- Email: [email protected]
IGFBP-3 sensitizes antiestrogen-resistant breast cancer cells through interaction with GRP78
Cancer Letters 325 (2012) 200–206
Contents lists available at SciVerse ScienceDirect
Cancer Letters journal homepage: www.elsevier.com/locate/canlet
IGFBP-3 sensitizes antiestrogen-resistant breast cancer cells through interaction with GRP78 Chao Li 1, Aki Harada 1, Youngman Oh ⇑ Department of Pathology, Medical College of Virginia Campus, Virginia Commonwealth University, 1101 East Marshall Street, Richmond, VA 23298, USA
a r t i c l e
i n f o
Article history: Received 4 May 2012 Accepted 2 July 2012
Keywords: GRP78 IGFBP-3 Caspase-7 Apoptosis Breast cancer Drug-resistance
a b s t r a c t IGFBP-3 is known to possess intrinsic biological activities such as anti-tumor property in addition to its IGF/IGF-R axis-dependent actions in a variety of human cancers including breast cancer. To investigate the molecular mechanisms underlying the intrinsic biological actions of IGFBP-3 on breast cancer cells, we performed yeast two-hybrid screening and found GRP78, known to cause drug-resistance, as a binding partner of IGFBP-3. Overexpression of IGFBP-3 in antiestrogen-resistant LCC9 cells showed that IGFBP-3 interacted with GRP78, resulting in disruption of the GRP78-caspase-7 complex, thereby activating caspase-7, and further inducing apoptosis. Combination of overexpression of IGFBP-3 and application of siRNAs against GRP78 led to decrease in cell viability upon ICI 182,780 treatment. These data suggest that IGFBP-3 could sensitize antiestrogen-resistant breast cancer cells to ICI 182,780 by preventing the anti-apoptotic function of GRP78. Ó 2012 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Breast cancer is the second leading cause of death in women in the US after lung cancer. According to American Cancer Society report, approximately 39,520 deaths from breast cancer were estimated in 2011 [1]. Hormone therapy is one of the adjuvant therapies for women whose breast cancers test positive for hormone receptors. Estrogen is known to promote the growth of many breast cancers through its binding to estrogen receptor and/or progesterone receptor. Antiestrogen drugs such as tamoxifen and toremifene work by blocking estrogen receptor on breast cancer cells while aromatase inhibitors stop estrogen production in post-menopausal women [2–5]. Fulvestrant (ICI 182,780) is an antiestrogen which exerts its effect not only by blocking estrogen receptor but also decreasing its number [6–8]. It is effective even when breast cancer cells develop tamoxifen-resistance. Despite
Abbreviations: IGF, insulin-like growth factor; IGFBP, IGF binding protein; Ad, adenovirus; EV, empty vector; MOI, multiplicity of infection; ER, endoplasmic reticulum. ⇑ Corresponding author. Address: Department of Pathology, Medical College of Virginia, Virginia Commonwealth University, 1101 East Marshall Street, P.O. Box 980662, Richmond, VA 23298-0662, USA. Tel.: +1 804 827 1324; fax: +1 804 828 9749. E-mail address: [email protected] (Y. Oh). 1 These authors contributed equally to this work. 0304-3835/$ - see front matter Ó 2012 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.canlet.2012.07.004
these improvements in treatment, acquired drug-resistance is still a major obstacle for the treatment of breast cancer. Insulin-like growth factor binding protein-3 (IGFBP-3), a major binding protein of IGFs in circulation, is known to modulate the actions of IGFs in the circulation as well as the immediate extracellular environment [9–12]. Although its anti-proliferative functions are mainly through the attenuation of the IGF/IGF-IR interaction, more recently IGFBP-3 is widely considered to demonstrate various biological effects independent of the IGF/IGF-IR axis. Previous studies from our laboratory as well as other groups indicated that interaction of IGFBP-3 with a variety of signaling molecules or cell surface proteins is critical for its apoptotic functions in a variety of cancer cells [12–21]. In addition, the proapoptotic effect of IGFBP-3 was associated with the activation of specific caspases that are mediated through death receptor-modulated apoptotic events in cancer cells [12,14]. Furthermore we have shown that IGFBP-3 sensitizes prostate cancer cells to doxorubicin through activation of caspase-8 and caspase-3/7 [22]. To deepen our understanding of the IGF/IGF-IR-independent action of IGFBP-3 in human disease, we performed the yeast two-hybrid screening to identify IGFBP-3-interacting partner proteins using an Hs578T breast cancer cell cDNA library. We discovered the 78-kDa glucose regulated protein (GRP78) as a novel binding partner of IGFBP-3. Interestingly GRP78 has been shown to be involved in the development of drug-resistance in breast cancer. Our study shows that IGFBP-3 binds to GRP78, thereby releasing caspase-7 from the GRP78-caspase-7 complex resulting in apoptosis in drug-resistant breast cancer cells.
C. Li et al. / Cancer Letters 325 (2012) 200–206 2. Materials and methods 2.1. Yeast two-hybrid screening
201
(Enzo Life Sciences, Farmingdale, NY) in assay buffer (50 mM HEPES pH 7.4, 100 mM NaCl, 0.1% CHAPS, 10% glycerol, 1 mM EDTA, and 10 mM dithiothreitol). The reaction mixture was incubated at 37 °C for 6 h, and fluorescence was measured in a fluorescence plate reader (BMG Labtech, Cary, NC).
Yeast two-hybrid screening was performed as described previously [14]. Briefly, an Hs578T cDNA library was generated and screened against IGFBP-3 encoding amino acids 88–148 as bait.
2.8. Statistical analysis
2.2. Adenovirus preparation
The experiments were done three times. We carried out statistical analysis by analysis of variance with Student’s t test. The p < 0.05 or less was considered significant.
Adenovirus harboring His-tagged GRP78 was provided by Dr. A.S. Lee (University of Southern California, CA) [23]. Generation of Ad:EV (empty vector) and Ad:IGFBP-3 (Flag-tagged) has been described previously [14]. Amplification and purification by CsCl gradient centrifugation of clonal recombinant adenoviruses were performed at Virginia Commonwealth University Virus Core Facility.
3. Results 3.1. GRP78 plays a major role in ICI 182,780-resistance in breast cancer cells
2.3. Cell culture, adenovirus infection, and siRNA transfection MCF-7 (tamoxifen-sensitive) was purchased from ATCC (Manassas, VA). MCF7derived LCC9 (tamoxifen- and ICI 182,780- resistant) was provided by Dr. R. Clarke (Georgetown University Medical School, Washington, DC) [24]. Cells were cultured in phenol red-free RPMI (Mediatech, Manassas, VA) in the presence of 1% L-glutamine and 5% charcoal/dextran stripped fetal bovine serum (CCS) at 37 °C and 5% CO2. Cells were transfected with siRNA using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol in the presence of 5% CCS. Six hours or 24 h after transfection, the media were changed to RPMI + 1% CCS. Adenovirus infection was performed in the presence of 5% or 1% CCS. When the infection was performed with 5% CCS, the media were changed to RPMI + 1%CCS on the following day. Control siRNA and GRP78 siRNA were purchased from Thermo Scientific (Lafayette, CO) and Ambion (Austin, TX), respectively. 2.4. Western blot analysis and immunoprecipitation Cells were harvested in HBSS (Mediatech) supplemented with 0.5% Triton X100, 0.35 g/L of sodium bicarbonate, 5 mM EDTA pH 8.0, and Halt Protease Inhibitor Cocktail (Thermo Scientific). Equal amount of protein in lysates were separated by SDS–PAGE. For immunoprecipitation, 5 lg of either anti-His, anti-Flag, or anti-caspase-7 antibodies were incubated with protein G Sepharose in lysis buffer for 2 h at room temperature prior to the incubation with the cell lysates. Cell lysates were added to the antibody conjugate, and incubated overnight at 4 °C. The resulting immune complexes were subjected to western blot analysis. Anti-a-tubulin and antiFlag (M2) antibodies, and protein G Sepharose were purchased from Sigma–Aldrich (St.Louis, MO). Anti-GRP78 and horseradish peroxidase-conjugated donkey-antigoat secondary antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-IGFBP-3 antibody was generated and validated in our laboratory (Strategic BioSolutions, Newark, DE) [22]. Anti-caspase-7 antibody was from BD Biosciences (San Jose, CA), and horseradish peroxidase–conjugated anti-rabbit and anti-mouse secondary antibodies were purchased from Cell Signaling (Danvers, MA).
MCF-7 (tamoxifen-sensitive) and MCF7-derived LCC9 (tamoxifen- and ICI 182,780-resistant) cells were used in order to explore the potential signaling pathways contributing to the development of drug-resistance in breast cancer cells. Cell viability assay showed dose-dependent growth inhibitory effect of ICI 182,780 on MCF-7 cells up to 500 nM while little effect was observed in LCC9 cells up to 1000 nM of ICI 182,780, confirming drug-resistant property of LCC9 cells (Fig. 1A). RT-PCR and western blot analysis demonstrated that GRP78 expression is much higher in LCC9 cells compared with that in MCF-7 cells (Fig. 1B). To elucidate the potential involvement of GRP78 in ICI 182,780-resistance in LCC9 cells, GRP78 was overexpressed in MCF-7 cells and cell viability assay was performed. Sub-optimal concentrations of ICI 182,780 (10–250 nM) which partially affected cell viability of MCF-7 were selected for the subsequent experiments. Uninfected and Ad:EV infected MCF-7 cells were sensitive to as little as 10 nM of ICI 182,780 (Fig. 1C). On the contrary, 250 nM of ICI 182,780 had little effect on the cell viability of GRP78-overexpressing MCF-7. GRP78 overexpression in LCC9 cells had no effect on their viability as LCC9 was already antiestrogen-resistant (Fig. 1D). However, when endogenous GRP78 was suppressed in LCC9 cells using siRNAs specific to GRP78, cells became drug-sensitive with decrease in cell viability by 40% even at 10 nM of ICI 182,780 (Fig. 1E). Taken together, our data suggest that overexpression of GRP78 may attribute, in part if not all, to antiestrogen-resistance in breast cancer cells.
2.5. RNA extraction and semi-quantitative RT-PCR Total RNA was extracted from the cells using Trizol (Invitrogen). One lg of purified total RNA was used for RT-PCR analysis using the ThermoScript RT-PCR System (Invitrogen). Semi-quantitative RT-PCR was performed as described previously described [22]. The sequences of the forward and reverse primers were as follows: GRP78 fwd, 50 CTGGGTACATTTGATCTGACTGG -30 ; rev, 50 GCATCCTGGTGGCTTTCCAGCCATTC -30 , b2-microglobulin (b2 M) fwd, 50 GTGCTCGCGCTACTCTCTCT-30 ; rev, 50 -CGGCAGGCATACTCATCTTT-30 . PCR amplification was performed 35 cycles (denaturation: 94 °C, 30 s; annealing: 55 °C, 30 s; extension: 72 °C, 30 s). Amplified products were analyzed on a 2.0% agarose gel and DNA was visualized by ethidium bromide staining. 2.6. Cell viability assay WST-1 and trypan blue were purchased from Roche Applied Science (Indianapolis, IN) and Thermo Scientific, respectively. Cell viability was determined by WST assay or by trypan blue exclusion followed by cell counting at day 6. For the WST assay, cells were plated in triplicate in 96-well plate. The cells were infected with Ad:EV, Ad:GRP78, or Ad:IGFBP-3 (MOI 250), and on the following day, treated with ICI 182,780 (Sigma–Aldrich, St.Louis, MO). This cycle was repeated once more, and the cells were cultured with 5% CO2 at 37 °C for 2 days and subjected to WST assay according to the manufacturer’s protocol.
