytokine production of astrocytes. J Neuroimmunol 159:48–54, 2005 45. Ossipov MH, Bazov I, Gardell LR, Kowal J, Yakovleva T, Usynin I, Ekström TJ, Porreca F, Bakalkin G: Control of chronic pain by the ubiquitin proteasome system in the spinal cord. J Neurosci 27:8226-37, 2007 46. Pertin M, Allchorne AJ, Beggah AT, Woolf CJ, Decosterd I: Delayed sympathetic dependence in the spared nerve injury (SNI) model of neuropathic pain. Mol Pain 3:21, 2007 47. Platanias LC: Mechanisms of type-I- and type-II-interferon-mediated signalling. Nat Rev Immunol 5:375-86, 2005 48. Plata-Salamán CR: Interferons and central regulation of feeding. Am J Physiol 263:R1222-7, 1992 49. Reyes-Vázquez C, Prieto-Gómez B, Dafny N: Alpha-interferon suppresses food intake and neuronal activity of the lateral hypothalamus. Neuropharmacology 33:1545-52, 1994 50. Rijckborst V, Janssen HL: The Role of Interferon in Hepatitis B Therapy. Curr Hepat Rep 9:231–8, 2010 51. Ritchie KJ, Malakhov MP, Hetherington CJ, Zhou L, Little MT, Malakhova OA, Sipe JC, Orkin SH, Zhang DE: Dysregulation of protein modification by ISG15 results in brain cell injury. Genes Dev 16:2207–12, 2002
19
52. Rosen S, Ham B, Mogil JS: Sex differences in neuroimmunity and pain. J Neurosci Res 95:500-8, 2017 53. Saphier D, Welch JE, Chuluyan HE: Alpha-interferon inhibits adrenocortical secretion via mu 1-opioid receptors in the rat. Eur J Pharmacol 236:183-91, 1993 54. Segall MA, Crnic LS: An animal model for the behavioral effects of interferon. Behav Neurosci. 104:612-8, 1990 55. Shields SD, Eckert WA 3rd, Basbaum AI: Spared nerve injury model of neuropathic pain in the mouse: a behavioral and anatomic analysis. J Pain 4:465-70, 2003 56. Sorge RE, Totsch SK: Sex Differences in Pain. J Neurosci Res 95:1271-81, 2017 57. Takeuchi T, Yokosawa H: ISG15 modification of Ubc13 suppresses its ubiquitin-conjugating activity. Biochem Biophys Res Commun 336:9-13, 2005 58. Tan PH, Gao YJ, Berta T, Xu ZZ, Ji RR: Short small-interfering RNAs produce interferon-αmediated analgesia. Br J Anaesth 108:662-9, 2012 59. Tsuda M, Masuda T, Kitano J, Shimoyama H, Tozaki-Saitoh H, Inoue K: IFN-gamma receptor signaling mediates spinal microglia activation driving neuropathic pain. Proc Natl Acad Sci USA 106:8032-7, 2009 60. Vacca V, Marinelli S, Pieroni L, Urbani A, Luvisetto S, Pavone F: Higher pain perception and lack of recovery from neuropathic pain in females: a behavioural, immunohistochemical, and proteomic investigation on sex-related differences in mice. Pain 155:388-402, 2014 61. Valente G, Ozmen L, Novelli F, Geuna M, Palestro G, Forni G, Garotta G: Distribution of interferon-gamma receptor in human tissues. Eur J Immunol 22:2403-12, 1992 62. Vanguri P: Interferon-gamma-inducible genes in primary glial cells of the central nervous system: comparisons of astrocytes with microglia and Lewis with brown Norway rats. J Neuroimmunol 56:35-43, 1995 63. Vikman KS, Hill RH, Backström E, Robertson B, Kristensson K: Interferon-gamma induces characteristics of central sensitization in spinal dorsal horn neurons in vitro. Pain 106:241-51, 2003 64. Wang BX, Rahbar R, Fish EN: Interferon: current status and future prospects in cancer therapy. J Interferon Cytokine Res 31:545-52, 2011 65. Yeh ET, Gong L, Kamitani T: Ubiquitin-like proteins: new wines in new bottles. Gene 248:114, 2000 66. Zhang D, Zhang DE: Interferon-stimulated gene 15 and the protein ISGylation system. J Interferon Cytokine Res 31:119-30, 2011 20
67. Zhang MD, Su J, Adori C, Cinquina V, Malenczyk K, Girach F, Peng C, Ernfors P, Löw P, Borgius L, Kiehn O, Watanabe M, Uhlén M, Mitsios N, Mulder J, Harkany T, Hökfelt T: Ca2+binding protein NECAB2 facilitates inflammatory pain hypersensitivity. J Clin Invest 128:3757-68, 2018
Fig. 1. Effects of intrathecal administration of IFNβ on nerve injury (SNI)-induced mechanical allodynia. (A) Dose-dependent analgesic effects of i.t. IFNβ on SNI-induced mechanical allodynia. SNI surgery was performed on day 0 and the timing of drug administration is indicated by an arrow. Ten mice were included in each group. Two-way analysis of variance with repeated measures was carried out, followed by Bonferroni post hoc analysis to test the differences among groups. **P<0.01 vs Naïve.
The specific differences between mechanical threshold immediately before drug
administration and at each time point following drug administration was tested with Student’s t-test. #P<0.05 and ##P<0.01 vs data point at day 5 shortly before drug administration in the corresponding group. (B-E) Effects of i.t. IFNβ on open-field activity and food intake in naïve mice. The open-field activity was evaluated over three parameters, including travel distance (B), number of squares crossed during the test period (C), and time spent in the inner field (D). Open-field tests were carried out beginning 2 h after IFNβ injection. (E) Food intake measurements, averaged over the course of a week. IFNβ was administered every other day in food intake measurements. Ten mice were included in each group, and one-way analysis of variance with repeated measures was performed, followed by Bonferroni testing. **P<0.01 vs Saline.
Fig. 2. Expression of ISG15 conjugate and free ISG15 in the spinal cord in wild type and UBP43 -/mice with or without nerve injury (SUTSWMNI treatment). (A,B) Effects of SNI treatment (A) and UBP43 gene knockout (B) on IFNβ-induced expression of ISG15 conjugate and free ISG15. (C) 21
Control for misiRNA activity and determination of siRNA efficiency. Tissues were collected 3-4 h after IFNβ treatment, and on postoperative day 5 for SNI group. Four samples were included in each group, and one-way analysis of variance followed by t-tests was performed. **P<0.01 vs Saline in the corresponding group of Sham or SNI (A) and of Wild Type or UBP43-/- (B), or vs. Naïve (C), ##P<0.01 vs IFNβ in Wild Type (B) or misiRNA + IFN (C), and @@P<0.01 vs Saline in wild type.
