IGF expression patterns and regulation in growth plate chondrocytes

Molecular and Cellular Endocrinology 327 (2010) 65–71

Contents lists available at ScienceDirect

Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce

IGF expression patterns and regulation in growth plate chondrocytes Werner Schlegel a , Daniel Halbauer a,∗ , Adalbert Raimann a , Christian Albrecht b , Daniela Scharmer c , Susanne Sagmeister a , Magda Helmreich c , Gabriele Häusler a , Monika Egerbacher c a

Medical University of Vienna, Department of Paediatrics and Adolescent Medicine, Waehringer Guertel 18-20, 1090 Vienna, Austria Medical University of Vienna, Department of Traumatology, Waehringer Guertel 18-20, 1090 Vienna, Austria c Veterinary University Vienna, Institute of Anatomy and Histology, Veterinaerplatz 1, 1210 Vienna, Austria b

a r t i c l e

i n f o

Article history: Received 20 January 2010 Received in revised form 14 May 2010 Accepted 6 June 2010 Keywords: IGF Chondrocyte GH Porcine growth plate

a b s t r a c t IGF-I and IGF-II are key regulators of growth and metabolism. Still, data about their expression and distribution within the growth plate in different animal models remain contradictory. Inferences drawn from rodent animal models can only be applied to human conditions to a limited extent as the rodent’s growth plate never fuses. In this study, we compared the expression of IGF-I and IGF-II in native growth plates of prepubertal piglets and under different cell culture conditions. We detected IGF-I mRNA expression and abundantly expressed IGF-II within the growth plate. IGF-I expression increased during monolayer cell culture while IGF-II expression dramatically decreased. Our studies revealed that these expression patterns remained unaffected by growth hormone stimulation in vitro. The abundant expression of IGF-II in porcine growth plate tissue, both on the mRNA and on the protein level, suggests that IGF-II also has a role in growth regulation at the early postnatal stage. © 2010 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Longitudinal growth takes place in the growth plates (GP) of long bones. During this process cells from the resting zone of the growth plate, which are positioned at the epiphyseal end of the template, undergo morphogenesis, line up in columns to form the proliferation zone, and differentiate into hypertrophic chondrocytes. The molecular mechanisms controlling bone growth are complex, delicately regulated and only partially explained (Hunziker, 1994; Kronenberg, 2003; van der Eerden et al., 2003). In most mammalian species including humans, rats and pigs, foetal growth is independent of growth hormone (GH). The influence of GH on the postnatal growth plate is described as both direct and indirect, the latter via hepatic IGF-I production (Le Roith et al., 2001; Ohlsson et al., 2000; Robson et al., 2002). Data on the autocrine and paracrine production of IGFs at the mRNA and protein level within the growth plate conflict. While some researchers have detected IGF-I as well as IGF-II, others have found only one or the other (Olney and Mougey, 1999; Shinar et al., 1993; Wang et al., 1995; Olney et al., 2004; Parker et al., 2007). These different data cannot only be explained by the different species and developmental stages investigated in the studies

∗ Corresponding author. Tel.: +43 1 404003291; fax: +43 1 404007683. E-mail addresses: [email protected], [email protected] (D. Halbauer). 0303-7207/$ – see front matter © 2010 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mce.2010.06.005

but also by the inherent problem of in situ techniques, handling mineralized tissues and decalcification procedures. In vitro culture conditions dramatically influence the expression profile of the hormones and their receptors that are involved in the growth and differentiation process (Albrecht et al., 2009). Recent papers stress the importance of epigenetical regulation of growth and the significance of imprinting for correct mammalian ontogenesis (Gicquel et al., 2005; Eggermann et al., 2008; Schonherr et al., 2006). Despite the undisputed role of the GH-IGF-I axis in postnatal mammalian growth, many questions concerning its local effects on the growth plate remain open. Publications which describe quantitative analyses of the expression profile of growth plate chondrocytes upon stimulating agents are scarce. Real-time PCR seems to be an excellent tool for performing quantitative analyses of expression patterns of IGFs within the growth plate and to study the influence of GH on these patterns. We chose the pig as an animal model for this study. The pig is better comparable than rodents to humans in terms of cellular number in the different zones, cell kinetics and the pattern of closure (Smink et al., 2002a; Thurston and Kember, 1985). We investigated the local distribution of IGFs and the influence of culture conditions on their expression patterns in growth plates from pigs aged 4–8 weeks, a developmental stage corresponding to early childhood in humans (Miller and Ullrey, 1987). Immunohistochemical staining was performed to confirm the protein expression within the growth plate. The dependence of IGF expression on time of cultivation was shown in long-term monolayer cultivation

66

W. Schlegel et al. / Molecular and Cellular Endocrinology 327 (2010) 65–71

experiments. We performed in vitro GH stimulation experiments to determine GH-dependent IGF expression of GP chondrocytes using two different cultivation models to exclude culture-dependent bias.