3.2. GRP78 is a novel binding partner of IGFBP-3 in LCC9 cells In an effort of finding associating proteins of IGFBP-3, an yeast two-hybrid screening was performed, and three proteins were identified as its binding partners; two of which were IGFBP-3R [14] and GRP78. To confirm the interaction between GRP78 and IGFBP-3 in breast cancer cells, reciprocal immunoprecipitation (IP) studies were performed followed by western blot analysis using the lysates from LCC9 cells expressing His-tagged GRP78, Flag-tagged IGFBP-3, or both proteins. IP with an anti-His antibody showed co-immunoprecipitation of IGFBP-3 with His-tagged GRP78 in IGFBP-3 and GRP78 co-expressing cells, but not in IGFBP-3 expressing cells (Fig. 2A). IP with antibodies to Flag further showed GRP78 was pulled down only in the presence of IGFBP-3 (Fig. 2B). These data clearly demonstrate physical IGFBP-3 interaction with GRP78 in breast cancer cells. 3.3. IGFBP-3 dissociates interaction between GRP78 and caspase-7 via its binding to GRP78
2.7. Caspase-7 activity assay Caspase-7 activity assay was performed as described previously [14]. Cell lysates were prepared using CHAPS lysis buffer (50 mM HEPES, pH 7.4, 0.1% CHAPS, 0.1% Triton X-100, 0.1 mM EDTA, and 1 mM dithiothreitol) and 12,000 g centrifugation at 4 °C. DEVDase activity was measured using Ac-DEVD amidomethylcoumarin
Previous report indicated that GRP78 can bind to caspase-7 thereby contributing to drug-resistance in cancer cells [25]. To investigate how interaction between IGFBP-3 and GRP78 affect breast cancer cell viability, IP with anti-His antibody and anti-cas-
202
C. Li et al. / Cancer Letters 325 (2012) 200–206
Fig. 1. GRP78 plays a major role in ICI 182,780-resistance in breast cancer cells. (A) WST-1 assay was performed to demonstrate different responses to antiestrogen drug ICI 182,780 in drug-sensitive MCF7 and -resistant LCC9 cells. Cells were treated with the indicated concentration of ICI 182,780 for 7 days in the presence of 1% serum. ICI 182,780 was added with fresh media every other day. The results were normalized to the cell viability with no ICI 182,780 as 100% for each cell lines. (B) Basal mRNA and protein expression of GRP78 in MCF7 and LCC9 were detected by RT-PCR and western blot analysis, and the results were normalized to b-2 microglobulin (b2 M) and atubulin, respectively. MCF7 cells (C) and LCC9 cells (D) were infected with Ad:EV or Ad:GRP78 at MOI 250, or left uninfected. Cells were then treated with the indicated concentration of ICI 182,780, and the cell viability was measured by WST-1 assay. The cell viability with no ICI 182,780 was considered 100% for each adenovirus treatment. (E) LCC9 cells were transfected with control siRNA or GRP78 siRNA, and treated with the indicated concentration of ICI 182,780. Western blot analysis was performed to confirm the suppression of GRP78. Alpha-tubulin was used as a loading control. WST-1 assay was performed to measure cell viability. The cell viability with no siRNA transfection without ICI 182,780 was considered as 100%. Bars denote mean ± S.D.
pase-7 antibody were performed in the same set of cell lysates as Fig. 2. Consistent with the report, caspase-7 was co-precipitated with GRP78 in the absence of IGFBP-3 (2nd lane in Fig. 3A). With co-expression of GRP78 and IGFBP-3, however, caspase-7 was undetectable in IP with anti-His antibody when IGFBP-3 was associated with GRP78 (3rd lane in Fig. 3A). IP with anti-caspase-7 antibody further revealed that GRP78 was not coimmunoprecipitated with caspase-7 in the presence of IGFBP-3 (Fig. 3B). To examine the effect of IGFBP-3 on induction of caspase-7 activity in LCC9 drug-resistant cells, IGFBP-3 was expressed in LCC9 cells and caspase-7 activity was evaluated by western blot (Fig. 3C) and caspase-7 activity assay (Fig. 3D). IGFBP-3 expression in LCC9 cells induced caspase-7 cleavage indicative of caspase-7 activation
(Fig. 3C). This was further confirmed by a caspase-7 specific activity assay showing 2-fold increase of DEVDase activity in IGFBP-3 expressing cells compared to control Ad:EV infected cells. These data indicate that IGFBP-3 may render drug-resistant breast cancer cells to apoptosis by dissociating caspase-7 from GRP78 and thereby activating caspase-7. 3.4. IGFBP-3 renders LCC9 cells sensitive to ICI 182,780 and suppresses their viability To explore the possibility whether IGFBP-3 expression affects cell viability in drug-resistant cells, LCC9 cells were subjected to WST-1 assay following Ad:IGFBP-3 infection. Ad:IGFBP-3 infection
C. Li et al. / Cancer Letters 325 (2012) 200–206
203
Fig. 2. IGFBP-3 and GRP78 interact in LCC9 cells. LCC9 wells were infected with Ad:His-GRP78 (MOI 250), Ad:IGFBP-3-Flag (MOI 250), or in combination. The cell lysates were used for immunoprecipitation with anti-His-antibody (A) or anti-Flag antibody (B). The immunocomplexes were resolved by SDS–PAGE followed by western blot analysis with the indicated antibodies.
at MOI 250 suppressed LCC9 cell viability by 40% compared to Ad:EV infection, and the suppression was slightly greater with MOI 500 of Ad:IGFBP-3 (Fig. 4A). To elucidate the role of IGFBP-3 in the context of its interaction with GRP78, GRP78 expression was suppressed using siRNAs specific to GRP78. As shown in Fig. 4B, GRP78 knockdown itself decreased cell viability by 20%. When GRP78 siRNAs and IGFBP-3 expression were combined, cell viability was further suppressed. Intriguingly, when IGFBP-3 was expressed in LCC9 cells, the cells became ICI 182,780-sensitive compared with Ad:EV infected cells at 250 nM of ICI 182,780 (Fig. 4C). The observed inhibitory effect of IGFBP-3 on cell viability was at least in part through its interaction with GRP78 since when GRP78 expression was suppressed with GRP78 siRNA, ICI 182,780 treatment in addition to IGFBP-3 expression resulted in more significant decrease in LCC9 cell viability than ICI 182,780 treatment itself (Fig. 4D). Taken together, these results suggest that IGFBP-3 renders LCC9 cells ICI 182,780 sensitive by activating caspase-7 through its dissociation from GRP78. 4. Discussion IGFBPs modulate the actions of IGFs by preventing IGF binding to its receptor, subsequently inhibiting its biological effects. This function of IGFBPs has drawn more attention in breast cancer recently since the studies demonstrating that the IGF/IGF-IR axis plays a crucial role in tumorigenesis and progression of breast cancer [26]. IGF-I and IGF-IR are found widely expressed in human breast tumor specimens [27–29]. Increased expression of IGF-IR is detected in 90% of breast cancer, and both IGF-I and IGF-II have been shown to have mitotic effects in breast cancer cells [30,31]. IGFBP-3 has been shown to inhibit the cell growth in an IGF-dependent manner in breast cancer cells [32]. The effort has been made to block the IGF/IGF-IR axis in breast cancer. Monoclonal antibodies targeting the extracellular domains of the IGF-IR and small inhibitor molecules to inhibit the kinase domains of all IGF receptors have been generated, some of which are in clinical trials [26]. In addition to the IGF/IGF-IR axis-dependent actions of IGFBP-3, more evidence has emerged that the interaction of IGFBP-3 with a variety of proteins or critical signaling cascades induces cell cycle arrest and apoptosis independently of the IGF/IGF-1R axis [11]. The anti-proliferative effects of TGF-b [33–35], retinoic acid [34,36–39], TNF-a [40–44] and Vitamin-D [45,46] analogs and
Fig. 3. IGFBP-3 dissociates the interaction between GRP78 and caspase-7 via its binding to GRP78, resulting in caspase-7 activation. (A) The same set of cell lysates used in Fig. 2 was immunoprecipitated with anti-His antibody, and the resulting immunocomplexes were resolved by SDS–PAGE followed by the indicated antibodies. (B) LCC9 cell lysates from Ad:EV or Ad:IGFBP-3 infected cells were subjected to immunoprecipitation with anti-caspase-7 antibody, and the immunocomplexes were analyzed by western blot analysis with the indicated antibodies. (C) LCC9 cell lysates from non-infected (control), Ad:EV (MOI 250), or Ad:IGFBP-3 (MOI 250) infected cells were subjected to western blot analysis with the indicated antibodies. Alpha-tubulin was used as a loading control. (D) The same set of cell lysates used in Fig. 3C were used for caspase activity assay using Ac-DEVD-amidomethylcoumarin as a substrate. Bars denote mean ± S.D.p < 0.05.
activation of related downstream signaling pathways in breast cancer cells have shown to be regulated, at least partially, through the IGFBP-3 system [11]. Previous studies have demonstrated that IGFBP-3 functions as a ligand for the type V TGF-b receptor and that the interaction between these two proteins leads to cell proliferation inhibition [15]. Further study for IGFBP-3-bound cell membrane proteins came from the identification of an autocrine motility factor (AMF)/phosphoglucose isomerase (PGI)/IGFBP-3 complex by cross-linking biotinylated IGFBP-3 to breast cancer cell membranes [16]. Recently we have identified a novel cell death receptor named IGFBP-3R, which mediates anti-tumor effects of
204
C. Li et al. / Cancer Letters 325 (2012) 200–206
Fig. 4. IGFBP-3 sensitizes LCC9 cells to ICI 182,780 through, in part, by its interaction with GRP78. (A) LCC9 cells were infected with Ad:EV or Ad:IGFBP-3 at MOI 250 and cultured for 2 days in the presence of 1% serum. WST-1 assay was performed to determine the cell viability. At each MOI, the cell viability of the cells infected with Ad:EV was considered as 100%. (B) Sixty 103 cells/well were plated into 96-well plate. The cells were transfected with the indicated siRNA and infected with the indicated adenovirus at MOI 250. On the following day, the media were changed and the cells were cultured for 4 days in the presence of 1% serum. The live cells were counted using trypan blue. Bars denote mean ± S.D.p < 0.05. (C) Adenovirus infection was performed as described in (B). One day after the media change, ICI 182,780 was added to the cell culture, and the cells were cultured for 2 days. The media was replaced with fresh media without ICI 182,780, and the cells were cultured for 1 day. The live cells were counted using trypan blue. Bars denote mean ± S.D.p < 0.05. (D) Small interfering RNA transfection, adenovirus infection, and ICI 182,780 treatment were performed as described above. WST-1 assay was performed to determine the cell viability. The result from the cells with no transfection/infection/ICI 182,780 was considered as 100%. Bars denote mean ± S.D.p < 0.05.