Fig. 3. Expression and distribution of ISG15 in the spinal dorsal horn following IFNβ treatment. (A) Representive images showing increased expression of ISG15 IFNβ treatment. (B-F) Representative images showing colocalization of ISG15 with some neurons and glial cells. Magnification: 100 (A); 200 (B-F). Bar = 50 m (A), = 100 m (B-F)
Fig. 4. IFNβ treatment inhibits nerve injury-induced mechanical allodynia mediated by ISG15 Activity. (A) SNI-induced mechanical allodynia was significantly reduced by i.t. IFNβ (5000U) in UBP43 -/(ISG15 gene knock out) mice or wild type mice. (B) Repetitive spinal pretreatment of ISG15-targeting siRNA impaired IFNβ-induced analgesia in SNI mice. PEI and misiRNA were used as control of siRNA treatment and each of them was delivered daily for 5 consecutive days as indicated. (C) IFNβ treatment increased threshold of mechanical withdrawal in both naïve wild type and UBP43 -/- mice. Ten mice were included in each group.
Two-way analysis of variance with repeated measures
followed by Bonferroni analysis was used to test differences among the groups. Student’s t-test was used to test specific differences between mechanical threshold on postoperative day 5 immediately before drug administration and at each time point following drug administration. In A, **P<0.01 vs Wild Type-Sham and UBP43-/--Sham. #P<0.05 and ##P<0.01 vs data point at day 5 before drug administration (as indicated by the arrow) in the corresponding group.
In B, **P<0.01 vs
22
Sham+PEI/misiRNA/siRNA; ##P<0.01 vs the corresponding data point at day 3 before drug administration. In C, *P<0.05 and **P<0.01 vs the group of Wild Type+Saline; ##P<0.01 vs the corresponding data points testing on the same day in the group of Wild Type+IFNβ. Fig. 5. Spinal administration of IFNβ inhibits SNI-induced activation of MAPK signaling mediated by activation of ISG15. (A) IFNβ treatment inhibited SNI-induced activation (phosphorylation) of ERK, JNK and p38 in both wild type and UBP43-/- mice. Note that the total protein expression of ERK, JNK and p38 was not changed while their phosphorylation was upregulated. (B) Pretreatment with ISG15targeting siRNA prevented IFNβ treatment from inhibiting activation of ERK, JNK and p38 in both sham-operated and nerve-injured (SNI) mice. (C) A single dose of IFN treatment inhibited SNIinduced activation of ERK, JNK and p38, such inhibition persisted for at least 3 days (IFNwas injected on postoperative day 3). (A-C) Left panels: representative bands, right: data summary. IFNβ 5000U was administered on the third day after SNI or 4-6 h after the last of other treatments. The siRNA and control misiRNA were delivered daily for 5 consecutive days on postoperative days -2, -1, 0, 1 and 2. Tissues were collected 3-4 h in (A) and (B) or 24 h (4d), 48 h (5d), and 72 h (6d) in (C) after the drug administration. Four samples were included in each of the groups. One-way analysis of variance followed by Bonferroni analysis was used to test the differences among groups. **P<0.01 vs Sham in the corresponding group Sham (A and C) or Sham+PEI (B). #P<0.05 and ##P<0.01 vs the corresponding group of SNI+Saline in the corresponding categories of Wild Type and UBP-/- (A) or SNI+Saline in the corresponding days (C).
23
24
25
26
27
28
IFNβ treatment inhibits nerve injury-induced mechanical allodynia and MAPK signaling by activating ISG15 in mouse spinal cord Su Liu , Stephen Karaganis , Ru-Fan Mo , Xiao-Xiao Li , Ruo-Xin Wen , Xue-Jun Song PII: DOI: Reference:
S1526-5900(19)30869-7 https://doi.org/10.1016/j.jpain.2019.11.010 YJPAI 3820
To appear in:
Journal of Pain
Received date: Revised date: Accepted date:
29 May 2019 15 October 2019 11 November 2019
Please cite this article as: Su Liu , Stephen Karaganis , Ru-Fan Mo , Xiao-Xiao Li , Ruo-Xin Wen , Xue-Jun Song , IFNβ treatment inhibits nerve injury-induced mechanical allodynia and MAPK signaling by activating ISG15 in mouse spinal cord, Journal of Pain (2019), doi: https://doi.org/10.1016/j.jpain.2019.11.010
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © Published by Elsevier Inc. on behalf of the American Pain Society
IFNβ treatment inhibits nerve injury-induced mechanical allodynia and MAPK signaling by activating ISG15 in mouse spinal cord
Su Liu1,2, Stephen Karaganis1,3, Ru-Fan Mo1, Xiao-Xiao Li2, Ruo-Xin Wen1, Xue-Jun Song1† 1
SUSTech Center for Pain Medicine and Medical School, Southern University of Science and
Technology, Shenzhen, Guangdong, China 2
Department of Anesthesiology, Xuzhou Medical University, Xuzhou, Jiangsu, China
3
Department of Life, Earth and Environmental Sciences, West Texas A&M University, Amarillo,
Texas, USA
†
Correspondence: Xue-Jun Song, Southern University of Science and Technology, Shenzhen,
Guangdong, China. Email: [email protected]
Animal Species Used: FVB mice (wild type and UBP43-/-)
Disclosures: Supported by National Nature Science Foundation of China (NSFC#81320108012 and #NSFC81671086) and SUSTech Res Fund (Y01416102). The authors declare that there is no conflict of interest regarding the publication of this article. Highlights Intrathecal IFNβ attenuates mechanical allodynia without behavioral deficits
ISG15 is induced by IFNβ in the spinal cord and mediates analgesic effects
IFNβ mediated analgesia and induction of ISG15 is potentiated in UBP43-/- mice
IFNβ treatment inhibits MAPK signaling by ISG15 activation
1
Abstract Neuropathic pain is difficult to treat and remains a major clinical challenge worldwide. While the mechanisms which underlie the development of neuropathic pain are incompletely understood, interferon signaling by the immune system is known to play a role. Here, we demonstrate a role for IFN in attenuating mechanical allodynia induced by the spared nerve injury in mice. The results show that intrathecal administration of IFNβ (dosages up to 5000U) produces significant, transient, and dose-dependent attenuation of mechanical allodynia without observable effects on motor activity or feeding behavior, as is common with IFN administration. This analgesic effect is mediated by the ubiquitin-like protein ISG15, which is potently induced within the spinal cord following intrathecal delivery of IFN. Both free and conjugated ISG15 are elevated following IFNtreatment, and this effect is increased in UBP43-/- mice lacking a key deconjugating enzyme.
The IFN-mediated
analgesia reduces MAPK signaling activation following nerve injury, and this effect requires induction of ISG15.
These findings highlight a new role for IFN, ISG15 and MAPK signaling in
immunomodulation of neuropathic pain and may lead to new therapeutic possibilities. Perspective: Neuropathic pain is frequently intractable in a clinical setting, and new treatment options are needed. Characterizing the anti-nociceptive potential of IFN and the associated downstream signaling pathways in preclinical models may lead to the development of new therapeutic options for debilitating neuropathies.
2
Keywords IFNβ; ISG15; MAPK Signaling; UBP43 mutation; Neuropathic pain.