2. Results 2.1. Expression of IGF-I, IGF-II and collagen type X in growth plates We found IGF-I m-RNA expressed throughout all zones, albeit to a very low extent. Liver tissue samples showed at least a tenfold higher expression of IGF-I than the growth plate zones. Strong expression of IGF-II was detected in all zones, decreasing from the resting to the hypertrophic zone. The chondrocytes from the resting zone exhibited a fivefold higher IGF-II expression than the chondrocytes from the hypertrophic zone (p ≤ 0.05). Nevertheless the expression of IGF-II in the resting zone was lower than in liver tissue samples. The opposite was true for collagen type X (Col X): Col X, a classic marker for the hypertrophic zone, was expressed in this part of the growth plate as expected. Nevertheless, we were also able to detect Col X mRNA in the other regions of the GP, but in significantly lower amounts (compared to resting zone p ≤ 0.05, compared to proliferative zone p ≤ 0.05) (Fig. 1C). Immunohistochemistry revealed that IGF-I is present in chondrocytes of the resting zone and early hypertrophic zone. Cells in the proliferative zone were weakly stained, and some were negative. Late hypertrophic chondrocytes did not show positive staining for IGF-I (Fig. 2). IGF-II was found to be equally distributed in all zones of the growth plate with a generally stronger staining intensity than that of IGF-I (Fig. 2).

2.2. Culture-dependent change of expression patterns of IGF-I and IGF-II IGF-I mRNA expression patterns revealed distinct differences between different cultivation systems. We found a significant difference in the amount of expression of IGF-I, IGF-II and Col X, depending on the cultivation method. IGF-I mRNA expression was approximately two orders of magnitude lower in monolayer cells than in explant culture (Fig. 3). IGF-II and Col X differences between the cultivation systems were less pronounced than the differences in the expression of IGF-I. In contrary to the down-regulation of the IGF-I expression in serum-free medium (Fig. 3), GP chondrocytes, which were kept in monolayer culture, in chondrocyte culture medium for up to 5 weeks, showed an upregulation of IGF-I as well as a continuous downregulation of IGF-II (Fig. 5) and Col X (Fig. 6).

2.3. GH stimulation GH at a concentration of 40 ng/ml or 1 ␮g/ml had no statistically significant stimulatory effect on IGF-I expression in monolayer or GP explant culture (Fig. 3). The same was true for Col X expression, which is a marker of differentiation to the hypertrophic phenotype. The expression of growth hormone receptor (GHR) in native porcine growth plates and in monolayer chondrocytes at the end of the stimulation experiments was compared to samples of porcine liver. The GHR is expressed in considerable amounts in the native growth plate and also in chondrocytes which were stimulated with GH (Fig. 4).

Fig. 1. mRNA expression of IGF-I (A), IGF-II (B) and Col X (C) within laser micro dissected growth plate tissue was evaluated. Furthermore IGF-I and IGF-II expression was compared with the expression in liver tissue. IGF-I expression within the resting and hypertrophic zones was about a tenth of the liver expression, even less IGF-I was found in the proliferative zone. The amount of IGF-II mRNA diminished within the growth plate from the resting zone to the hypertrophic zone. Col X mRNA was already present in the cells of the resting zone and the amount rose, with the highest expression in the hypertrophic zone.

W. Schlegel et al. / Molecular and Cellular Endocrinology 327 (2010) 65–71

67

Fig. 2. Immunohistochemical detection (brown staining) of IGF-1 (A–C) and IGF-2 (D–F) in the GP of the proximal tibia of a 4-week-old piglet. IGF-1 was present predominantly in chondrocytes of the resting zone (A) and the early hypertrophic zone (C). Some cells in the proliferating zone were negative for IGF-1 (B). Equally strong staining of IGF-2 was observed in all zones of the GP (D–F). Negative controls by omitting the secondary antibody (G), or the primary antibody (H), and by replacing the primary antibody with rabbit IgG (I) did not show any staining throughout the GP zones. Positive controls for IGF-1 (liver, J; skeletal muscle, K) and IGF-2 (pancreas, L; skeletal muscle M) showed intense staining. Magnification: (A–F) bar = 20 ␮m and (G–M) bar = 50 ␮m.