IGFBP-3 in breast and prostate cancer cells through activation of caspase-8-dependent apoptosis [14]. In addition, several other important binding partners of IGFBP-3 have also been reported, such as Humanin, its interaction with IGFBP-3 may be important in neurological diseases progression [17]; RNA polymerase II binding subunit 3 (Rpb3), its association with IGFBP-3 may play a critical role for IGFBP-3-regulated gene transcription [18]; GalNAc-T14 binding to IGFBP-3 in vitro and in vivo with ambiguous mechanisms [19]. Translocation of IGFBP-3 to the nucleus has been also demonstrated where it interacted with nuclear receptors such as retinoid X receptor-a, retinoic acid receptor, and Nur77 to induce apoptosis [20]. Interaction of IGFBP-3 with BAX in the mitochondria has been also reported for apoptosis induction [21]. Several studies showed that a mutant IGFBP-3 which lacks nuclear localization property can still induce apoptosis in cancer cells [47,48]. These studies suggest that IGFBP-3 is a potent tumor suppressor whose biological functions are mediated through the interaction with a variety of binding ligands either on the cell surface or within the cells. GRP78, also called BiP (immunoglobulin heavy-chain binding protein), is a major molecular chaperon at the endoplasmic reticulum (ER) [49,50]. It is a multifunctional protein with an anti-apoptotic property. When unfolded or misfolded proteins accumulate in the ER (called ER stress), unfolded protein response (UPR) is activated through the induction of GRP78 and the activation of PERK, IRE1, and ATF6. It is a response to restore normal function of the ER by attenuating global translation and increasing the folding capacity of the ER. In the unstressed state, GRP78 binds to those three proteins to maintain them inactive. When ER stress prolongs, UPR induces apoptosis with the mechanisms to be elucidated [51].
Due to its anti-apoptotic property, GRP78 is implicated in tumor progression and drug-resistance of solid tumors [52]. Development of acquired antiestrogen resistance becomes a major obstacle for the effective treatment of metastatic breast cancer although there is initial drug sensitivity. High expression level of GRP78 confers multiple survival advantages to facilitate the proliferation of cancer cells through harsh conditions and to acquire chemotherapeutic resistance when subjected to drug treatment [53–57]. GRP78 can be found highly expressed in many tumor cell lines and primary tumors, such as breast and prostate cancer cells, while it is difficult to detect GRP78 expression in normal cells. In vivo studies also demonstrate a critical role of GRP78 in tumor growth, metastasis and angiogenesis in xenograft and Grp78 heterozegous mice [57]. It has been shown that GRP78 interacts with proapoptotic protein BIK and specific caspases such as caspase-7 on the ER membrane, thereby regulating the balance between cell survival and apoptosis [25,58–60]. GRP78 is commonly thought to locate inside the ER lumen because of a presumed N-terminal ER localization signal that guides its localization into the ER. GRP78 can be detected as a cell surface protein in a broad variety of tumor cells by global profiling of the cell surface genome of cancer cells, suggesting that these cells may have evolved a specific mechanism to translocate GRP78 to cell surface [53,61,62]. In the present study, we showed that GRP78 overexpression caused antiestrogen resistance in MCF7-derived LCC9 cells, which strongly suggest that GRP78 is a critical factor involved in drugresistance in breast cancer cells. Knockdown of endogenous GRP78 or overexpression of IGFBP-3 in LCC9 cells restored antiestrogen sensitivity in these cells. Further data obtained from co-IP confirmed the interaction of IGFBP-3 with GRP78. In addition,
C. Li et al. / Cancer Letters 325 (2012) 200–206
205
Fig. 5. Model of the inhibitory effect of IGFBP-3 on GRP78-induced ICI 182,780-resistsnce in breast cancer cells. IGFBP-3 interacts with GRP78 at the ER membrane and hence interferes with GRP78-caspase-7 complex, resulting in the dissociation of caspase-7 from the complex. Released caspase-7 is then activated leading the cells to apoptosis. We also speculate that IGFBP-3 binding to GRP78 would result in inhibition of other biological functions of GRP78 in breast cancer cells as indicated in the figure.
decline in cell viability induced by the introduction of IGFBP-3 into LCC9 cells was associated with the release and consequent activation of caspase-7, which was considered as the binding ligand for GRP78 in the resting stage of drug resistant breast cancer cells (Fig. 5). In summary, our findings demonstrate that GRP78 is a binding partner of IGFBP-3 and that GRP78 induces drug resistance in MCF7 leading it to antiestrogen-resistant cells such as LCC9. This novel finding enhances our understanding of the multifaceted molecular mechanisms of the IGF/IGF-1R axis-independent actions of IGFBP-3 in cancer cells. We provide the very first evidence for IGFBP-3 interaction with GRP78 and subsequent IGFBP-3’s inhibitory effect on acquired drug-resistance in cancer cells. Our finding may provide a rewarding novel anti-tumor approach for drug-resistant breast cancer cells. Acknowledgements This study was supported by Department of Defense Grant, W81XWH-09-1-0061 (to Y.O). We thank Dr. R. Clarke (Georgetown University) for providing MCF-7-derived LCC9 cells, Dr. A.S. Lee (University of Southern California) for Ad:GRP78. Amplification and titer determination of adenovirus were performed by the VCU Massey Cancer Center Biological Macromolecule Shared Resource, supported, in part, with funding from NIH-NCI Cancer Center Support Grant P30 CA016059. References [1] American Cancer Society. Breast Cancer Facts & Figures 2011–2012. Atlanta: American Cancer, Society, Inc., 2011. [2] V.C. Jordan, Antiestrogenic and antitumor properties of tamoxifen in laboratory animals, Cancer Treat. Rep. 60 (1976) 1409–1419. [3] L. Kangas, A.L. Nieminen, G. Blanco, M. Gronroos, S. Kallio, A. Karjalainen, M. Perila, M. Sodervall, R. Toivola, A new triphenylethylene compound, fc-1157a. II. Antitumor effects, Cancer Chemother. Pharmacol. 17 (1986) 109–113. [4] L. Gibson, D. Lawrence, C. Dawson, J. Bliss, Aromatase inhibitors for treatment of advanced breast cancer in postmenopausal women, Cochrane Database Syst. Rev. (4) (2009) CD003370. [5] M. Dediu, D. Median, A. Alexandru, G. Vremes, C. Gal, M. Gongu, Adjuvant therapy with aromatase inhibitors in postmenopausal, estrogen receptorpositive breast cancer patients: upfront or sequential?, J Buon. 14 (2009) 375– 379.
[6] M.G. Parker, Action of ‘‘pure’’ antiestrogens in inhibiting estrogen receptor action, Breast Cancer Res. Treat. 26 (1993) 131–137. [7] N.J. Bundred, E. Anderson, R.I. Nicholson, M. Dowsett, M. Dixon, J.F. Robertson, Fulvestrant, an estrogen receptor downregulator, reduces cell turnover index more effectively than tamoxifen, Anticancer Res. 22 (2002) 2317–2319. [8] M. Dowsett, R.I. Nicholson, R.J. Pietras, Biological characteristics of the pure antiestrogen fulvestrant: overcoming endocrine resistance, Breast Cancer Res. Treat. 93 (Suppl. 1) (2005) S11–S18. [9] S. Mohan, D.J. Baylink, IGF-binding proteins are multifunctional and act via IGF-dependent and -independent mechanisms, J. Endocrinol. 175 (2002) 19– 31. [10] V. Hwa, Y. Oh, R.G. Rosenfeld, The insulin-like growth factor-binding protein (IGFBP) superfamily, Endocr. Rev. 20 (1999) 761–787. [11] S. Jogie-Brahim, D. Feldman, Y. Oh, Unraveling insulin-like growth factor binding protein-3 actions in human disease, Endocr. Rev. 30 (2009) 417– 437. [12] H.S. Kim, A.R. Ingermann, J. Tsubaki, S.M. Twigg, G.E. Walker, Y. Oh, Insulin-like growth factor-binding protein 3 induces caspase-dependent apoptosis through a death receptor-mediated pathway in MCF-7 human breast cancer cells, Cancer Res. 64 (2004) 2229–2237. [13] Y. Oh, H.L. Muller, H. Pham, R.G. Rosenfeld, Demonstration of receptors for insulin-like growth factor binding protein-3 on Hs578T human breast cancer cells, J. Biol. Chem. 268 (1993) 26045–26048. [14] A.R. Ingermann, Y.F. Yang, J. Han, et al., Identification of a novel cell death receptor mediating IGFBP-3-induced anti-tumor effects in breast and prostate cancer, J. Biol. Chem. 285 (2010) 30233–30246. [15] S.M. Leal, Q. Liu, S.S. Huang, J.S. Huang, The type V transforming growth factor beta receptor is the putative insulin-like growth factor-binding protein 3 receptor, J. Biol. Chem. 272 (1997) 20572–20576. [16] S. Mishra, A. Raz, L.J. Murphy, Insulin-like growth factor binding protein-3 interacts with autocrine motility factor/phosphoglucose isomerase (AMF/PGI) and inhibits the AMF/PGI function, Cancer Res. 64 (2004) 2516–2522. [17] M. Ikonen, B. Liu, Y. Hashimoto, L. Ma, K.W. Lee, T. Niikura, I. Nishimoto, P. Cohen, Interaction between the alzheimer’s survival peptide humanin and insulin-like growth factor-binding protein 3 regulates cell survival and apoptosis, Proc. Nat. Acad. Sci. U.S.A. 100 (2003) 13042–13047. [18] M. Oufattole, S.W. Lin, B. Liu, D. Mascarenhas, P. Cohen, B.D. Rodgers, Ribonucleic acid polymerase II binding subunit 3 (Rpb3), a potential nuclear target of insulin-like growth factor binding protein-3, Endocrinology 147 (2006) 2138–2146. [19] C. Wu, G. Yao, M. Zou, G. Chen, M. Wang, J. Liu, J. Wang, D. Xu, Nacetylgalactosaminyltransferase 14, a novel insulin-like growth factor binding protein-3 binding partner, Biochem. Biophys. Res. Commun. 357 (2007) 360– 365. [20] K.W. Lee, L. Ma, X. Yan, B. Liu, X.K. Zhang, P. Cohen, Rapid apoptosis induction by IGFBP-3 involves an insulin-like growth factor-independent nucleomitochondrial translocation of RXRalpha/Nur77, J. Biol. Chem. 280 (2005) 16942–16948. [21] Y. Jia, K.W. Lee, R. Swerdloff, D. Hwang, L.J. Cobb, A. Sinha Hikim, Y.H. Lue, P. Cohen, C. Wang, Interaction of insulin-like growth factor-binding protein-3 and BAX in mitochondria promotes male germ cell apoptosis, J. Biol. Chem. 285 (2010) 1726–1732.