Introduction Interferons (IFNs) are a class of cytokines originally detected in immunological cells, but have since been shown to be produced during non-immunological responses of both central and peripheral origins. IFNs regulate antiviral and immunomodulatory responses as well as cell growth in immune cells (lymphocytes and macrophages) and non-immune target cells from epithelial and nervous tissues.10,12,34,61,62 There are two major types of IFNs: type I consists chiefly of IFNα and IFNβ, and also IFNω, IFNδ, and IFNτ, whereas type II consists of a single type, IFNγ.47 While type I IFNs are ubiquitous and may be expressed by any cell type as an innate antiviral response, type II IFNs are synthesized and secreted in a cell-specific manner by macrophages, monocytes, T lymphocytes, and NK cells, as well as non-immune glial and neuronal cell types.10,33,47,62
IFN receptors are also
expressed in each of these cell types,7 although type I IFNs activate different receptors (IFNAR1/2) than IFN does (IFNGR1/2).47 Currently, IFNs are the major treatment modality for hematological malignancies and several non-malignant diseases, including multiple sclerosis and hepatitis B and C.1,9,23,29,50,64 However, studies have provided evidence that IFNs can directly modulate neuronal activity and opioid signaling in the CNS.7,32,40 IFNα administration has been shown to alter neuronal activity in brain regions underlying opioid signaling either in the presence of opioid or when given alone.5 Also, spinal injection of IFNα can reverse CFA-induced hyperalgesia.58 IFNβ shares about 60% homology with IFNα, and both classes of IFN exhibit many additional similarities.7 In humans, IFNβ is the predominant IFN subtype, being produced by a variety of non-lymphoid cells.22 However, whether IFNβ can regulate pain sensitivity is still unknown.
3
IFN treatment induces a variety of cellular changes and alters the expression of over 1000 genes in human HT1080 cells.14 Interferon-stimulated gene 15 (ISG15), which belongs to the family of ubiquitin-like modifiers,8,66 is induced by IFNs and is one of the most abundant gene products expressed following stimulation by type I IFNs.39
Protein modification with ISG15 is termed
ISGylation, and is regulated in a manner analogous to the ubiquitin modification pathway, requiring a series of three enzymatically catalyzed steps (activation, conjugation and ligation). A number of ISGylation-specific regulatory enzymes have been identified, and there is also some degree of convergence with the ubiquitin pathway, such that ligation of both ISG15 and ubiquitin are catalyzed by E2 UBCH8.8,66 ISG15 deconjugation (or de-ISGylation) is analogous to deubiquitination, and is catalyzed by the ubiquitin specific protease (UBP43).8,66
It has been reported that proteasome
inhibitors, such as MG132, increase the level of ISG15 conjugates37, and can prevent or reduce neuropathic pain.41,45
We hypothesized that spinal administration of IFNβ has anti-nociceptive
potential, and characterized the associated downstream signaling pathways in rodents expressing neuropathic pain after nerve injury. Our findings have demonstrated that spinal administration of IFNβ can robustly attenuate mechanical allodynia in nerve-injured mice with no observable behavioral deficits at dosages of up to 5000U. Such analgesic effects of IFNβ treatment may be mediated by ISG15 in the spinal cord, where ISG15 may also mediate IFNβ-induced inhibition of MAPK signaling. This study elucidates a new role for IFNβ, ISG15 and MAPK signaling in regulating neuropathic pain, and advances understanding of neuroimmunological processes that may lead to new therapeutic strategies. Methods Animals, anesthesia, drugs and administration. All animals were used in accordance with the regulations of the ethics committee of the International Association for the Study of Pain, and all
4
protocols were approved by the Institutional Animal Care and Use Committee. Adult, male, wild type FVB mice (The Jackson Laboratory, Bar Harbor, Maine) and UBP43-/- mice (kindly provided by professor Donger Zhang from University of California at Dan Diego), of ages of 6-8 weeks and weighing 20-22 grams were used in this study. The animals were housed and caged in a pathogen-free standard university facility and maintained at 21C under a 12h:12h light/dark cycle with free access to food and water. Animals were randomly divided into different experimental groups as described further in the results. All surgeries were done under anesthesia with pentobarbital (50 mg/kg, i.p.). Choice of anesthetic, route and dose were based on current ILAR guidelines.19 Interferon β (IFNβ) (Sigma-Aldrich, St. Louis, MO) was administered by intrathecal injection (i.t., in volume of 10 µl). The experimenters who performed behavioral testing were blinded to allocation of animal surgery and/or drug administration groups.
Neuropathic pain model. The spared nerve injury (SNI) model was used to produce neuropathic pain in mice.31 SNI was performed as previously described.13 Briefly, under anesthesia, the sciatic nerve and its three terminal branches (tibial, common peroneal and sural nerves) were carefully exposed and separated at the mid-thigh. The tibial and common peroneal nerves were individually ligated with 5.0 silk and then distally cut, as described elsewhere.3,13,46,55,67 The sural branch was left intact and thus comprised the ‘spared’ portion of the sciatic nerve. The muscle and skin incisions were closed separately using silk sutures. Animals in the sham group received surgery identical to that described in SNI but without nerve injury. Behavioral testing. Mechanical allodynia was determined by measuring incidence of foot withdrawal in response to mechanical indentation of the plantar surface of each hindpaw with a sharp, cylindrical probe with a uniform tip diameter of approximately 0.2 mm provided by an Electronic von Frey
5
Anesthesiometer (ALMEMO 2390-5 Anesthesiometer, IITC Life Science Inc., Woodland Hills, CA). Similar to methods used in previous studies,4,13,46 the probe was applied to six designated loci distributed over the plantar surface of the foot with five minute intervals between each measurement. The minimal force (in grams) that induced paw withdrawal was read off the display. The threshold of mechanical withdrawal in each animal was calculated by averaging the six measurements and the force was converted into millinewtons (mN). For open-field testing, mice were individually placed in an open field (80cm×80cm) with the floor divided into 4×4 squares. Mice were placed in one corner of the arena and allowed to freely explore the space for 5 min. The time spent in the inner 2×2 squares and the number of squares crossed was recorded. Food intake was measured manually. Mice were given a pre-weighed amount of food, and 24 h later the food was re-weighed before refeeding. All behavioral testing procedures were carried out between 14:00-18:00 on the specified day.
Small interfering RNA (siRNA) delivery. The siRNA specifically targeting the cDNA sequence of mouse ISG15 (5’- CCAUGACGGUGUCAGAACUUU-3’) (GenBank accession NM_015783), as well as a scrambled control (5’- GGGUGACCUCGCAUAGAAUUU -3’), were purchased from Invitrogen (Waltham, MA). The siRNA was mixed with branched polyethyleneimine (PEI, Sigma-Aldrich, St. Louis, MO) for 10 min at room temperature before intrathecal administration in order to increase cell membrane penetration and reduce degradation. PEI was dissolved in 5% glucose, and 1 μg of siRNA was mixed with 0.18 μl of PEI solution. 1 μg of siRNA was administered (i.t. route) daily for four consecutive days as follows: at one day before surgery, on the day of surgery (immediately prior to the procedure), and one and two days after surgery. A mismatch siRNA (misiRNA) was used as control.
6
Western blot. The L4-L5 segments of the spinal cord were quickly removed from deeply anesthetized mice and stored at -80°C. Sequential precipitation procedures were used on the tissue samples that were lysed in ice-cold (4oC) NP-40 or RIPA lysis buffer containing a cocktail of protease inhibitor, phosphatase inhibitors, and phenylmethylsulfonyl fluoride (Sigma-Aldrich, St. Louis, MO).