3. Discussion In this study we compared the expression pattern of cells in different parts of the porcine growth plate and upon cultivation for different time periods in monolayer. Response to GH stimulation of

growth plate explants and monolayer chondrocytes was examined and the resulting expression patterns compared. Previous studies were mostly performed in rodents (Parker et al., 2007; Shinar et al., 1993; Wang et al., 1995; Oberbauer and Peng, 1995). The major difference between growth plates in rats and humans is that unlike

68

W. Schlegel et al. / Molecular and Cellular Endocrinology 327 (2010) 65–71

Fig. 5. Quantitative real-time PCR of native growth plate tissue, frozen in liquid nitrogen directly after dissection, and chondrocytes cultivated in monolayer in chondrocyte culture medium for the indicated periods was performed. Cultivation caused a modest increase of IGF-I and a decline in IGF-II expression.

Fig. 3. Quantitative real-time PCR of explant growth plate culture and monolayer cells (A, IGF-I; B, IGF-II; C, Col X expression), which were kept in tissue culture for 1 week, followed by 1 day serum deprivation and afterwards stimulation with the indicated amounts of GH for 24 h, both steps performed with chondrocyte stimulation medium. GH did not stimulate production of IGF.

Fig. 4. Quantitative real-time PCR of native liver and native growth plate tissue, frozen in liquid nitrogen directly after dissection and of monolayer chondrocytes from the GH stimulation experiments.

in human rat growth plates are not subjected to total ossification. In our studies we used the piglet as a model rather than rodents because pigs are reported to be closer to humans than rodents in terms of cellular number in the different zones, cell kinetics and the pattern of closure (Miller and Ullrey, 1987; Smink et al., 2002a; Thurston and Kember, 1985). Our data support the hypothesis that IGF-I mRNA is present in the growth plate, albeit in a much lower amount than IGF-II. These data correspond to data from rats, cattle and humans reported by Parker et al. (2007), Hutchison et al. (2007) and Olney and Mougey (1999), respectively. The crucial role of IGF-I for growth before birth is not disputed as IGF-I deletion in mice leads to dwarfism (Liu et al., 1993; PowellBraxton et al., 1993; Wang et al., 1999). Conditional IGF-I knock-out in type II␣I collagen-expressing cells of mice leads to impaired gain in body length and underlines the importance of the local IGF-I for longitudinal growth (Govoni et al., 2007; Ohlsson et al., 2009). However, whether IGF-I is responsible for proliferation in the growth plate (Ohlsson et al., 1998) or acts on the hypertrophic chondrocytes with an insulin-like effect and proliferation is caused by IGF-II (Wang et al., 1999) is under debate. We found significant amounts of IGF-II in postnatal prepubertal growth plates, pointing to a role for IGF-II in either local growth plate regulation or in systemic growth as well as in local growth plate regulation. The cells of the resting zone had the highest and the cells of the hypertrophic zone

Fig. 6. Quantitative real-time PCR of Col X mRNA expression in monolayer culture vs. total, native growth plate is shown. The expression of the differentiation marker Col X declined after prolonged cultivation in monolayer.