206
C. Li et al. / Cancer Letters 325 (2012) 200–206
[22] J. Han, S. Jogie-Brahim, A. Harada, Y. Oh, Insulin-like growth factor-binding protein-3 suppresses tumor growth via activation of caspase-dependent apoptosis and cross-talk with NF-kappaB signaling, Cancer Lett. 307 (2011) 200–210. [23] B.H. Yeung, B.W. Kwan, Q.Y. He, A.S. Lee, J. Liu, A.S. Wong, Glucose-regulated protein 78 as a novel effector of BRCA1 for inhibiting stress-induced apoptosis, Oncogene 27 (2008) 6782–6789. [24] N. Brunner, B. Boysen, S. Jirus, T.C. Skaar, C. Holst-Hansen, J. Lippman, T. Frandsen, M. Spang-Thomsen, S.A. Fuqua, R. Clarke, MCF7/LCC9: an antiestrogen-resistant MCF-7 variant in which acquired resistance to the steroidal antiestrogen ICI 182,780 confers an early cross-resistance to the nonsteroidal antiestrogen tamoxifen, Cancer Res. 57 (1997) 3486–3493. [25] R.K. Reddy, C. Mao, P. Baumeister, R.C. Austin, R.J. Kaufman, A.S. Lee, Endoplasmic reticulum chaperone protein GRP78 protects cells from apoptosis induced by topoisomerase inhibitors: role of ATP binding site in suppression of caspase-7 activation, J. Biol. Chem. 278 (2003) 20915–20924. [26] L. Mohanraj, Y. Oh, Targeting IGF-I, IGFBPs and IGF-I receptor system in cancer: the current and future in breast cancer therapy, Recent. Pat. Anticancer Drug Discov. 6 (2011) 166–177. [27] R.A. Jones, C.I. Campbell, E.J. Gunther, L.A. Chodosh, J.J. Petrik, R. Khokha, R.A. Moorehead, Transgenic overexpression of IGF-IR disrupts mammary ductal morphogenesis and induces tumor formation, Oncogene 26 (2007) 1636– 1644. [28] J.P. Peyrat, J. Bonneterre, R. Beuscart, J. Djiane, A. Demaille, Insulin-like growth factor 1 receptors in human breast cancer and their relation to estradiol and progesterone receptors, Cancer Res. 48 (1988) 6429–6433. [29] K.J. Cullen, D. Yee, W.S. Sly, J. Perdue, B. Hampton, M.E. Lippman, N. Rosen, Insulin-like growth factor receptor expression and function in human breast cancer, Cancer Res. 50 (1990) 48–53. [30] K.J. Cullen, A. Allison, I. Martire, M. Ellis, C. Singer, Insulin-like growth factor expression in breast cancer epithelium and stroma, Breast Cancer Res. Treat. 22 (1992) 21–29. [31] C.L. Arteaga, C.K. Osborne, Growth inhibition of human breast cancer cells in vitro with an antibody against the type I somatomedin receptor, Cancer Res. 49 (1989) 6237–6241. [32] L.J. Schedlich, L.D. Graham, Role of insulin-like growth factor binding protein-3 in breast cancer cell growth, Microsc. Res. Tech. 59 (2002) 12–22. [33] Y. Oh, H.L. Muller, L. Ng, R.G. Rosenfeld, Transforming growth factor-betainduced cell growth inhibition in human breast cancer cells is mediated through insulin-like growth factor-binding protein-3 action, J. Biol. Chem. 270 (1995) 13589–13592. [34] Z.S. Gucev, Y. Oh, K.M. Kelley, R.G. Rosenfeld, Insulin-like growth factor binding protein 3 mediates retinoic acid- and transforming growth factor beta2-induced growth inhibition in human breast cancer cells, Cancer Res. 56 (1996) 1545–1550. [35] J.L. Martin, M. Ballesteros, R.C. Baxter, Insulin-like growth factor-I (IGF-I) and transforming growth factor-beta 1 release IGF-binding protein-3 from human fibroblasts by different mechanisms, Endocrinology 131 (1992) 1703–1710. [36] J.A. Fontana, A. Burrows-Mezu, D.R. Clemmons, D. LeRoith, Retinoid modulation of insulin-like growth factor-binding proteins and inhibition of breast carcinoma proliferation, Endocrinology 128 (1991) 1115–1122. [37] M.L. Adamo, Z.M. Shao, F. Lanau, J.C. Chen, D.R. Clemmons, C.T. Roberts Jr, D. LeRoith, J.A. Fontana, Insulin-like growth factor-I (IGF-I) and retinoic acid modulation of IGF-binding proteins (IGFBPs): IGFBP-2, -3, and -4 gene expression and protein secretion in a breast cancer cell line, Endocrinology 131 (1992) 1858–1866. [38] J.L. Martin, J.A. Coverley, S.T. Pattison, R.C. Baxter, Insulin-like growth factorbinding protein-3 production by MCF-7 breast cancer cells: stimulation by retinoic acid and cyclic adenosine monophosphate and differential effects of estradiol, Endocrinology 136 (1995) 1219–1226. [39] Y. Shang, C.R. Baumrucker, M.H. Green, Signal relay by retinoic acid receptors alpha and beta in the retinoic acid-induced expression of insulin-like growth factor-binding protein-3 in breast cancer cells, J. Biol. Chem. 274 (1999) 18005–18010. [40] M.E. Yateman, D.C. Claffey, S.C. Cwyfan Hughes, V.J. Frost, J.A. Wass, J.M. Holly, Cytokines modulate the sensitivity of human fibroblasts to stimulation with insulin-like growth factor-I (IGF-I) by altering endogenous IGF-binding protein production, J. Endocrinol. 137 (1993) 151–159. [41] R.C. Olney, D.M. Wilson, M. Mohtai, P.J. Fielder, R.L. Smith, Interleukin-1 and tumor necrosis factor-alpha increase insulin-like growth factor-binding
[42]
[43]
[44]
[45]
[46]
[47]
[48]
[49]
[50]
[51] [52] [53]
[54]
[55] [56] [57] [58]
[59]
[60]
[61]
[62]
protein-3 (IGFBP-3) production and IGFBP-3 protease activity in human articular chondrocytes, J. Endocrinol. 146 (1995) 279–286. V. Besset, B. Le Magueresse-Battistoni, J. Collette, M. Benahmed, Tumor necrosis factor alpha stimulates insulin-like growth factor binding protein 3 expression in cultured porcine sertoli cells, Endocrinology 137 (1996) 296– 303. F. Rozen, J. Zhang, M. Pollak, Antiproliferative action of tumor necrosis factoralpha on MCF-7 breastcancer cells is associated with increased insulin-like growth factor binding protein-3 accumulation, Int. J. Oncol. 13 (1998) 865– 869. R. Rajah, K.W. Lee, P. Cohen, Insulin-like growth factor binding protein-3 mediates tumor necrosis factor-alpha-induced apoptosis: role of bcl-2 phosphorylation, Cell Growth Differ. 13 (2002) 163–171. K.W. Colston, C.M. Perks, S.P. Xie, J.M. Holly, Growth inhibition of both MCF-7 and Hs578T human breast cancer cell lines by vitamin D analogues is associated with increased expression of insulin-like growth factor binding protein-3, J. Mol. Endocrinol. 20 (1998) 157–162. T. Nickerson, H. Huynh, Vitamin D analogue EB1089-induced prostate regression is associated with increased gene expression of insulin-like growth factor binding proteins, J. Endocrinol. 160 (1999) 223–229. N. Bhattacharyya, K. Pechhold, H. Shahjee, G. Zappala, C. Elbi, B. Raaka, M. Wiench, J. Hong, M.M. Rechler, Nonsecreted insulin-like growth factor binding protein-3 (IGFBP-3) can induce apoptosis in human prostate cancer cells by IGF-independent mechanisms without being concentrated in the nucleus, J. Biol. Chem. 281 (2006) 24588–24601. G. Zappala, C. Elbi, J. Edwards, J. Gorenstein, M.M. Rechler, N. Bhattacharyya, Induction of apoptosis in human prostate cancer cells by insulin-like growth factor binding protein-3 does not require binding to retinoid X receptor-alpha, Endocrinology 149 (2008) 1802–1812. E. Little, M. Ramakrishnan, B. Roy, G. Gazit, A.S. Lee, The glucose-regulated proteins (GRP78 and GRP94): functions, gene regulation, and applications, Crit. Rev. Eukaryot. Gene Expr. 4 (1994) 1–18. A. Bertolotti, Y. Zhang, L.M. Hendershot, H.P. Harding, D. Ron, Dynamic interaction of BiP and ER stress transducers in the unfolded-protein response, Nat. Cell Biol. 2 (2000) 326–332. H. Malhi, R.J. Kaufman, Endoplasmic reticulum stress in liver disease, J. Hepatol. 54 (2011) 795–809. G. Jing, J.J. Wang, S.X. Zhang, ER stress and apoptosis: a new mechanism for retinal cell death, Exp. Diabetes Res. 2012 (2012) 589589. M. Gonzalez-Gronow, M.A. Selim, J. Papalas, S.V. Pizzo, GRP78: a multifunctional receptor on the cell surface, Antioxid. Redox Signal. 11 (2009) 2299–2306. D. Dong, M. Ni, J. Li, et al., Critical role of the stress chaperone GRP78/BiP in tumor proliferation, survival, and tumor angiogenesis in transgene-induced mammary tumor development, Cancer Res. 68 (2008) 498–505. A.S. Lee, The glucose-regulated proteins: stress induction and clinical applications, Trends Biochem. Sci. 26 (2001) 504–510. J. Li, A.S. Lee, Stress induction of GRP78/BiP and its role in cancer, Curr. Mol. Med. 6 (2006) 45–54. A.S. Lee, GRP78 induction in cancer: therapeutic and prognostic implications, Cancer Res. 67 (2007) 3496–3499. R.V. Rao, K. Niazi, P. Mollahan, X. Mao, D. Crippen, K.S. Poksay, S. Chen, D.E. Bredesen, Coupling endoplasmic reticulum stress to the cell-death program: a novel HSP90-independent role for the small chaperone protein p23, Cell Death Differ. 13 (2006) 415–425. Y. Fu, J. Li, A.S. Lee, GRP78/BiP inhibits endoplasmic reticulum BIK and protects human breast cancer cells against estrogen starvation-induced apoptosis, Cancer Res. 67 (2007) 3734–3740. N. Rauschert, S. Brandlein, E. Holzinger, F. Hensel, H.K. Muller-Hermelink, H.P. Vollmers, A new tumor-specific variant of GRP78 as target for antibody-based therapy, Lab. Invest. 88 (2008) 375–386. U.K. Misra, R. Deedwania, S.V. Pizzo, Activation and cross-talk between Akt, NF-kappaB, and unfolded protein response signaling in 1-LN prostate cancer cells consequent to ligation of cell surface-associated GRP78, J. Biol. Chem. 281 (2006) 13694–13707. U.K. Misra, S.V. Pizzo, Ligation of cell surface GRP78 with antibody directed against the COOH-terminal domain of GRP78 suppresses Ras/MAPK and PI 3kinase/AKT signaling while promoting caspase activation in human prostate cancer cells, Cancer Biol. Ther. 9 (2010) 142–152.