The
protein concentrations of the lysates were estimated using the BCA method (Pierce, Rockford, IL) and the total protein content between samples was equalized. The total protein from each sample was separated by SDS-PAGE and transferred to 0.2 µm nitrocellulose or PVDF membrane (both from BioRad Laboratories, Hercules, CA). The following primary antibodies were used: anti-ISG15 (0.5 g/ml; cat. no. 2743), anti-p-ERK1/2 (1:1000; cat no. 9101), anti-ERK1/2 (1:1000; cat no. 9102), anti-p-JNK (1:1000; cat no. 9211), anti-JNK (1:1000; cat no. 3708), anti-p-P38 (1:1000; cat no. 9251), anti-P38 (1:1000; cat no. 9212) (Cell Signaling Tech, Beverly, MA), anti-GAPDH (1:5000~35000; cat no. AMAB91152), anti-IB4 (1:100; cat no. L2895) (Sigma-Aldrich, St. Louis, MO), anti-CGRP (1:200; cat no. ab81887), anti-GFAP (1:200; cat no. ab53554), anti-Iba1 (1:400; cat no. ab5076) (Abcam, Cambridge, UK), and NeuN (1:200; cat no. MAB377, Merk Millipore, Darmstadt, Germany). The membranes were then developed by enhanced chemiluminescence reagents (PerkinElmer, Waltham, MA) using horseradish peroxidase-conjugated secondary antibodies (R&D Systems, Minneapolis, MN). Data were analyzed with a Molecular Imager ChemiDoc XR System (Bio-Rad Laboratories) and the associated software Quantity One-4.6.5 (Bio-Rad Laboratories). For western blot analysis, ISG15 protein was normalized to GAPDH, which served as a loading control. Phosphorylated proteins (MAPK pathway) were normalized to total levels of each protein.
Statistics. SPSS Rel 15 (SPSS Inc., Chicago, IL, USA) was used to conduct all statistical analyses. Alterations of protein expression profiles and the behavioral responses among groups to mechanical
7
stimuli over time were tested with one-way and two-way ANOVA with repeated measures followed by Bonferroni post hoc tests, respectively. For Western blot data, individual t-tests were used to test specific hypotheses regarding differences between each surgical or drug-treated group and its corresponding control group. All data are presented as mean S.E.M. The criterion for statistical significance was set at p < 0.05. Results
Spinal administration of IFNβ inhibits mechanical allodynia in nerve-injured mice SNI produced mechanical allodynia manifested as the significantly decreased mechanical threshold to the von Frey filament stimulation. Spinal administration of IFNβ significantly suppressed SNI-induced mechanical allodynia in a dose-dependent manner, and the inhibition lasted for 2-3 days following a single injection. The lowest dose (500U) used in this experiment produced no analgesic effects. The higher doses (1000U, 5000U, and 10000U) significantly reduced SNI-induced allodynia (Fig. 1A).
Previous reports indicate that administration of IFNα, another class of type I IFN,
diminishes motor activity and food intake in mammals.16,48,49,54 We thus examined whether IFNβ administration could induce unexpected side effects. Our results showed that i.t. delivery of IFNβ at 500U, 1000U and 5000U did not affect open-field motor activity or food intake. However, at the highest dosage (10000U) i.t. IFNβ did change the pattern of the open-field activity for total travel distance (Fig. 1B, P<0.05), but did not significantly affect the number of squares crossed (Fig. 1C), time spent in the inner area (Fig. 1D), or food intake (Fig. 1E). Data are summarized in Fig. 1B-E. Therefore, in subsequent experiments we administered IFNβ at a dosage of 5000U, which produced the maximal analgesic effect without obvious side effects.
8
At all times, both prior to and throughout the period of experimentation, the animals exhibited normal health status as evaluated by general observation. In brief, all mice appeared in good health throughout the study. They gained weight during the test period, were well groomed, and exhibited no self-inflicted wounds. No abnormal gait or posture was observed in the sham-operation control group. However, after SNI, all mice showed development of varying degrees of abnormality in gait and posture. One mouse died during SNI surgery, most likely due to the anesthesia; all other mice were included in this study.
IFNβ treatment induces increase in expression of ISG15 in the spinal cord ISG15 is a ubiquitin-like protein. Similar to ubiquitin, ISG15 post-translationally modifies proteins by covalent conjugation with its targets, a process referred to as ISGylation.8,66 In both sham and SNI groups, expression of free ISG15 as well as the conjugated form was at very low levels. However, following spinal administration of IFNβ (5000U), expression of both free and conjugated ISG15 was significantly increased in sham and SNI animals. Such increases in SNI animals were larger than those in the sham controls. Representative Western blot bands and data summary are shown in Fig. 2A. As it is well known that UBP43 is a major ISG15-specific protease in mammals8,66, we further examined IFNβ’s effects in UBP43 knockout (UBP43-/-) mice. Our results show that expression of both free and conjugated ISG15 in the spinal cord of UBP43-/- mice was significantly elevated compared to that in the wild type spinal cord.
Following IFNβ treatment, expression of both ISG15 forms was
significantly increased in wild type and UBP43-/-mice. Notably, the IFNβ-induced increase of ISG15 conjugates in UBP43-/- mouse spinal cord was about 2.5x higher than that in wild type mice, and about 6x higher compared to levels in the wild type control (saline) group. Representative Western blots and data summary are shown in Fig. 2B. Further, we performed additional experiments in naïve animals
9
testing effects of ISG15-targeting siRNA and its control misRNA on the expression of free- and conjugated-ISG15. The results showed that the IFNβ-induced increases of both ISG15 conjugates and free ISG15 in the spinal cord were suppressed by siRNA treatment (Fig. 2C). These results indicate that i.t. delivery of IFNβ can induce expression of both ISG15 conjugates and free ISG15 in the spinal cord in a wild type background, and that such effects are significantly amplified after nerve injury and UBP43 gene mutation, respectively.
The expression of ISG15 conjugates can be even further
increased in nerve-injured UBP43-/- mice. In addition, by means of immunohistochemistry, we examined the distribution of IFNβ-induced ISG15 expression in the spinal dorsal horn in wild type background.
The results showed that
intrathecal administration of IFNβ (5000U) significantly increased expression of ISG15. The increased expression of ISG15 was predominantly distributed in the superficial layers of the dorsal horn (Fig. 3A) and colocalized mostly with neurons and astrocytes, with only a small amount of immunoreactivity observed in microglial cells (Fig. 3B-F).
IFNβ treatment inhibits nerve injury-induced mechanical allodynia mediated by ISG15 Activity Given that IFNβ treatment can significantly inhibit nerve injury-induced pain and greatly increase expression of free and conjugated ISG15 in the spinal cord and that UBP43 knockout can further increase ISG15 level and result in greater sensitivity of ISG15 to IFNβ treatment, we further examined the possible roles of ISG15 in IFNβ-induced analgesia using pharmacological and molecular knockdown approaches. Our results showed that spinal administration of a single dose of IFNβ at 5000U was sufficient to completely suppress SNI-induced allodynia (100% inhibition) in UBP43-/mice, and, moreover, this potent analgesic effect lasted for 3-4 days before regressing toward the pretreatment baseline by the 4th test day. Meanwhile, the same IFNβ treatment reduced SNI-induced
10
allodynia by approximately 60% in wild type mice, but never produced total inhibition like that observed in the SNI-UBP43-/- mice (Fig. 4A). In contrast, spinal pretreatment of ISG15-targeting siRNA, but not the control misiRNA, significantly prevented IFNβ-induced inhibition of mechanical allodynia in wild type SNI mice (Fig. 4B). These findings indicate that ISG15 activity is necessary for IFNβ treatment-induced analgesia. In addition, we found that a single dose of IFNβ at 5000U increased the mechanical threshold in both wild type and UBP43-/- mice (Fig. 4C). These behavioral results are consistent with the neurochemical findings shown in Fig. 2, and further corroborate the idea that activity of ISG15 is critical in IFNβ-induced analgesia.