W. Schlegel et al. / Molecular and Cellular Endocrinology 327 (2010) 65–71

had the lowest amount of IGF-II mRNA. IGF-II mRNA expression distinctly exceeded IGF-I mRNA expression by about two orders of magnitude in native growth plate explants and monolayer culture, supporting the view that, although it is not fully understood, the function of IGF-II within the growth plate is important. IGF-II is a potent modifier of growth in vivo (Hassan and Howell, 2000; Nielsen, 1992). The expression pattern of IGF-II is strictly regulated by genetic imprinting. Loss of imprinting or hypermethylation leads to growth disorders like the Beckwith-Wiedemann syndrome or the Silver–Russell syndrome as well as increased tumour frequency (Cruz-Correa et al., 2009; Hassan and Howell, 2000; Meyer et al., 2009; Eggermann et al., 2008; LeRoith and Roberts, 2003). Our experiments showed that growth plate chondrocytes, which were kept in monolayer culture and therefore in a system with good opportunities to divide, substantially downregulated IGF-II mRNA. It remains to be clarified whether this phenomenon is attributable to a negative feedback loop or the ability of IGF-II imprinting regulation, which might have otherwise become lost in neoplastic cells, displaying high amounts of IGF-II (Christofori et al., 1995) or whether it is simply the result of the dedifferentiation caused by the cell culture conditions. According to current views the major contribution of IGF-II to growth occurs during the intrauterine period while the importance of the GH-IGF-I axis in growth regulation is established after birth. This has been shown by experiments in mice with congenital GH or IGF-I deficiency (van der Eerden et al., 2003; Woods et al., 1996). Growth plate chondrocytes have also been found to display the GHR (Albrecht et al., 2009; Parker et al., 2007; Gevers et al., 2002), which suggests a direct effect of GH, independent of IGF-I (Le Roith et al., 2001; Kaplan and Cohen, 2007). When GH was supplied to the culture medium, we did not measure any stimulating effect on mRNA expression of IGF-I or IGF-II in vitro (Fig. 3), despite the expression of the GHR in the stimulated chondrocytes (Fig. 4). This was true for growth plate monolayer cells as well as for explant culture. Additionally we found significant differences in the expression of IGF-I and IGF-II depending on the cultivation method. These results stress that it is important to not only examine the response to GH in monolayer chondrocyte culture. Our data contradict the hypothesis supported by semiquantitative investigations in rats that GH stimulates local IFG-I synthesis in the growth plate (Isaksson et al., 1987; Jux et al., 1998; Nilsson et al., 1990). In those rat studies hypophysectomy resulted in a reduction of IGF-I, measured by in situ hybridisation and silver-grain counting. Nilsson et al. reported that replacement treatment with exogenous GH (200 ␮g s.c. every 4 h for 24 h) restored the signal partially. Jux et al. measured IGF-I concentration in the supernatant of rat chondrocyte monolayer cell culture by RIA and found a duplication of the signal intensity after incubation with GH for 48 h. This effect was reported to be suppressible by dexamethasone. In a more recent study, application of dexamethasone was found to result in a significant increase in the number of chondrocytes expressing IGF-I (Smink et al., 2002b). Isolated bovine chondrocytes treated with 100 ng/ml GH did not increase IGF-1 mRNA (Hutchison et al., 2007). Furthermore a recent publication mentions that GH does not stimulate IGF-I production in growth plates of uraemic rats. On the contrary, IGF-I production was found to be slightly downregulated (Gil et al., 2008). These data were achieved by cDNA arrays as well as quantitative PCR. Our real-time PCR data from the growth plates of healthy juvenile pigs fit into this alternative view of local interaction between GH and IGF-I, and indicate that paracrine IGF-I production cannot be stimulated by GH. Our data imply that current concepts of GH action on IGF-I production by GP chondrocytes have to be questioned and stress the importance of adequate in vitro conditions in studies on molecular biological mechanisms. Furthermore, the high expression of IGF-II in GP chondrocytes derived from developmental stages cor-