Contents lists available at SciVerse ScienceDirect
Cancer Letters journal homepage: www.elsevier.com/locate/canlet
IGFBP-3 sensitizes antiestrogen-resistant breast cancer cells through interaction with GRP78 Chao Li 1, Aki Harada 1, Youngman Oh ⇑ Department of Pathology, Medical College of Virginia Campus, Virginia Commonwealth University, 1101 East Marshall Street, Richmond, VA 23298, USA
a r t i c l e
i n f o
Article history: Received 4 May 2012 Accepted 2 July 2012
Keywords: GRP78 IGFBP-3 Caspase-7 Apoptosis Breast cancer Drug-resistance
a b s t r a c t IGFBP-3 is known to possess intrinsic biological activities such as anti-tumor property in addition to its IGF/IGF-R axis-dependent actions in a variety of human cancers including breast cancer. To investigate the molecular mechanisms underlying the intrinsic biological actions of IGFBP-3 on breast cancer cells, we performed yeast two-hybrid screening and found GRP78, known to cause drug-resistance, as a binding partner of IGFBP-3. Overexpression of IGFBP-3 in antiestrogen-resistant LCC9 cells showed that IGFBP-3 interacted with GRP78, resulting in disruption of the GRP78-caspase-7 complex, thereby activating caspase-7, and further inducing apoptosis. Combination of overexpression of IGFBP-3 and application of siRNAs against GRP78 led to decrease in cell viability upon ICI 182,780 treatment. These data suggest that IGFBP-3 could sensitize antiestrogen-resistant breast cancer cells to ICI 182,780 by preventing the anti-apoptotic function of GRP78. Ó 2012 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Breast cancer is the second leading cause of death in women in the US after lung cancer. According to American Cancer Society report, approximately 39,520 deaths from breast cancer were estimated in 2011 [1]. Hormone therapy is one of the adjuvant therapies for women whose breast cancers test positive for hormone receptors. Estrogen is known to promote the growth of many breast cancers through its binding to estrogen receptor and/or progesterone receptor. Antiestrogen drugs such as tamoxifen and toremifene work by blocking estrogen receptor on breast cancer cells while aromatase inhibitors stop estrogen production in post-menopausal women [2–5]. Fulvestrant (ICI 182,780) is an antiestrogen which exerts its effect not only by blocking estrogen receptor but also decreasing its number [6–8]. It is effective even when breast cancer cells develop tamoxifen-resistance. Despite
Abbreviations: IGF, insulin-like growth factor; IGFBP, IGF binding protein; Ad, adenovirus; EV, empty vector; MOI, multiplicity of infection; ER, endoplasmic reticulum. ⇑ Corresponding author. Address: Department of Pathology, Medical College of Virginia, Virginia Commonwealth University, 1101 East Marshall Street, P.O. Box 980662, Richmond, VA 23298-0662, USA. Tel.: +1 804 827 1324; fax: +1 804 828 9749. E-mail address: [email protected] (Y. Oh). 1 These authors contributed equally to this work. 0304-3835/$ - see front matter Ó 2012 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.canlet.2012.07.004
these improvements in treatment, acquired drug-resistance is still a major obstacle for the treatment of breast cancer. Insulin-like growth factor binding protein-3 (IGFBP-3), a major binding protein of IGFs in circulation, is known to modulate the actions of IGFs in the circulation as well as the immediate extracellular environment [9–12]. Although its anti-proliferative functions are mainly through the attenuation of the IGF/IGF-IR interaction, more recently IGFBP-3 is widely considered to demonstrate various biological effects independent of the IGF/IGF-IR axis. Previous studies from our laboratory as well as other groups indicated that interaction of IGFBP-3 with a variety of signaling molecules or cell surface proteins is critical for its apoptotic functions in a variety of cancer cells [12–21]. In addition, the proapoptotic effect of IGFBP-3 was associated with the activation of specific caspases that are mediated through death receptor-modulated apoptotic events in cancer cells [12,14]. Furthermore we have shown that IGFBP-3 sensitizes prostate cancer cells to doxorubicin through activation of caspase-8 and caspase-3/7 [22]. To deepen our understanding of the IGF/IGF-IR-independent action of IGFBP-3 in human disease, we performed the yeast two-hybrid screening to identify IGFBP-3-interacting partner proteins using an Hs578T breast cancer cell cDNA library. We discovered the 78-kDa glucose regulated protein (GRP78) as a novel binding partner of IGFBP-3. Interestingly GRP78 has been shown to be involved in the development of drug-resistance in breast cancer. Our study shows that IGFBP-3 binds to GRP78, thereby releasing caspase-7 from the GRP78-caspase-7 complex resulting in apoptosis in drug-resistant breast cancer cells.
C. Li et al. / Cancer Letters 325 (2012) 200–206 2. Materials and methods 2.1. Yeast two-hybrid screening
201
(Enzo Life Sciences, Farmingdale, NY) in assay buffer (50 mM HEPES pH 7.4, 100 mM NaCl, 0.1% CHAPS, 10% glycerol, 1 mM EDTA, and 10 mM dithiothreitol). The reaction mixture was incubated at 37 °C for 6 h, and fluorescence was measured in a fluorescence plate reader (BMG Labtech, Cary, NC).
Yeast two-hybrid screening was performed as described previously [14]. Briefly, an Hs578T cDNA library was generated and screened against IGFBP-3 encoding amino acids 88–148 as bait.
2.8. Statistical analysis
2.2. Adenovirus preparation
The experiments were done three times. We carried out statistical analysis by analysis of variance with Student’s t test. The p < 0.05 or less was considered significant.
Adenovirus harboring His-tagged GRP78 was provided by Dr. A.S. Lee (University of Southern California, CA) [23]. Generation of Ad:EV (empty vector) and Ad:IGFBP-3 (Flag-tagged) has been described previously [14]. Amplification and purification by CsCl gradient centrifugation of clonal recombinant adenoviruses were performed at Virginia Commonwealth University Virus Core Facility.
3. Results 3.1. GRP78 plays a major role in ICI 182,780-resistance in breast cancer cells
2.3. Cell culture, adenovirus infection, and siRNA transfection MCF-7 (tamoxifen-sensitive) was purchased from ATCC (Manassas, VA). MCF7derived LCC9 (tamoxifen- and ICI 182,780- resistant) was provided by Dr. R. Clarke (Georgetown University Medical School, Washington, DC) [24]. Cells were cultured in phenol red-free RPMI (Mediatech, Manassas, VA) in the presence of 1% L-glutamine and 5% charcoal/dextran stripped fetal bovine serum (CCS) at 37 °C and 5% CO2. Cells were transfected with siRNA using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol in the presence of 5% CCS. Six hours or 24 h after transfection, the media were changed to RPMI + 1% CCS. Adenovirus infection was performed in the presence of 5% or 1% CCS. When the infection was performed with 5% CCS, the media were changed to RPMI + 1%CCS on the following day. Control siRNA and GRP78 siRNA were purchased from Thermo Scientific (Lafayette, CO) and Ambion (Austin, TX), respectively. 2.4. Western blot analysis and immunoprecipitation Cells were harvested in HBSS (Mediatech) supplemented with 0.5% Triton X100, 0.35 g/L of sodium bicarbonate, 5 mM EDTA pH 8.0, and Halt Protease Inhibitor Cocktail (Thermo Scientific). Equal amount of protein in lysates were separated by SDS–PAGE. For immunoprecipitation, 5 lg of either anti-His, anti-Flag, or anti-caspase-7 antibodies were incubated with protein G Sepharose in lysis buffer for 2 h at room temperature prior to the incubation with the cell lysates. Cell lysates were added to the antibody conjugate, and incubated overnight at 4 °C. The resulting immune complexes were subjected to western blot analysis. Anti-a-tubulin and antiFlag (M2) antibodies, and protein G Sepharose were purchased from Sigma–Aldrich (St.Louis, MO). Anti-GRP78 and horseradish peroxidase-conjugated donkey-antigoat secondary antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-IGFBP-3 antibody was generated and validated in our laboratory (Strategic BioSolutions, Newark, DE) [22]. Anti-caspase-7 antibody was from BD Biosciences (San Jose, CA), and horseradish peroxidase–conjugated anti-rabbit and anti-mouse secondary antibodies were purchased from Cell Signaling (Danvers, MA).
MCF-7 (tamoxifen-sensitive) and MCF7-derived LCC9 (tamoxifen- and ICI 182,780-resistant) cells were used in order to explore the potential signaling pathways contributing to the development of drug-resistance in breast cancer cells. Cell viability assay showed dose-dependent growth inhibitory effect of ICI 182,780 on MCF-7 cells up to 500 nM while little effect was observed in LCC9 cells up to 1000 nM of ICI 182,780, confirming drug-resistant property of LCC9 cells (Fig. 1A). RT-PCR and western blot analysis demonstrated that GRP78 expression is much higher in LCC9 cells compared with that in MCF-7 cells (Fig. 1B). To elucidate the potential involvement of GRP78 in ICI 182,780-resistance in LCC9 cells, GRP78 was overexpressed in MCF-7 cells and cell viability assay was performed. Sub-optimal concentrations of ICI 182,780 (10–250 nM) which partially affected cell viability of MCF-7 were selected for the subsequent experiments. Uninfected and Ad:EV infected MCF-7 cells were sensitive to as little as 10 nM of ICI 182,780 (Fig. 1C). On the contrary, 250 nM of ICI 182,780 had little effect on the cell viability of GRP78-overexpressing MCF-7. GRP78 overexpression in LCC9 cells had no effect on their viability as LCC9 was already antiestrogen-resistant (Fig. 1D). However, when endogenous GRP78 was suppressed in LCC9 cells using siRNAs specific to GRP78, cells became drug-sensitive with decrease in cell viability by 40% even at 10 nM of ICI 182,780 (Fig. 1E). Taken together, our data suggest that overexpression of GRP78 may attribute, in part if not all, to antiestrogen-resistance in breast cancer cells.
2.5. RNA extraction and semi-quantitative RT-PCR Total RNA was extracted from the cells using Trizol (Invitrogen). One lg of purified total RNA was used for RT-PCR analysis using the ThermoScript RT-PCR System (Invitrogen). Semi-quantitative RT-PCR was performed as described previously described [22]. The sequences of the forward and reverse primers were as follows: GRP78 fwd, 50 CTGGGTACATTTGATCTGACTGG -30 ; rev, 50 GCATCCTGGTGGCTTTCCAGCCATTC -30 , b2-microglobulin (b2 M) fwd, 50 GTGCTCGCGCTACTCTCTCT-30 ; rev, 50 -CGGCAGGCATACTCATCTTT-30 . PCR amplification was performed 35 cycles (denaturation: 94 °C, 30 s; annealing: 55 °C, 30 s; extension: 72 °C, 30 s). Amplified products were analyzed on a 2.0% agarose gel and DNA was visualized by ethidium bromide staining. 2.6. Cell viability assay WST-1 and trypan blue were purchased from Roche Applied Science (Indianapolis, IN) and Thermo Scientific, respectively. Cell viability was determined by WST assay or by trypan blue exclusion followed by cell counting at day 6. For the WST assay, cells were plated in triplicate in 96-well plate. The cells were infected with Ad:EV, Ad:GRP78, or Ad:IGFBP-3 (MOI 250), and on the following day, treated with ICI 182,780 (Sigma–Aldrich, St.Louis, MO). This cycle was repeated once more, and the cells were cultured with 5% CO2 at 37 °C for 2 days and subjected to WST assay according to the manufacturer’s protocol.