IFNβ treatment inhibits MAPK signaling mediated by activating ISG15 Nerve injury can elicit behaviorally expressed allodynia as well as neurochemical alterations including increased activity of the MAPK signaling pathway. Our Western blotting analysis further showed that the phosphorylation of ERK (pERK), JNK (pJNK), and p38 (pP38), but not their protein expression in the spinal cord, was significantly upregulated following SNI treatment in wild type and UBP43-/- mice. Such SNI-induced phosphorylation of ERK (pERK), JNK (pJNK), and p38 (pP38) was significantly reduced in wild type mice and completely suppressed in UBP43-/- mice following spinal administration of IFNβ (5000U) (Fig. 5A). Further, IFNβ treatment-induced inhibition of pERK, pJNK, and pP38 was successfully prevented by pretreatment with ISG15-targeting siRNA (Fig. 5B). A single dose of IFNβ treatment-induced inhibition of pERK, pJNK, and pP38 lasted for 2-3 days (Fig. 5C).
These findings support the idea that IFNβ-induced inhibition of MAPK signaling may be
mediated by ISG15 activation. Discussion
11
The present study investigated the analgesic potential of IFNβ in mice expressing neuropathic pain following spared nerve injury. The results have shown that spinal administration of IFNβ produces transient and dose-dependent attenuation of mechanical allodynia; such analgesic effects of IFNβ treatment may be mediated by ISG15 in the spinal cord; and ISG15 may also mediate IFNβ-induced inhibition of MAPK signaling. This study may lead to the development of new therapeutic options for debilitating neuropathies. IFNs serve as physiological modulators that facilitate convergent signaling between the immune, endocrine and central nervous systems.7 Currently, IFNs are used as immunologic therapy for various viral infections, autoimmune diseases and malignancies.18 While the roles IFNs play in the nervous system remain incompletely understood, there is significant and accumulating evidence that modulation of pain signaling is a major function of IFN signaling pathways. Whereas type II IFN () induces neuropathic pain,59,63 type I IFN has been demonstrated to promote analgesic effects. For instance, recent studies reported that IFNα can reverse CFA-induced hyperalgesia,58 and the antinociceptive effect is mediated by opioid receptor.35,58 Additionally, whereas microglial IFN sensitizes nociceptive afferents in the dorsal horn,63 astrocytic IFN suppresses afferent synaptic transmission, contributing to analgesic effects.36 However, while the pivotal role of IFNα in promoting antinociception within the CNS is clear, it is unclear whether IFNβ has a similar antinociceptive effect. In the present study, we found that spinal administration of IFNβ, another type I IFN, could significantly inhibit nerve injury-induced mechanical allodynia. Encouragingly, the analgesic dose we used did not induce obvious adverse behavioral effects as has been reported for IFN administration in rodents and humans.16,48,49,53 It has been reported that IFNα, but not IFNβ or IFNγ, binds to opioid receptors and shares some structural and pharmacological properties with opiates, including analgesic activity.2,6,25,28,30,32,40 So
12
how can IFNβ suppress neuropathic pain? Mechanistically, our data support a role for proteosomal regulation by the ubiquitin like factor ISG15 as a neuromodulator of pain signaling pathways in the CNS. Indeed, ISG15 is one of the most strongly induced genes following transcriptional activation by type I IFN, and ISG15 protein has significant sequence homology to ubiquitin, possessing two ubiquitin-like domains connected in tandem.8,66 In vivo, ISG15 exists in both free and conjugated forms.
Free ISG15 can function as a cytokine that modulates immune responses,11 whereas
conjugation of ISG15 to its target protein (ISGylation) can modify target functions either directly, such as by affecting subcellular localization, interactions or activity, or by competing for ubiquitin, thereby enhancing target stability.26,36,65 ISGylation can also inhibit activity of the ubiquitin modification pathway by interacting with the ubiquitin-conjugating enzymes (E2) Ubc13 and UbcH8.15,57 Recently, it was reported that the ubiquitin-proteasome system is required for maintenance of chronic neuropathic pain, and intrathecal or subcutaneous administration of proteasome inhibitors such as MG132 prevented or reversed the development of nerve injury-induced pain behavior.45 Moreover, MG132 administration increases the level of ISG15 conjugation in human fibrosarcoma cells in vitro.37 Collectively, these studies suggest that ISGylation may regulate pain processing pathways within the CNS. In the present study, both free and conjugated ISG15 were significantly increased by spinal administration of IFNβ, and this effect was significantly larger in the SNI group compared with sham controls.