69

responding to early childhood suggests that IGF-II plays a role in GP physiology. The impact on normal and disturbed growth needs further investigation. 4. Materials and methods 4.1. Tissue sampling The methods of obtaining animals and tissue were evaluated and approved by the ethics committee of the Veterinary University Vienna. The piglets used were a cross between Large White and Landrace breeds; they were euthanised in the course of other studies at the Institute of Parasitology at the Veterinary University Vienna. Growth plates were collected from the distal femur and the proximal tibia of ten piglets killed at the age of 4–8 weeks. The limbs were resected and the entire epiphysis was broken off from the femur and tibia at the level of the ossification front of the growth plate. Pieces of growth plate were loosened from the bone by undermining with a scalpel. The growth plate pieces (GPP) were transferred into formalin, and fixed for at least 24 h at room temperature for histology and immunohistochemistry. GPP were transferred in liquid nitrogen and stored at −80 ◦ C before use in Laser Microdissection (LMD). Liver tissues samples and GPP were transferred into RNAlater (Ambion, Austin, USA) for mRNA evaluation and chondrocytes were isolated from GPP for cultivation purposes (see below). 4.2. Isolation of chondrocytes GPP were collected in a medium containing DMEM and 10% FCS. The samples were incubated for 30 min in an antibiotic solution consisting of PBS, 5 ␮g/ml amphotericin B and 200 ␮g/ml gentamycin, before they were cut into small pieces and incubated for at least one day in DMEM containing 236 U/ml collagenase II (Gibco, Carlsbad, USA), 2 ␮g/ml amphotericin B and 100 ␮g/ml gentamycin. The separated cells were filtered through a 40-␮m filter and collected by centrifugation. Isolated chondrocytes were propagated in monolayer culture for up to 5 weeks according to a standard operation procedure, as previously described (Marlovits et al., 2004). Chondrocyte culture medium consisted of DMEM, containing 4 mM l-glutamine, 2 mg/l amphotericin B, 50 mg/l ascorbic acid 2-phosphate Mg salt hydrate, 100 mg/l gentamycin, 5 mg/l insulin and 10% FCS. Cells were cultivated at 37 ◦ C under 5% CO2 . 4.3. Laser microdissection Cryo samples were cut into 6-␮m thick sections at a temperature of −15 ◦ C using the Leica 1800 CM cryostat. All sections to be used for laser microdissection were mounted on special metal frame slides covered with a polyethylenenaphtalate membrane (MMI, Glattbrugg, CH). The LMD slides with the tissue sections were stained with HistoGene Frozen Section Staining Kit from Arcturus (Molecular Devices, MDS Analytical Technologies GmbH, Germany). The staining process was carried out according to the manufacturer’s instructions. The sections were dried immediately for approximately 10 min (for resting zone) or the chondrocyte matrix was removed from all but one section with a needle before the drying process (for proliferative and hypertrophic zones). The Veritas Microdissection System by Arcturus Engineering was used in this study. The energy of the cutting laser was set at 11, the power of the capture laser was 70 mW and the pulse of the capture laser was set at 2500 ␮s. The chondrocytes of each zone were collected on CapSureTM Macro caps (MDS) and the cap placed onto a tube containing extraction buffer from the Qiagen RNeasy Micro Kit. The cells were lysed into buffer at room temperature for 30 min and were centrifuged for 2 min at maximum speed after the incubation period. Chondrocytes from 18 sections were pooled for each zone. The cell extracts were frozen at −80 ◦ C. 4.4. Extraction and purification of total RNA from chondrocytes Homogenisation of total porcine growth plates or explant cultured growth plates was performed by mechanical disruption of the frozen tissue (liquid nitrogen) using a mortar and pestle and dissolving in 1 ml TRI reagent (Sigma–Aldrich, St. Louis, MO, USA). Cells from monolayer culture were harvested by adding 1 ml of the TRI® reagent. RNA was isolated according to the manufacturer’s instructions. The purity and amount of RNA were determined by measurement of the OD260/280 ratio. 4.4.1. cDNA synthesis 0.2–1 ␮g of the total RNA was diluted with nuclease-free water to a volume of 15 ␮l. 4 ␮l of iScriptTM reaction mix and 1 ␮l of iScriptTM reverse transcriptase were added (Bio-Rad Laboratories, Hercules, CA, USA) to the RNA solution. The mix was incubated at 25 ◦ C for 5 min and at 42 ◦ C for 30 min. The cDNA synthesis was stopped by heating the reaction at 85 ◦ C for 5 min. The reaction was diluted by adding 20 ␮l (LCM) or 80 ␮l of nuclease-free water. 4.4.2. Primers and probes for quantitative analyses Primers and probes were designed using the Primer3 program (http://frodo.wi.mit.edu/primer3) to create oligo nucleotides with similar melting temperatures and minimal self-complementarity. The probes were placed

70

W. Schlegel et al. / Molecular and Cellular Endocrinology 327 (2010) 65–71

Table 1 Primer sequences for real-time PCR. Sequence

Product (bp)

GenBank accession no.