3.2. GRP78 is a novel binding partner of IGFBP-3 in LCC9 cells In an effort of finding associating proteins of IGFBP-3, an yeast two-hybrid screening was performed, and three proteins were identified as its binding partners; two of which were IGFBP-3R [14] and GRP78. To confirm the interaction between GRP78 and IGFBP-3 in breast cancer cells, reciprocal immunoprecipitation (IP) studies were performed followed by western blot analysis using the lysates from LCC9 cells expressing His-tagged GRP78, Flag-tagged IGFBP-3, or both proteins. IP with an anti-His antibody showed co-immunoprecipitation of IGFBP-3 with His-tagged GRP78 in IGFBP-3 and GRP78 co-expressing cells, but not in IGFBP-3 expressing cells (Fig. 2A). IP with antibodies to Flag further showed GRP78 was pulled down only in the presence of IGFBP-3 (Fig. 2B). These data clearly demonstrate physical IGFBP-3 interaction with GRP78 in breast cancer cells. 3.3. IGFBP-3 dissociates interaction between GRP78 and caspase-7 via its binding to GRP78
2.7. Caspase-7 activity assay Caspase-7 activity assay was performed as described previously [14]. Cell lysates were prepared using CHAPS lysis buffer (50 mM HEPES, pH 7.4, 0.1% CHAPS, 0.1% Triton X-100, 0.1 mM EDTA, and 1 mM dithiothreitol) and 12,000 g centrifugation at 4 °C. DEVDase activity was measured using Ac-DEVD amidomethylcoumarin
Previous report indicated that GRP78 can bind to caspase-7 thereby contributing to drug-resistance in cancer cells [25]. To investigate how interaction between IGFBP-3 and GRP78 affect breast cancer cell viability, IP with anti-His antibody and anti-cas-
202
C. Li et al. / Cancer Letters 325 (2012) 200–206
Fig. 1. GRP78 plays a major role in ICI 182,780-resistance in breast cancer cells. (A) WST-1 assay was performed to demonstrate different responses to antiestrogen drug ICI 182,780 in drug-sensitive MCF7 and -resistant LCC9 cells. Cells were treated with the indicated concentration of ICI 182,780 for 7 days in the presence of 1% serum. ICI 182,780 was added with fresh media every other day. The results were normalized to the cell viability with no ICI 182,780 as 100% for each cell lines. (B) Basal mRNA and protein expression of GRP78 in MCF7 and LCC9 were detected by RT-PCR and western blot analysis, and the results were normalized to b-2 microglobulin (b2 M) and atubulin, respectively. MCF7 cells (C) and LCC9 cells (D) were infected with Ad:EV or Ad:GRP78 at MOI 250, or left uninfected. Cells were then treated with the indicated concentration of ICI 182,780, and the cell viability was measured by WST-1 assay. The cell viability with no ICI 182,780 was considered 100% for each adenovirus treatment. (E) LCC9 cells were transfected with control siRNA or GRP78 siRNA, and treated with the indicated concentration of ICI 182,780. Western blot analysis was performed to confirm the suppression of GRP78. Alpha-tubulin was used as a loading control. WST-1 assay was performed to measure cell viability. The cell viability with no siRNA transfection without ICI 182,780 was considered as 100%. Bars denote mean ± S.D.
pase-7 antibody were performed in the same set of cell lysates as Fig. 2. Consistent with the report, caspase-7 was co-precipitated with GRP78 in the absence of IGFBP-3 (2nd lane in Fig. 3A). With co-expression of GRP78 and IGFBP-3, however, caspase-7 was undetectable in IP with anti-His antibody when IGFBP-3 was associated with GRP78 (3rd lane in Fig. 3A). IP with anti-caspase-7 antibody further revealed that GRP78 was not coimmunoprecipitated with caspase-7 in the presence of IGFBP-3 (Fig. 3B). To examine the effect of IGFBP-3 on induction of caspase-7 activity in LCC9 drug-resistant cells, IGFBP-3 was expressed in LCC9 cells and caspase-7 activity was evaluated by western blot (Fig. 3C) and caspase-7 activity assay (Fig. 3D). IGFBP-3 expression in LCC9 cells induced caspase-7 cleavage indicative of caspase-7 activation
(Fig. 3C). This was further confirmed by a caspase-7 specific activity assay showing 2-fold increase of DEVDase activity in IGFBP-3 expressing cells compared to control Ad:EV infected cells. These data indicate that IGFBP-3 may render drug-resistant breast cancer cells to apoptosis by dissociating caspase-7 from GRP78 and thereby activating caspase-7. 3.4. IGFBP-3 renders LCC9 cells sensitive to ICI 182,780 and suppresses their viability To explore the possibility whether IGFBP-3 expression affects cell viability in drug-resistant cells, LCC9 cells were subjected to WST-1 assay following Ad:IGFBP-3 infection. Ad:IGFBP-3 infection
C. Li et al. / Cancer Letters 325 (2012) 200–206
203
Fig. 2. IGFBP-3 and GRP78 interact in LCC9 cells. LCC9 wells were infected with Ad:His-GRP78 (MOI 250), Ad:IGFBP-3-Flag (MOI 250), or in combination. The cell lysates were used for immunoprecipitation with anti-His-antibody (A) or anti-Flag antibody (B). The immunocomplexes were resolved by SDS–PAGE followed by western blot analysis with the indicated antibodies.
at MOI 250 suppressed LCC9 cell viability by 40% compared to Ad:EV infection, and the suppression was slightly greater with MOI 500 of Ad:IGFBP-3 (Fig. 4A). To elucidate the role of IGFBP-3 in the context of its interaction with GRP78, GRP78 expression was suppressed using siRNAs specific to GRP78. As shown in Fig. 4B, GRP78 knockdown itself decreased cell viability by 20%. When GRP78 siRNAs and IGFBP-3 expression were combined, cell viability was further suppressed. Intriguingly, when IGFBP-3 was expressed in LCC9 cells, the cells became ICI 182,780-sensitive compared with Ad:EV infected cells at 250 nM of ICI 182,780 (Fig. 4C). The observed inhibitory effect of IGFBP-3 on cell viability was at least in part through its interaction with GRP78 since when GRP78 expression was suppressed with GRP78 siRNA, ICI 182,780 treatment in addition to IGFBP-3 expression resulted in more significant decrease in LCC9 cell viability than ICI 182,780 treatment itself (Fig. 4D). Taken together, these results suggest that IGFBP-3 renders LCC9 cells ICI 182,780 sensitive by activating caspase-7 through its dissociation from GRP78. 4. Discussion IGFBPs modulate the actions of IGFs by preventing IGF binding to its receptor, subsequently inhibiting its biological effects. This function of IGFBPs has drawn more attention in breast cancer recently since the studies demonstrating that the IGF/IGF-IR axis plays a crucial role in tumorigenesis and progression of breast cancer [26]. IGF-I and IGF-IR are found widely expressed in human breast tumor specimens [27–29]. Increased expression of IGF-IR is detected in 90% of breast cancer, and both IGF-I and IGF-II have been shown to have mitotic effects in breast cancer cells [30,31]. IGFBP-3 has been shown to inhibit the cell growth in an IGF-dependent manner in breast cancer cells [32]. The effort has been made to block the IGF/IGF-IR axis in breast cancer. Monoclonal antibodies targeting the extracellular domains of the IGF-IR and small inhibitor molecules to inhibit the kinase domains of all IGF receptors have been generated, some of which are in clinical trials [26]. In addition to the IGF/IGF-IR axis-dependent actions of IGFBP-3, more evidence has emerged that the interaction of IGFBP-3 with a variety of proteins or critical signaling cascades induces cell cycle arrest and apoptosis independently of the IGF/IGF-1R axis [11]. The anti-proliferative effects of TGF-b [33–35], retinoic acid [34,36–39], TNF-a [40–44] and Vitamin-D [45,46] analogs and
Fig. 3. IGFBP-3 dissociates the interaction between GRP78 and caspase-7 via its binding to GRP78, resulting in caspase-7 activation. (A) The same set of cell lysates used in Fig. 2 was immunoprecipitated with anti-His antibody, and the resulting immunocomplexes were resolved by SDS–PAGE followed by the indicated antibodies. (B) LCC9 cell lysates from Ad:EV or Ad:IGFBP-3 infected cells were subjected to immunoprecipitation with anti-caspase-7 antibody, and the immunocomplexes were analyzed by western blot analysis with the indicated antibodies. (C) LCC9 cell lysates from non-infected (control), Ad:EV (MOI 250), or Ad:IGFBP-3 (MOI 250) infected cells were subjected to western blot analysis with the indicated antibodies. Alpha-tubulin was used as a loading control. (D) The same set of cell lysates used in Fig. 3C were used for caspase activity assay using Ac-DEVD-amidomethylcoumarin as a substrate. Bars denote mean ± S.D.p < 0.05.
activation of related downstream signaling pathways in breast cancer cells have shown to be regulated, at least partially, through the IGFBP-3 system [11]. Previous studies have demonstrated that IGFBP-3 functions as a ligand for the type V TGF-b receptor and that the interaction between these two proteins leads to cell proliferation inhibition [15]. Further study for IGFBP-3-bound cell membrane proteins came from the identification of an autocrine motility factor (AMF)/phosphoglucose isomerase (PGI)/IGFBP-3 complex by cross-linking biotinylated IGFBP-3 to breast cancer cell membranes [16]. Recently we have identified a novel cell death receptor named IGFBP-3R, which mediates anti-tumor effects of
204
C. Li et al. / Cancer Letters 325 (2012) 200–206
Fig. 4. IGFBP-3 sensitizes LCC9 cells to ICI 182,780 through, in part, by its interaction with GRP78. (A) LCC9 cells were infected with Ad:EV or Ad:IGFBP-3 at MOI 250 and cultured for 2 days in the presence of 1% serum. WST-1 assay was performed to determine the cell viability. At each MOI, the cell viability of the cells infected with Ad:EV was considered as 100%. (B) Sixty 103 cells/well were plated into 96-well plate. The cells were transfected with the indicated siRNA and infected with the indicated adenovirus at MOI 250. On the following day, the media were changed and the cells were cultured for 4 days in the presence of 1% serum. The live cells were counted using trypan blue. Bars denote mean ± S.D.p < 0.05. (C) Adenovirus infection was performed as described in (B). One day after the media change, ICI 182,780 was added to the cell culture, and the cells were cultured for 2 days. The media was replaced with fresh media without ICI 182,780, and the cells were cultured for 1 day. The live cells were counted using trypan blue. Bars denote mean ± S.D.p < 0.05. (D) Small interfering RNA transfection, adenovirus infection, and ICI 182,780 treatment were performed as described above. WST-1 assay was performed to determine the cell viability. The result from the cells with no transfection/infection/ICI 182,780 was considered as 100%. Bars denote mean ± S.D.p < 0.05.