Ubiquitin-specific protease 18 (USP18/UBP43) is an ISG15-specific isopeptidase
responsible for removing ISG15 from its conjugated proteins38. The UBP43 knockout (UBP43-/-) mice exhibit higher constitutive and IFN-inducible levels of ISG15 conjugation38, and serves as a good model to study ISG15 functions.51 We found that ISG15 conjugates can be detected in the spinal cord of UBP43-/- mice even in the absence of exogenous IFNβ stimulation, and following IFNβ treatment,
13
the levels of ISG15 (especially ISG15 conjugates) were dramatically increased. Furthermore, the analgesic effects of IFNβ on UBP43-/- mice were even more pronounced compared with wild type mice, demonstrating that ISG15 may be a major mediator of IFNβ-induced antinociception. Another interesting finding in this study was that IFNβ administration alone was sufficient to increase paw withdrawal threshold in naïve mice, further pointing toward a direct analgesic role for IFNβ. To confirm the role of ISG15 in IFNβ-induced analgesia, we used siRNA to induce targeted knockdown of this protein. The results showed that IFNβ-induced anti-allodynia was prevented by intrathecal pretreatment with ISG15-targeting siRNA. Taken together, our data support an idea that spinal IFNβ administration can effectively relieve neuropathic pain, most likely via induced upregulation of ISG15. These findings uncovered a novel role for ISG15 in regulating IFNβ-induced analgesic effects; however, the mechanistic basis for how increased ISG15 could mediate such effects remains unknown. ISG15 is the first reported ubiquitin-like protein,21 and subsequently it was reported that a small ubiquitin-like factor can inhibit cAMP-mediated activation of the p38 MAPK pathway in Th2 lymphocytes.42 Type I IFN-induced ISGylation of the actin binding protein filamin B can promote dissociation of scaffold proteins RAC1, MEKK1 and MKK4, thereby terminating activation of the apoptotic JNK pathway.26 Thus, while the JAK/STAT signaling is the major pathway for ISGylation, there is evidence of convergence with MAPK signaling, which is the subject of investigation in the present study. Moreover, the role of MAPK signaling in inflammatory and neuropathic pain have been well established. Here we demonstrate that spinal administration of IFNβ can significantly inhibit SNI-induced phosphorylation of ERK, JNK and p38, and the extent of inhibition was even more obvious in UBP43-/- mice. However, siRNA-mediated knockdown of ISG15 blocked the effects of IFNβ on MAPK signaling, suggesting ISG15 functions as a regulator of IFNβ-induced MAPK
14
signaling inhibition. Nevertheless, we cannot rule out the possibility that off-target effects of RNAi may have contributed to this outcome or that other mechanisms may play a role in IFNβ-induced analgesia beyond induction of ISG15 expression. For instance, an earlier study reported that treatment of multiple sclerosis patients with IFNβ induced an elevation in β-endorphin levels within isolated peripheral blood mononuclear cells.20
This suggests endogenous opioid signaling may also be
involved in the antinociceptive mechanism of IFNβ. The precise cellular signaling pathways mediating IFNβ’s analgesic effects within the spinal cord merit further investigation. The histological organization of IFN signaling pathways is not fully characterized in the spinal cord, although IFNAR expression is ubiquitous, with widespread distribution observed in most cell types, including immune cells as well as neurons and glia in the spinal cord.24,44 Previous studies have shown that nerve injury can induce expression and activation of ERK, JNK or p38 in the spinal cord in different populations of glial cells, including astrocytes, oligodendrocytes and microglia.27,43 Moreover, our results show that increased expression of ISG15 following nerve injury is predominantly distributed in the superficial layers of the spinal dorsal horn and colocalized in the CGRP- and IB4positive neurons, astrocytes, and a few microglia. An additional interesting question is whether there are sex differences in pain modulation by IFN and MAPK signaling in rodents. As we used all male mice, we were not able to address this in the present study, however, this should be a topic of future investigation given that sexual dimorphism in neuroimmunity and pain signaling has been reported.52
For example, neuropathic pain is more
prevalent in females,17 activation of different immune cell populations occurs in males and females56, and many immune cells express receptors for sex hormones and exhibit differential responses to testosterone, estrogen and progesterone.52,56 Indeed, differences in neuropathic pain perception and p38 MAPK signaling following chronic constriction injury have been demonstrated in mice.60
15
In summary, we have demonstrated that intrathecal administration of IFNβ can effectively suppress mechanical allodynia caused by peripheral nerve injury in mice. The analgesic effect of IFNβ is mediated, at least in part, by induction of intracellular ISG15 expression, which may inhibit MAPK signaling. The present study provides experimental evidence for a novel analgesic role of IFNβ in neuropathic pain, and supports the possible clinical utility of IFNβ for the treatment of neuropathic pain due to injury, infection or malignant diseases. Further investigations are needed to verify if IFNβ can effectively regulate neuropathic pain in humans.
References 1. Abraham AK, Ramanathan M, Weinstock-Guttman B, Mager DE: Mechanisms of interferonbeta effects on bone homeostasis. Biochem Pharmacol 77:1757-62, 2009 2. Blalock JE, Smith EM: Human leukocyte interferon: structural and biological relatedness to adrenocorticotropic hormone and endorphins. Proc Natl Acad Sci USA 77:5972-4, 1980 3. Chen Z, Doyle TM, Luongo L, Largent-Milnes TM, Giancotti LA, Kolar G, Squillace S, Boccella S, Walker JK, Pendleton A, Spiegel S, Neumann WL, Vanderah TW, Salvemini D: Sphingosine-1-phosphate receptor 1 activation in astrocytes contributes to neuropathic pain. Proc Natl Acad Sci USA 116:10557-62, 2019 4. Cichon J, Sun L, Yang G: Spared Nerve Injury Model of Neuropathic Pain in Mice. Bio Protoc 8:e2777, 2018 5. Dafny N, Reyes-Vazquez C: Three different types of alpha-interferons alter naloxone-induced abstinence in morphine-addicted rats. Immunopharmacology 9:13-7, 1985 6. Dafny N, Lee JR, Dougherty PM: Immune response products alter CNS activity: interferon modulates central opioid functions. J Neurosci Res 19:130-9, 1988 7. Dafny N, Yang PB: Interferon and the central nervous system. Eur J Pharmacol 31:1-15, 2005. 8. Dao CT, Zhang DE: ISG15: a ubiquitin-like enigma. Front Biosci 10:2701-22, 2005 9. Dargahi N, Katsara M, Tselios T, Androutsou ME, de Courten M, Matsoukas J, Apostolopoulos V: Multiple Sclerosis: Immunopathology and Treatment Update. Brain Sci 7:e78, 2017
16