IGF-I Left primer Right primer Hyb oligo

GTTCGTGTGCGGAGACAGG GCCCTCCGACTGCTGGA CTTTTATTTCAACAAGCCCACAGGGTACGG

69

DQ784687

IGF-II Left primer Right primer Hyb oligo

AAGTCCGAGAGGGACGTGTC GAAGAACTTGCCCACGGG CTCCGACCGTGCTTCCGGACAAC

78

AF466299

Col X Left primer Right primer Hyb oligo

TTTATACTGAGCAATACCAAACACCT GAATACCTTGCTCTCCTCTTAGTGAT TCCCCTACGCCATAAAGAGTAAAGGT

126

NM 001005153.1

GHR Left primer Right primer Hyb oligo

TACCCTACTGTATCAAGCTGACTAGC GTAGAGTCCAGTTGAGGCCAAT TTCTCCGTTGAGGAAATAGTGCAACC

111

NM 214254.2

at the junction of two exons to avoid amplification of genomic DNA. The gene specificity of the primers and probes and absence of DNA polymorphism were confirmed by BLASTN searches. Primers and probes were synthesised from GenXpress (Wiener Neudorf, Austria). Primer concentrations were tested for each primer at concentrations of 50, 300, and 900 nM, choosing the combination that displayed the lowest Ct value. The similar PCR reaction efficiencies allow the comparison of the expression levels of the different evaluated genes. Primer sequences are shown in Table 1. 4.4.3. Real-time PCR amplification and analysis The mRNA was quantified using real-time PCR. PCR amplification was performed and monitored with a 7500 fast real-time PCR system (Applied Biosystems, Foster City USA). Master mix was based on 2× Sensi Mix (dU) DNA KitTM (Quantance, London, UK). The best results were obtained when using a final Mg2+ concentration of 5.5 mM. The thermal cycling conditions comprised the initial steps at 50 ◦ C for 2 min and at 95 ◦ C for 10 min. The cDNA products were amplified with 40 PCR cycles, consisting of a denaturation step at 95 ◦ C for 15 s and an extension step at 60 ◦ C for 1 min. All probes were normalised to 18S rRNA using the pre-developed Taqman assay (Applied Biosystems, Foster City, USA). All cDNA samples (2.4 ␮l in 20 ␮l) were analysed in triplicate. The final numeric value was calculated as the ratio of the respective gene to 18S RNA and expressed in arbitrary units. 4.4.4. Histology and immunohistochemistry Proximal tibia and distal femur growth plates from 17 piglets were dissected and fixed in 4% buffered formalin and embedded in paraffin. 4-␮m sections were mounted on slides coated with APES and glutaraldehyde and dried at 37 ◦ C overnight. After deparaffinisation, slides were blocked with methanol in hydrogen peroxide (0.6%) and incubated with goat serum. Primary antibodies were rabbit antiIGF-I (IBT Immunological & Biochemical Testsystems, Reutlingen, Germany, dilution 1:50) and goat anti-IGF-II (R&D Systems, Minneapolis, MN, USA, dilution 1:50) incubated overnight at 4 ◦ C. IGF-II detection required pretreatment in 0.001 M EDTA, pH 8.0, at 96 ◦ C for 20 min. As secondary systems, we used anti-rabbit PowerVisionTM HRP (ImmunoVision Technologies, Brisbane, CA, USA), and a biotinylated anti-goat antibody for 30 min followed by ABC standard kit (Vector Lab, Burlingame, CA, USA), with DAB as substrate. Immunohistochemical staining was carried out according to described protocols (Albrecht et al., 2009). As positive controls tissue from pig liver, pancreas and sceletal muscle was stained. Negative control experiments were performed by omitting the primary antibody, omitting the secondary antibody, and by replacing the primary antibody with rabbit IgG (dilution 1:1000). 4.5. Stimulation protocol After cultivation of GP explants (size approximately 1 mm × 1 mm × 4 mm) and monolayer cultures for 1 week in chondrocyte culture medium, 20,000 cells per cm2 growth area or GP explants were transferred into a stimulation medium containing 40 or 1000 ng/ml procine growth hormone and cultivated at 37 ◦ C under 5% CO2 . Cells were harvested after an incubation time of 24 h in stimulation medium. Chondrocyte stimulation medium consisted of DMEM without phenol red, containing 4 mM l-glutamine, 3.151 mg/ml glucose, 220.08 ␮g/ml Na pyruvate, 2 ␮g/ml transferrin, 2 ␮g/l selenous acid, 420 mg/l BSA, 2.1 mg/l linoleic acid, 25 mg/l ascorbic acid, 2 mg/l amphotericin B, 100 mg/l gentamycin, and 5 mg/l insulin. 4.6. Statistical analysis All samples were assayed by real-time PCR in triplicates. The values were log transformed and reported as the mean ± SEM of real-time PCR analyses. The signifi-

cance of the difference in gene expression was calculated in SPSS using the Student’s t test and ANOVA. Values of p ≤ 0.05 were considered significant.