IGFBP-3 in breast and prostate cancer cells through activation of caspase-8-dependent apoptosis [14]. In addition, several other important binding partners of IGFBP-3 have also been reported, such as Humanin, its interaction with IGFBP-3 may be important in neurological diseases progression [17]; RNA polymerase II binding subunit 3 (Rpb3), its association with IGFBP-3 may play a critical role for IGFBP-3-regulated gene transcription [18]; GalNAc-T14 binding to IGFBP-3 in vitro and in vivo with ambiguous mechanisms [19]. Translocation of IGFBP-3 to the nucleus has been also demonstrated where it interacted with nuclear receptors such as retinoid X receptor-a, retinoic acid receptor, and Nur77 to induce apoptosis [20]. Interaction of IGFBP-3 with BAX in the mitochondria has been also reported for apoptosis induction [21]. Several studies showed that a mutant IGFBP-3 which lacks nuclear localization property can still induce apoptosis in cancer cells [47,48]. These studies suggest that IGFBP-3 is a potent tumor suppressor whose biological functions are mediated through the interaction with a variety of binding ligands either on the cell surface or within the cells. GRP78, also called BiP (immunoglobulin heavy-chain binding protein), is a major molecular chaperon at the endoplasmic reticulum (ER) [49,50]. It is a multifunctional protein with an anti-apoptotic property. When unfolded or misfolded proteins accumulate in the ER (called ER stress), unfolded protein response (UPR) is activated through the induction of GRP78 and the activation of PERK, IRE1, and ATF6. It is a response to restore normal function of the ER by attenuating global translation and increasing the folding capacity of the ER. In the unstressed state, GRP78 binds to those three proteins to maintain them inactive. When ER stress prolongs, UPR induces apoptosis with the mechanisms to be elucidated [51].
Due to its anti-apoptotic property, GRP78 is implicated in tumor progression and drug-resistance of solid tumors [52]. Development of acquired antiestrogen resistance becomes a major obstacle for the effective treatment of metastatic breast cancer although there is initial drug sensitivity. High expression level of GRP78 confers multiple survival advantages to facilitate the proliferation of cancer cells through harsh conditions and to acquire chemotherapeutic resistance when subjected to drug treatment [53–57]. GRP78 can be found highly expressed in many tumor cell lines and primary tumors, such as breast and prostate cancer cells, while it is difficult to detect GRP78 expression in normal cells. In vivo studies also demonstrate a critical role of GRP78 in tumor growth, metastasis and angiogenesis in xenograft and Grp78 heterozegous mice [57]. It has been shown that GRP78 interacts with proapoptotic protein BIK and specific caspases such as caspase-7 on the ER membrane, thereby regulating the balance between cell survival and apoptosis [25,58–60]. GRP78 is commonly thought to locate inside the ER lumen because of a presumed N-terminal ER localization signal that guides its localization into the ER. GRP78 can be detected as a cell surface protein in a broad variety of tumor cells by global profiling of the cell surface genome of cancer cells, suggesting that these cells may have evolved a specific mechanism to translocate GRP78 to cell surface [53,61,62]. In the present study, we showed that GRP78 overexpression caused antiestrogen resistance in MCF7-derived LCC9 cells, which strongly suggest that GRP78 is a critical factor involved in drugresistance in breast cancer cells. Knockdown of endogenous GRP78 or overexpression of IGFBP-3 in LCC9 cells restored antiestrogen sensitivity in these cells. Further data obtained from co-IP confirmed the interaction of IGFBP-3 with GRP78. In addition,
C. Li et al. / Cancer Letters 325 (2012) 200–206
205
Fig. 5. Model of the inhibitory effect of IGFBP-3 on GRP78-induced ICI 182,780-resistsnce in breast cancer cells. IGFBP-3 interacts with GRP78 at the ER membrane and hence interferes with GRP78-caspase-7 complex, resulting in the dissociation of caspase-7 from the complex. Released caspase-7 is then activated leading the cells to apoptosis. We also speculate that IGFBP-3 binding to GRP78 would result in inhibition of other biological functions of GRP78 in breast cancer cells as indicated in the figure.
decline in cell viability induced by the introduction of IGFBP-3 into LCC9 cells was associated with the release and consequent activation of caspase-7, which was considered as the binding ligand for GRP78 in the resting stage of drug resistant breast cancer cells (Fig. 5). In summary, our findings demonstrate that GRP78 is a binding partner of IGFBP-3 and that GRP78 induces drug resistance in MCF7 leading it to antiestrogen-resistant cells such as LCC9. This novel finding enhances our understanding of the multifaceted molecular mechanisms of the IGF/IGF-1R axis-independent actions of IGFBP-3 in cancer cells. We provide the very first evidence for IGFBP-3 interaction with GRP78 and subsequent IGFBP-3’s inhibitory effect on acquired drug-resistance in cancer cells. Our finding may provide a rewarding novel anti-tumor approach for drug-resistant breast cancer cells. Acknowledgements This study was supported by Department of Defense Grant, W81XWH-09-1-0061 (to Y.O). We thank Dr. R. Clarke (Georgetown University) for providing MCF-7-derived LCC9 cells, Dr. A.S. Lee (University of Southern California) for Ad:GRP78. Amplification and titer determination of adenovirus were performed by the VCU Massey Cancer Center Biological Macromolecule Shared Resource, supported, in part, with funding from NIH-NCI Cancer Center Support Grant P30 CA016059. References [1] American Cancer Society. Breast Cancer Facts & Figures 2011–2012. Atlanta: American Cancer, Society, Inc., 2011. [2] V.C. Jordan, Antiestrogenic and antitumor properties of tamoxifen in laboratory animals, Cancer Treat. Rep. 60 (1976) 1409–1419. [3] L. Kangas, A.L. Nieminen, G. Blanco, M. Gronroos, S. Kallio, A. Karjalainen, M. Perila, M. Sodervall, R. Toivola, A new triphenylethylene compound, fc-1157a. II. Antitumor effects, Cancer Chemother. Pharmacol. 17 (1986) 109–113. [4] L. Gibson, D. Lawrence, C. Dawson, J. Bliss, Aromatase inhibitors for treatment of advanced breast cancer in postmenopausal women, Cochrane Database Syst. Rev. (4) (2009) CD003370. [5] M. Dediu, D. Median, A. Alexandru, G. Vremes, C. Gal, M. Gongu, Adjuvant therapy with aromatase inhibitors in postmenopausal, estrogen receptorpositive breast cancer patients: upfront or sequential?, J Buon. 14 (2009) 375– 379.
[6] M.G. Parker, Action of ‘‘pure’’ antiestrogens in inhibiting estrogen receptor action, Breast Cancer Res. Treat. 26 (1993) 131–137. [7] N.J. Bundred, E. Anderson, R.I. Nicholson, M. Dowsett, M. Dixon, J.F. Robertson, Fulvestrant, an estrogen receptor downregulator, reduces cell turnover index more effectively than tamoxifen, Anticancer Res. 22 (2002) 2317–2319. [8] M. Dowsett, R.I. Nicholson, R.J. Pietras, Biological characteristics of the pure antiestrogen fulvestrant: overcoming endocrine resistance, Breast Cancer Res. Treat. 93 (Suppl. 1) (2005) S11–S18. [9] S. Mohan, D.J. Baylink, IGF-binding proteins are multifunctional and act via IGF-dependent and -independent mechanisms, J. Endocrinol. 175 (2002) 19– 31. [10] V. Hwa, Y. Oh, R.G. Rosenfeld, The insulin-like growth factor-binding protein (IGFBP) superfamily, Endocr. Rev. 20 (1999) 761–787. [11] S. Jogie-Brahim, D. Feldman, Y. Oh, Unraveling insulin-like growth factor binding protein-3 actions in human disease, Endocr. Rev. 30 (2009) 417– 437. [12] H.S. Kim, A.R. Ingermann, J. Tsubaki, S.M. Twigg, G.E. Walker, Y. Oh, Insulin-like growth factor-binding protein 3 induces caspase-dependent apoptosis through a death receptor-mediated pathway in MCF-7 human breast cancer cells, Cancer Res. 64 (2004) 2229–2237. [13] Y. Oh, H.L. Muller, H. Pham, R.G. Rosenfeld, Demonstration of receptors for insulin-like growth factor binding protein-3 on Hs578T human breast cancer cells, J. Biol. Chem. 268 (1993) 26045–26048. [14] A.R. Ingermann, Y.F. Yang, J. Han, et al., Identification of a novel cell death receptor mediating IGFBP-3-induced anti-tumor effects in breast and prostate cancer, J. Biol. Chem. 285 (2010) 30233–30246. [15] S.M. Leal, Q. Liu, S.S. Huang, J.S. Huang, The type V transforming growth factor beta receptor is the putative insulin-like growth factor-binding protein 3 receptor, J. Biol. Chem. 272 (1997) 20572–20576. [16] S. Mishra, A. Raz, L.J. Murphy, Insulin-like growth factor binding protein-3 interacts with autocrine motility factor/phosphoglucose isomerase (AMF/PGI) and inhibits the AMF/PGI function, Cancer Res. 64 (2004) 2516–2522. [17] M. Ikonen, B. Liu, Y. Hashimoto, L. Ma, K.W. Lee, T. Niikura, I. Nishimoto, P. Cohen, Interaction between the alzheimer’s survival peptide humanin and insulin-like growth factor-binding protein 3 regulates cell survival and apoptosis, Proc. Nat. Acad. Sci. U.S.A. 100 (2003) 13042–13047. [18] M. Oufattole, S.W. Lin, B. Liu, D. Mascarenhas, P. Cohen, B.D. Rodgers, Ribonucleic acid polymerase II binding subunit 3 (Rpb3), a potential nuclear target of insulin-like growth factor binding protein-3, Endocrinology 147 (2006) 2138–2146. [19] C. Wu, G. Yao, M. Zou, G. Chen, M. Wang, J. Liu, J. Wang, D. Xu, Nacetylgalactosaminyltransferase 14, a novel insulin-like growth factor binding protein-3 binding partner, Biochem. Biophys. Res. Commun. 357 (2007) 360– 365. [20] K.W. Lee, L. Ma, X. Yan, B. Liu, X.K. Zhang, P. Cohen, Rapid apoptosis induction by IGFBP-3 involves an insulin-like growth factor-independent nucleomitochondrial translocation of RXRalpha/Nur77, J. Biol. Chem. 280 (2005) 16942–16948. [21] Y. Jia, K.W. Lee, R. Swerdloff, D. Hwang, L.J. Cobb, A. Sinha Hikim, Y.H. Lue, P. Cohen, C. Wang, Interaction of insulin-like growth factor-binding protein-3 and BAX in mitochondria promotes male germ cell apoptosis, J. Biol. Chem. 285 (2010) 1726–1732.