10. Darwich L, Coma G, Peña R, Bellido R, Blanco EJ, Este JA, Borras FE, Clotet B, Ruiz L, Rosell A, Andreo F, Parkhouse RM, Bofill M: Secretion of interferon-gamma by human macrophages demonstrated at the single-cell level after costimulation with interleukin (IL)-12 plus IL-18. Immunology 126:386-93, 2009 11. D'Cunha J, Knight E Jr, Haas AL, Truitt RL, Borden EC: Immunoregulatory properties of ISG15, an interferon-induced cytokine. Proc Natl Acad Sci USA 93:211-5, 1996 12. De Simone R, Levi G, Aloisi F: Interferon gamma gene expression in rat central nervous system glial cells. Cytokine 10:418-22, 1998 13. Decosterd I, Woolf CJ: Spared nerve injury: an animal model of persistent peripheral neuropathic pain. Pain 87:149-58, 2000 14. Der SD, Zhou A, Williams BR, Silverman RH: Identification of genes differentially regulated by interferon alpha, beta, or gamma using oligonucleotide arrays. Proc Natl Acad Sci USA 95:15623-8, 1998 15. Desai SD, Haas AL, Wood LM, Tsai YC, Pestka S, Rubin EH, Saleem A, Nur-E-Kamal A, Liu LF: Elevated expression of ISG15 in tumor cells interferes with the ubiquitin/26S proteasome pathway. Cancer Res 66:921-8, 2006 16. Dunn AL, Crnic LS: Repeated injections of interferon-alpha A/D in Balb/c mice: behavioral effects. Brain Behav Immun 7:104-11, 1993 17. Fillingim RB, King CD, Ribeiro-Dasilva MC, Rahim-Williams B, Riley JL 3rd: Sex, gender, and pain: a review of recent clinical and experimental findings. J Pain 10:447-85, 2009 18. Friedman RM, Contente S: Interferons as Therapy for Viral and Neoplastic Diseases: From Panacea to Pariah to Paragon. Pharmaceuticals (Basel) 2:206-16, 2009 19. Gargiulo S, Greco A, Gramanzini M, Esposito S, Affuso A, Brunetti A, Vesce G: Mice anesthesia, analgesia, and care, Part I: anesthetic considerations in preclinical research. ILAR J 53: E55-69, 2012 20. Gironi M, Martinelli V, Brambilla E, Furlan R, Panerai AE, Comi G, Sacerdote P: Betaendorphin concentrations in peripheral blood mononuclear cells of patients with multiple sclerosis: effects of treatment with interferon beta. Arch Neurol 57:1178-81, 2000 21. Haas AL, Ahrens P, Bright PM, Ankel H: Interferon induces a 15-kilodalton protein exhibiting marked homology to ubiquitin. J Biol Chem 262:11315-23, 1987 22. Havell EA, Hayes TG, Vilcek J: Synthesis of two distinct interferons by human fibroblasts. Virology 89:330-4, 1978 23. Heim MH: Interferons and hepatitis C virus. Swiss Med Wkly 142:w13586, 2012
17
24. Heine S, Ebnet J, Maysami S, Stangel M: Effects of interferon beta on oligodendroglial cells. J Neuroimmunol 177:173–80, 2006 25. Hori T, Katafuchi T, Take S, Shimizu N: Neuroimmunomodulatory actions of hypothalamic interferon-alpha. Neuroimmunomodulation 5:172-7, 1998 26. Jeon YJ, Choi JS, Lee JY, Yu KR, Kim SM, Ka SH, Oh KH, Kim KI, Zhang DE, Bang OS, Chung CH: ISG15 modification of filamin B negatively regulates the type I interferon-induced JNK signalling pathway. EMBO Rep 10:374-80, 2009 27. Ji RR, Gereau RW 4th, Malcangio M, Strichartz GR: MAP kinase and pain. Brain Res Rev 60:135–48, 2009 28. Jörnvall H, Persson M, Ekman R: Structural comparisons of leukocyte interferon and proopiomelanocortin correlated with immunological similarities. FEBS Lett 137:153-6, 1982 29. Kalinke U, Prinz M: Endogenous, or therapeutically induced, type I interferon responses differentially modulate Th1/Th17-mediated autoimmunity in the CNS. Immunol Cell Biol 90:505– 9, 2012 30. Kay NE, Morley JE, Allen JI: Interaction between endogenous opioids and IL-2 on PHAstimulated human lymphocytes. Immunology 70:485-91, 1990 31. Kim SH, Chung JM: An experimental model for peripheral neuropathy produced by segmental spinal nerve ligation in the rat. Pain 50:355-63, 1992 32. Kobayashi T, Washiyama K, Ikeda K: Effects of interferon-alpha on cloned opioid receptors expressed in Xenopus oocytes. Life Sci 76:407-15, 2004 33. Kraaij MD, Vereyken EJ, Leenen PJ, van den Bosch TP, Rezaee F, Betjes MG, Baan CC, Rowshani AT: Human monocytes produce interferon-gamma upon stimulation with LPS. Cytokine 67:7-12, 2014 34. Le Page C, Génin P, Baines MG, Hiscott J: Interferon activation and innate immunity. Rev Immunogenet 2:374-86, 2000 35. Lee JK, Park SH, Sim YB, Jung JS, Suh HW: Interaction of supraspinally administered interferon-α with opioid system in the production of antinociception. Arch Pharm Res 33:1059-63, 2010 36. Liu CC, Gao YJ, Luo H, Berta T, Xu ZZ, Ji RR, Tan PH: Interferon alpha inhibits spinal cord synaptic and nociceptive transmission via neuronal-glial interactions. Sci Rep 6:34356, 2016 37. Liu M, Li XL, Hassel BA: Proteasomes modulate conjugation to the ubiquitin-like protein, ISG15. J Biol Chem 278:1594-602, 2003
18
38. Malakhov MP, Malakhova OA, Kim KI, Ritchie KJ, Zhang DE: UBP43 (USP18) specifically removes ISG15 from conjugated proteins. J Biol Chem 277:9976-81, 2002 39. Martensen PM, Justesen J: Small ISGs coming forward. J Interferon Cytokine Res 24:1-19, 2004 40. Menzies RA, Patel R, Hall NR, O'Grady MP, Rier SE: Human recombinant interferon alpha inhibits naloxone binding to rat brain membranes. Life Sci 50:PL227-32, 1992 41. Moss A, Blackburn-Munro G, Garry EM, Blakemore JA, Dickinson T, Rosie R, Mitchell R, Fleetwood-Walker SM: A role of the ubiquitin-proteasome system in neuropathic pain. J Neurosci 22:1363-72, 2002 42. Nakamura M, Tanigawa Y: Ubiquitin-like polypeptide inhibits cAMP-induced p38 MAPK activation in Th2 cells. Immunobiology 208:439-44, 2004 43. Obata K, Noguchi K: MAPK activation in nociceptive neurons and pain hypersensitivity. Life Sci 74:2643-53, 2004 44. Okada K, Kuroda E, Yoshida Y, Yamashita U, Suzumura A, Tsuji S: Effects of interferon-beta on the cytokine production of astrocytes. J Neuroimmunol 159:48–54, 2005 45. Ossipov MH, Bazov I, Gardell LR, Kowal J, Yakovleva T, Usynin I, Ekström TJ, Porreca F, Bakalkin G: Control of chronic pain by the ubiquitin proteasome system in the spinal cord. J Neurosci 27:8226-37, 2007 46. Pertin M, Allchorne AJ, Beggah AT, Woolf CJ, Decosterd I: Delayed sympathetic dependence in the spared nerve injury (SNI) model of neuropathic pain. Mol Pain 3:21, 2007 47. Platanias LC: Mechanisms of type-I- and type-II-interferon-mediated signalling. Nat Rev Immunol 5:375-86, 2005 48. Plata-Salamán CR: Interferons and central regulation of feeding. Am J Physiol 263:R1222-7, 1992 49. Reyes-Vázquez C, Prieto-Gómez B, Dafny N: Alpha-interferon suppresses food intake and neuronal activity of the lateral hypothalamus. Neuropharmacology 33:1545-52, 1994 50. Rijckborst V, Janssen HL: The Role of Interferon in Hepatitis B Therapy. Curr Hepat Rep 9:231–8, 2010 51. Ritchie KJ, Malakhov MP, Hetherington CJ, Zhou L, Little MT, Malakhova OA, Sipe JC, Orkin SH, Zhang DE: Dysregulation of protein modification by ISG15 results in brain cell injury. Genes Dev 16:2207–12, 2002
19