Conflict of interest statement None. Acknowledgments This work was supported by research grants from Novo Nordisk Pharma GmbH and Sandoz GmbH to the Medical University of Vienna. References Albrecht, C., Helmreich, M., Tichy, B., Marlovits, S., Plasenzotti, R., Egerbacher, M., Haeusler, G., 2009. Impact of 3D-culture on the expression of differentiation markers and hormone receptors in growth plate chondrocytes as compared to articular chondrocytes. Int. J. Mol. Med. 23, 347–355. Christofori, G., Naik, P., Hanahan, D., 1995. Deregulation of both imprinted and expressed alleles of the insulin-like growth factor 2 gene during beta-cell tumorigenesis. Nat. Genet. 10, 196–201. Cruz-Correa, M., Zhao, R., Oviedo, M., Bernabe, R.D., Lacourt, M., Cardona, A., LopezEnriquez, R., Wexner, S., Cuffari, C., Hylind, L., Platz, E., Cui, H., Feinberg, A.P., Giardiello, F.M., 2009. Temporal stability and age-related prevalence of loss of imprinting of the insulin-like growth factor-2 gene. Epigenetics 4. Eggermann, T., Eggermann, K., Schonherr, N., 2008. Growth retardation versus overgrowth: Silver–Russell syndrome is genetically opposite to BeckwithWiedemann syndrome. Trends Genet. 24, 195–204. Gevers, E.F., van der Eerden, B.C., Karperien, M., Raap, A.K., Robinson, I.C., Wit, J.M., 2002. Localization and regulation of the growth hormone receptor and growth hormone-binding protein in the rat growth plate. J. Bone Miner. Res. 17, 1408–1419. Gicquel, C., Rossignol, S., Cabrol, S., Houang, M., Steunou, V., Barbu, V., Danton, F., Thibaud, N., Le Merrer, M., Burglen, L., Bertrand, A.M., Netchine, I., Le Bouc, Y., 2005. Epimutation of the telomeric imprinting center region on chromosome 11p15 in Silver–Russell syndrome. Nat. Genet. 37, 1003–1007. Gil, H., Lozano, J.J., Alvarez-Garcia, O., Secades-Vazquez, P., Rodriguez-Suarez, J., Garcia-Lopez, E., Carbajo-Perez, E., Santos, F., 2008. Differential gene expression induced by growth hormone treatment in the uremic rat growth plate. Growth Horm. IGF Res. 18, 353–359. Govoni, K.E., Lee, S.K., Chung, Y.S., Behringer, R.R., Wergedal, J.E., Baylink, D.J., Mohan, S., 2007. Disruption of insulin-like growth factor-I expression in type IIalphaI collagen-expressing cells reduces bone length and width in mice. Physiol. Genomics 30, 354–362. Hassan, A.B., Howell, J.A., 2000. Insulin-like growth factor II supply modifies growth of intestinal adenoma in Apc(Min/+) mice. Cancer Res. 60, 1070–1076. Hunziker, E.B., 1994. Mechanism of longitudinal bone growth and its regulation by growth plate chondrocytes. Microsc. Res. Techn. 28, 505–519. Hutchison, M.R., Bassett, M.H., White, P.C., 2007. Insulin-like growth factor-I and fibroblast growth factor, but not growth hormone, affect growth plate chondrocyte proliferation. Endocrinology 148, 3122–3130. Isaksson, O.G., Lindahl, A., Nilsson, A., Isgaard, J., 1987. Mechanism of the stimulatory effect of growth hormone on longitudinal bone growth. Endocr. Rev. 8, 426–438. Jux, C., Leiber, K., Hugel, U., Blum, W., Ohlsson, C., Klaus, G., Mehls, O., 1998. Dexamethasone impairs growth hormone (GH)-stimulated growth by suppression

W. Schlegel et al. / Molecular and Cellular Endocrinology 327 (2010) 65–71 of local insulin-like growth factor (IGF)-I production and expression of GH- and IGF-I-receptor in cultured rat chondrocytes. Endocrinology 139, 3296–3305. Kaplan, S.A., Cohen, P., 2007. The somatomedin hypothesis 2007: 50 years later. J. Clin. Endocrinol. Metab. 92, 4529–4535. Kronenberg, H.M., 2003. Developmental regulation of the growth plate. Nature 423, 332–336. Le Roith, D., Bondy, C., Yakar, S., Liu, J.L., Butler, A., 2001. The somatomedin hypothesis: 2001. Endocr. Rev. 22, 53–74. LeRoith, D., Roberts Jr., C.T., 2003. The insulin-like growth factor system and cancer. Cancer Lett. 195, 127–137. Liu, J.P., Baker, J., Perkins, A.S., Robertson, E.J., Efstratiadis, A., 1993. Mice carrying null mutations of the genes encoding insulin-like growth factor I (Igf-1) and type 1 IGF receptor (Igf1r). Cell 75, 59–72. Marlovits, S., Hombauer, M., Tamandl, D., Vecsei, V., Schlegel, W., 2004. Quantitative analysis of gene expression in human articular chondrocytes in monolayer culture. Int. J. Mol. Med. 13, 281–287. Meyer, E., Lim, D., Pasha, S., Tee, L.J., Rahman, F., Yates, J.R., Woods, C.G., Reik, W., Maher, E.R., 2009. Germline mutation in NLRP2 (NALP2) in a familial imprinting disorder (Beckwith-Wiedemann syndrome). PLoS Genet. 5, e1000423. Miller, E.R., Ullrey, D.E., 1987. The pig as a model for human nutrition. Annu. Rev. Nutr. 7, 361–382. Nielsen, F.C., 1992. The molecular and cellular biology of insulin-like growth factor II. Prog. Growth Factor Res. 4, 257–290. Nilsson, A., Carlsson, B., Isgaard, J., Isaksson, O.G., Rymo, L., 1990. Regulation by GH of insulin-like growth factor-I mRNA expression in rat epiphyseal growth plate as studied with in-situ hybridization. J. Endocrinol. 125, 67–74. Oberbauer, A.M., Peng, R., 1995. Fractionation of growth plate chondrocytes: differential expression of IGF-I and growth hormone and IGF-I receptor mRNA in purified populations. Connect. Tissue Res. 31, 179–187. Ohlsson, C., Bengtsson, B.A., Isaksson, O.G., Andreassen, T.T., Slootweg, M.C., 1998. Growth hormone and bone. Endocr. Rev. 19, 55–79. Ohlsson, C., Sjogren, K., Jansson, J.O., Isaksson, O.G., 2000. The relative importance of endocrine versus autocrine/paracrine insulin-like growth factor-I in the regulation of body growth. Pediatr. Nephrol. 14, 541–543. Ohlsson, C., Mohan, S., Sjögren, K., Tivesten, A., Isgaard, J., Isaksson, O., Jansson, J.O., Svensson, J., 2009. The role of liver-derived insulin-like growth factor-I. Endocr. Rev. 30, 494–535. Olney, R.C., Mougey, E.B., 1999. Expression of the components of the insulin-like growth factor axis across the growth-plate. Mol. Cell Endocrinol. 156, 63–71.