206
C. Li et al. / Cancer Letters 325 (2012) 200–206
[22] J. Han, S. Jogie-Brahim, A. Harada, Y. Oh, Insulin-like growth factor-binding protein-3 suppresses tumor growth via activation of caspase-dependent apoptosis and cross-talk with NF-kappaB signaling, Cancer Lett. 307 (2011) 200–210. [23] B.H. Yeung, B.W. Kwan, Q.Y. He, A.S. Lee, J. Liu, A.S. Wong, Glucose-regulated protein 78 as a novel effector of BRCA1 for inhibiting stress-induced apoptosis, Oncogene 27 (2008) 6782–6789. [24] N. Brunner, B. Boysen, S. Jirus, T.C. Skaar, C. Holst-Hansen, J. Lippman, T. Frandsen, M. Spang-Thomsen, S.A. Fuqua, R. Clarke, MCF7/LCC9: an antiestrogen-resistant MCF-7 variant in which acquired resistance to the steroidal antiestrogen ICI 182,780 confers an early cross-resistance to the nonsteroidal antiestrogen tamoxifen, Cancer Res. 57 (1997) 3486–3493. [25] R.K. Reddy, C. Mao, P. Baumeister, R.C. Austin, R.J. Kaufman, A.S. Lee, Endoplasmic reticulum chaperone protein GRP78 protects cells from apoptosis induced by topoisomerase inhibitors: role of ATP binding site in suppression of caspase-7 activation, J. Biol. Chem. 278 (2003) 20915–20924. [26] L. Mohanraj, Y. Oh, Targeting IGF-I, IGFBPs and IGF-I receptor system in cancer: the current and future in breast cancer therapy, Recent. Pat. Anticancer Drug Discov. 6 (2011) 166–177. [27] R.A. Jones, C.I. Campbell, E.J. Gunther, L.A. Chodosh, J.J. Petrik, R. Khokha, R.A. Moorehead, Transgenic overexpression of IGF-IR disrupts mammary ductal morphogenesis and induces tumor formation, Oncogene 26 (2007) 1636– 1644. [28] J.P. Peyrat, J. Bonneterre, R. Beuscart, J. Djiane, A. Demaille, Insulin-like growth factor 1 receptors in human breast cancer and their relation to estradiol and progesterone receptors, Cancer Res. 48 (1988) 6429–6433. [29] K.J. Cullen, D. Yee, W.S. Sly, J. Perdue, B. Hampton, M.E. Lippman, N. Rosen, Insulin-like growth factor receptor expression and function in human breast cancer, Cancer Res. 50 (1990) 48–53. [30] K.J. Cullen, A. Allison, I. Martire, M. Ellis, C. Singer, Insulin-like growth factor expression in breast cancer epithelium and stroma, Breast Cancer Res. Treat. 22 (1992) 21–29. [31] C.L. Arteaga, C.K. Osborne, Growth inhibition of human breast cancer cells in vitro with an antibody against the type I somatomedin receptor, Cancer Res. 49 (1989) 6237–6241. [32] L.J. Schedlich, L.D. Graham, Role of insulin-like growth factor binding protein-3 in breast cancer cell growth, Microsc. Res. Tech. 59 (2002) 12–22. [33] Y. Oh, H.L. Muller, L. Ng, R.G. Rosenfeld, Transforming growth factor-betainduced cell growth inhibition in human breast cancer cells is mediated through insulin-like growth factor-binding protein-3 action, J. Biol. Chem. 270 (1995) 13589–13592. [34] Z.S. Gucev, Y. Oh, K.M. Kelley, R.G. Rosenfeld, Insulin-like growth factor binding protein 3 mediates retinoic acid- and transforming growth factor beta2-induced growth inhibition in human breast cancer cells, Cancer Res. 56 (1996) 1545–1550. [35] J.L. Martin, M. Ballesteros, R.C. Baxter, Insulin-like growth factor-I (IGF-I) and transforming growth factor-beta 1 release IGF-binding protein-3 from human fibroblasts by different mechanisms, Endocrinology 131 (1992) 1703–1710. [36] J.A. Fontana, A. Burrows-Mezu, D.R. Clemmons, D. LeRoith, Retinoid modulation of insulin-like growth factor-binding proteins and inhibition of breast carcinoma proliferation, Endocrinology 128 (1991) 1115–1122. [37] M.L. Adamo, Z.M. Shao, F. Lanau, J.C. Chen, D.R. Clemmons, C.T. Roberts Jr, D. LeRoith, J.A. Fontana, Insulin-like growth factor-I (IGF-I) and retinoic acid modulation of IGF-binding proteins (IGFBPs): IGFBP-2, -3, and -4 gene expression and protein secretion in a breast cancer cell line, Endocrinology 131 (1992) 1858–1866. [38] J.L. Martin, J.A. Coverley, S.T. Pattison, R.C. Baxter, Insulin-like growth factorbinding protein-3 production by MCF-7 breast cancer cells: stimulation by retinoic acid and cyclic adenosine monophosphate and differential effects of estradiol, Endocrinology 136 (1995) 1219–1226. [39] Y. Shang, C.R. Baumrucker, M.H. Green, Signal relay by retinoic acid receptors alpha and beta in the retinoic acid-induced expression of insulin-like growth factor-binding protein-3 in breast cancer cells, J. Biol. Chem. 274 (1999) 18005–18010. [40] M.E. Yateman, D.C. Claffey, S.C. Cwyfan Hughes, V.J. Frost, J.A. Wass, J.M. Holly, Cytokines modulate the sensitivity of human fibroblasts to stimulation with insulin-like growth factor-I (IGF-I) by altering endogenous IGF-binding protein production, J. Endocrinol. 137 (1993) 151–159. [41] R.C. Olney, D.M. Wilson, M. Mohtai, P.J. Fielder, R.L. Smith, Interleukin-1 and tumor necrosis factor-alpha increase insulin-like growth factor-binding
[42]
[43]
[44]
[45]
[46]
[47]
[48]
[49]
[50]
[51] [52] [53]
[54]
[55] [56] [57] [58]
[59]
[60]
[61]
[62]
protein-3 (IGFBP-3) production and IGFBP-3 protease activity in human articular chondrocytes, J. Endocrinol. 146 (1995) 279–286. V. Besset, B. Le Magueresse-Battistoni, J. Collette, M. Benahmed, Tumor necrosis factor alpha stimulates insulin-like growth factor binding protein 3 expression in cultured porcine sertoli cells, Endocrinology 137 (1996) 296– 303. F. Rozen, J. Zhang, M. Pollak, Antiproliferative action of tumor necrosis factoralpha on MCF-7 breastcancer cells is associated with increased insulin-like growth factor binding protein-3 accumulation, Int. J. Oncol. 13 (1998) 865– 869. R. Rajah, K.W. Lee, P. Cohen, Insulin-like growth factor binding protein-3 mediates tumor necrosis factor-alpha-induced apoptosis: role of bcl-2 phosphorylation, Cell Growth Differ. 13 (2002) 163–171. K.W. Colston, C.M. Perks, S.P. Xie, J.M. Holly, Growth inhibition of both MCF-7 and Hs578T human breast cancer cell lines by vitamin D analogues is associated with increased expression of insulin-like growth factor binding protein-3, J. Mol. Endocrinol. 20 (1998) 157–162. T. Nickerson, H. Huynh, Vitamin D analogue EB1089-induced prostate regression is associated with increased gene expression of insulin-like growth factor binding proteins, J. Endocrinol. 160 (1999) 223–229. N. Bhattacharyya, K. Pechhold, H. Shahjee, G. Zappala, C. Elbi, B. Raaka, M. Wiench, J. Hong, M.M. Rechler, Nonsecreted insulin-like growth factor binding protein-3 (IGFBP-3) can induce apoptosis in human prostate cancer cells by IGF-independent mechanisms without being concentrated in the nucleus, J. Biol. Chem. 281 (2006) 24588–24601. G. Zappala, C. Elbi, J. Edwards, J. Gorenstein, M.M. Rechler, N. Bhattacharyya, Induction of apoptosis in human prostate cancer cells by insulin-like growth factor binding protein-3 does not require binding to retinoid X receptor-alpha, Endocrinology 149 (2008) 1802–1812. E. Little, M. Ramakrishnan, B. Roy, G. Gazit, A.S. Lee, The glucose-regulated proteins (GRP78 and GRP94): functions, gene regulation, and applications, Crit. Rev. Eukaryot. Gene Expr. 4 (1994) 1–18. A. Bertolotti, Y. Zhang, L.M. Hendershot, H.P. Harding, D. Ron, Dynamic interaction of BiP and ER stress transducers in the unfolded-protein response, Nat. Cell Biol. 2 (2000) 326–332. H. Malhi, R.J. Kaufman, Endoplasmic reticulum stress in liver disease, J. Hepatol. 54 (2011) 795–809. G. Jing, J.J. Wang, S.X. Zhang, ER stress and apoptosis: a new mechanism for retinal cell death, Exp. Diabetes Res. 2012 (2012) 589589. M. Gonzalez-Gronow, M.A. Selim, J. Papalas, S.V. Pizzo, GRP78: a multifunctional receptor on the cell surface, Antioxid. Redox Signal. 11 (2009) 2299–2306. D. Dong, M. Ni, J. Li, et al., Critical role of the stress chaperone GRP78/BiP in tumor proliferation, survival, and tumor angiogenesis in transgene-induced mammary tumor development, Cancer Res. 68 (2008) 498–505. A.S. Lee, The glucose-regulated proteins: stress induction and clinical applications, Trends Biochem. Sci. 26 (2001) 504–510. J. Li, A.S. Lee, Stress induction of GRP78/BiP and its role in cancer, Curr. Mol. Med. 6 (2006) 45–54. A.S. Lee, GRP78 induction in cancer: therapeutic and prognostic implications, Cancer Res. 67 (2007) 3496–3499. R.V. Rao, K. Niazi, P. Mollahan, X. Mao, D. Crippen, K.S. Poksay, S. Chen, D.E. Bredesen, Coupling endoplasmic reticulum stress to the cell-death program: a novel HSP90-independent role for the small chaperone protein p23, Cell Death Differ. 13 (2006) 415–425. Y. Fu, J. Li, A.S. Lee, GRP78/BiP inhibits endoplasmic reticulum BIK and protects human breast cancer cells against estrogen starvation-induced apoptosis, Cancer Res. 67 (2007) 3734–3740. N. Rauschert, S. Brandlein, E. Holzinger, F. Hensel, H.K. Muller-Hermelink, H.P. Vollmers, A new tumor-specific variant of GRP78 as target for antibody-based therapy, Lab. Invest. 88 (2008) 375–386. U.K. Misra, R. Deedwania, S.V. Pizzo, Activation and cross-talk between Akt, NF-kappaB, and unfolded protein response signaling in 1-LN prostate cancer cells consequent to ligation of cell surface-associated GRP78, J. Biol. Chem. 281 (2006) 13694–13707. U.K. Misra, S.V. Pizzo, Ligation of cell surface GRP78 with antibody directed against the COOH-terminal domain of GRP78 suppresses Ras/MAPK and PI 3kinase/AKT signaling while promoting caspase activation in human prostate cancer cells, Cancer Biol. Ther. 9 (2010) 142–152.