52. Rosen S, Ham B, Mogil JS: Sex differences in neuroimmunity and pain. J Neurosci Res 95:500-8, 2017 53. Saphier D, Welch JE, Chuluyan HE: Alpha-interferon inhibits adrenocortical secretion via mu 1-opioid receptors in the rat. Eur J Pharmacol 236:183-91, 1993 54. Segall MA, Crnic LS: An animal model for the behavioral effects of interferon. Behav Neurosci. 104:612-8, 1990 55. Shields SD, Eckert WA 3rd, Basbaum AI: Spared nerve injury model of neuropathic pain in the mouse: a behavioral and anatomic analysis. J Pain 4:465-70, 2003 56. Sorge RE, Totsch SK: Sex Differences in Pain. J Neurosci Res 95:1271-81, 2017 57. Takeuchi T, Yokosawa H: ISG15 modification of Ubc13 suppresses its ubiquitin-conjugating activity. Biochem Biophys Res Commun 336:9-13, 2005 58. Tan PH, Gao YJ, Berta T, Xu ZZ, Ji RR: Short small-interfering RNAs produce interferon-αmediated analgesia. Br J Anaesth 108:662-9, 2012 59. Tsuda M, Masuda T, Kitano J, Shimoyama H, Tozaki-Saitoh H, Inoue K: IFN-gamma receptor signaling mediates spinal microglia activation driving neuropathic pain. Proc Natl Acad Sci USA 106:8032-7, 2009 60. Vacca V, Marinelli S, Pieroni L, Urbani A, Luvisetto S, Pavone F: Higher pain perception and lack of recovery from neuropathic pain in females: a behavioural, immunohistochemical, and proteomic investigation on sex-related differences in mice. Pain 155:388-402, 2014 61. Valente G, Ozmen L, Novelli F, Geuna M, Palestro G, Forni G, Garotta G: Distribution of interferon-gamma receptor in human tissues. Eur J Immunol 22:2403-12, 1992 62. Vanguri P: Interferon-gamma-inducible genes in primary glial cells of the central nervous system: comparisons of astrocytes with microglia and Lewis with brown Norway rats. J Neuroimmunol 56:35-43, 1995 63. Vikman KS, Hill RH, Backström E, Robertson B, Kristensson K: Interferon-gamma induces characteristics of central sensitization in spinal dorsal horn neurons in vitro. Pain 106:241-51, 2003 64. Wang BX, Rahbar R, Fish EN: Interferon: current status and future prospects in cancer therapy. J Interferon Cytokine Res 31:545-52, 2011 65. Yeh ET, Gong L, Kamitani T: Ubiquitin-like proteins: new wines in new bottles. Gene 248:114, 2000 66. Zhang D, Zhang DE: Interferon-stimulated gene 15 and the protein ISGylation system. J Interferon Cytokine Res 31:119-30, 2011 20
67. Zhang MD, Su J, Adori C, Cinquina V, Malenczyk K, Girach F, Peng C, Ernfors P, Löw P, Borgius L, Kiehn O, Watanabe M, Uhlén M, Mitsios N, Mulder J, Harkany T, Hökfelt T: Ca2+binding protein NECAB2 facilitates inflammatory pain hypersensitivity. J Clin Invest 128:3757-68, 2018
Fig. 1. Effects of intrathecal administration of IFNβ on nerve injury (SNI)-induced mechanical allodynia. (A) Dose-dependent analgesic effects of i.t. IFNβ on SNI-induced mechanical allodynia. SNI surgery was performed on day 0 and the timing of drug administration is indicated by an arrow. Ten mice were included in each group. Two-way analysis of variance with repeated measures was carried out, followed by Bonferroni post hoc analysis to test the differences among groups. **P<0.01 vs Naïve.
The specific differences between mechanical threshold immediately before drug
administration and at each time point following drug administration was tested with Student’s t-test. #P<0.05 and ##P<0.01 vs data point at day 5 shortly before drug administration in the corresponding group. (B-E) Effects of i.t. IFNβ on open-field activity and food intake in naïve mice. The open-field activity was evaluated over three parameters, including travel distance (B), number of squares crossed during the test period (C), and time spent in the inner field (D). Open-field tests were carried out beginning 2 h after IFNβ injection. (E) Food intake measurements, averaged over the course of a week. IFNβ was administered every other day in food intake measurements. Ten mice were included in each group, and one-way analysis of variance with repeated measures was performed, followed by Bonferroni testing. **P<0.01 vs Saline.
Fig. 2. Expression of ISG15 conjugate and free ISG15 in the spinal cord in wild type and UBP43 -/mice with or without nerve injury (SUTSWMNI treatment). (A,B) Effects of SNI treatment (A) and UBP43 gene knockout (B) on IFNβ-induced expression of ISG15 conjugate and free ISG15. (C) 21
Control for misiRNA activity and determination of siRNA efficiency. Tissues were collected 3-4 h after IFNβ treatment, and on postoperative day 5 for SNI group. Four samples were included in each group, and one-way analysis of variance followed by t-tests was performed. **P<0.01 vs Saline in the corresponding group of Sham or SNI (A) and of Wild Type or UBP43-/- (B), or vs. Naïve (C), ##P<0.01 vs IFNβ in Wild Type (B) or misiRNA + IFN (C), and @@P<0.01 vs Saline in wild type.
Fig. 3. Expression and distribution of ISG15 in the spinal dorsal horn following IFNβ treatment. (A) Representive images showing increased expression of ISG15 IFNβ treatment. (B-F) Representative images showing colocalization of ISG15 with some neurons and glial cells. Magnification: 100 (A); 200 (B-F). Bar = 50 m (A), = 100 m (B-F)
Fig. 4. IFNβ treatment inhibits nerve injury-induced mechanical allodynia mediated by ISG15 Activity. (A) SNI-induced mechanical allodynia was significantly reduced by i.t. IFNβ (5000U) in UBP43 -/(ISG15 gene knock out) mice or wild type mice. (B) Repetitive spinal pretreatment of ISG15-targeting siRNA impaired IFNβ-induced analgesia in SNI mice. PEI and misiRNA were used as control of siRNA treatment and each of them was delivered daily for 5 consecutive days as indicated. (C) IFNβ treatment increased threshold of mechanical withdrawal in both naïve wild type and UBP43 -/- mice. Ten mice were included in each group.
Two-way analysis of variance with repeated measures
followed by Bonferroni analysis was used to test differences among the groups. Student’s t-test was used to test specific differences between mechanical threshold on postoperative day 5 immediately before drug administration and at each time point following drug administration. In A, **P<0.01 vs Wild Type-Sham and UBP43-/--Sham. #P<0.05 and ##P<0.01 vs data point at day 5 before drug administration (as indicated by the arrow) in the corresponding group.
In B, **P<0.01 vs
22
Sham+PEI/misiRNA/siRNA; ##P<0.01 vs the corresponding data point at day 3 before drug administration. In C, *P<0.05 and **P<0.01 vs the group of Wild Type+Saline; ##P<0.01 vs the corresponding data points testing on the same day in the group of Wild Type+IFNβ. Fig. 5. Spinal administration of IFNβ inhibits SNI-induced activation of MAPK signaling mediated by activation of ISG15. (A) IFNβ treatment inhibited SNI-induced activation (phosphorylation) of ERK, JNK and p38 in both wild type and UBP43-/- mice. Note that the total protein expression of ERK, JNK and p38 was not changed while their phosphorylation was upregulated. (B) Pretreatment with ISG15targeting siRNA prevented IFNβ treatment from inhibiting activation of ERK, JNK and p38 in both sham-operated and nerve-injured (SNI) mice. (C) A single dose of IFN treatment inhibited SNIinduced activation of ERK, JNK and p38, such inhibition persisted for at least 3 days (IFNwas injected on postoperative day 3). (A-C) Left panels: representative bands, right: data summary. IFNβ 5000U was administered on the third day after SNI or 4-6 h after the last of other treatments. The siRNA and control misiRNA were delivered daily for 5 consecutive days on postoperative days -2, -1, 0, 1 and 2. Tissues were collected 3-4 h in (A) and (B) or 24 h (4d), 48 h (5d), and 72 h (6d) in (C) after the drug administration. Four samples were included in each of the groups. One-way analysis of variance followed by Bonferroni analysis was used to test the differences among groups. **P<0.01 vs Sham in the corresponding group Sham (A and C) or Sham+PEI (B). #P<0.05 and ##P<0.01 vs the corresponding group of SNI+Saline in the corresponding categories of Wild Type and UBP-/- (A) or SNI+Saline in the corresponding days (C).
23
24
25
26
27
28