71

Olney, R.C., Wang, J., Sylvester, J.E., Mougey, E.B., 2004. Growth factor regulation of human growth plate chondrocyte proliferation in vitro. Biochem. Biophys. Res. Commun. 317, 1171–1182. Parker, E.A., Hegde, A., Buckley, M., Barnes, K.M., Baron, J., Nilsson, O., 2007. Spatial and temporal regulation of GH-IGF-related gene expression in growth plate cartilage. J. Endocrinol. 194, 31–40. Powell-Braxton, L., Hollingshead, P., Warburton, C., Dowd, M., Pitts-Meek, S., Dalton, D., Gillett, N., Stewart, T.A., 1993. IGF-I is required for normal embryonic growth in mice. Genes Dev. 7, 2609–2617. Robson, H., Siebler, T., Shalet, S.M., Williams, G.R., 2002. Interactions between GH, IGF-I, glucocorticoids, and thyroid hormones during skeletal growth. Pediatr. Res. 52, 137–147. Schonherr, N., Meyer, E., Eggermann, K., Ranke, M.B., Wollmann, H.A., Eggermann, T., 2006. (Epi)mutations in 11p15 significantly contribute to Silver–Russell syndrome: but are they generally involved in growth retardation? Eur. J. Med. Genet. 49, 414–418. Shinar, D.M., Endo, N., Halperin, D., Rodan, G.A., Weinreb, M., 1993. Differential expression of insulin-like growth factor-I (IGF-I) and IGF-II messenger ribonucleic acid in growing rat bone. Endocrinology 132, 1158–1167. Smink, J.J., Koedam, J.A., Koster, J.G., van Buul-Offers, S.C., 2002a. Dexamethasoneinduced growth inhibition of porcine growth plate chondrocytes is accompanied by changes in levels of IGF axis components. J. Endocrinol. 174, 343–352. Smink, J.J., Koster, J.G., Gresnigt, M.G., Rooman, R., Koedam, J.A., Van Buul-Offers, S.C., 2002b. IGF and IGF-binding protein expression in the growth plate of normal, dexamethasone-treated and human IGF-II transgenic mice. J. Endocrinol. 175, 143–153. Thurston, M.N., Kember, N.F., 1985. In vitro thymidine labelling in human and porcine growth plates. Cell Tissue Kinet. 18, 575–582. van der Eerden, B.C., Karperien, M., Wit, J.M., 2003. Systemic and local regulation of the growth plate. Endocr. Rev. 24, 782–801. Wang, E., Wang, J., Chin, E., Zhou, J., Bondy, C.A., 1995. Cellular patterns of insulin-like growth factor system gene expression in murine chondrogenesis and osteogenesis. Endocrinology 136, 2741–2751. Wang, J., Zhou, J., Bondy, C.A., 1999. Igf1 promotes longitudinal bone growth by insulin-like actions augmenting chondrocyte hypertrophy. Faseb J. 13, 1985–1990. Woods, K.A., Camacho-Hubner, C., Savage, M.O., Clark, A.J., 1996. Intrauterine growth retardation and postnatal growth failure associated with deletion of the insulinlike growth factor I gene. N. Engl. J. Med. 335, 1363–1367.