- Email: [email protected]
mTOR pathway
Biomedicine & Pharmacotherapy 116 (2019) 109034
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
IGFBPrP1 accelerates autophagy and activation of hepatic stellate cells via mutual regulation between H19 and PI3K/AKT/mTOR pathway
T
Ting-Juan Huanga, Jun-Jie Rena, Qian-Qian Zhanga,b,c, Yang-Yang Konga, Hai-Yan Zhanga,b,c, ⁎ Xiao-Hong Guoa,b,c, Hui-Qin Fana,b,c, Li-Xin Liua,b,c, a
Department of Gastroenterology and Hepatology, The First Hospital of Shanxi Medical University, Taiyuan, 030001, China Experimental Center of Science and Research, The First Hospital of Shanxi Medical University, Taiyuan, 030001, China c Key Laboratory of Cell Physiology, Department of the Ministry of Education, Shanxi Medical University, Taiyuan, 030001, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Autophagy Hepatic stellate cells Hepatic fibrosis Insulin-like growth factor binding proteinrelated protein 1 PI3K/AKT/mTOR LncRNA H19
Background: Our previous study found that insulin-like growth factor binding protein-associated protein (IGFBPrP1) drives hepatic stellate cells (HSCs) activation, and IGFBPrP1 and transforming growth factor β1 (TGFβ1) likely interact with each other to promote HSCs activation. TGFβ1 reportedly promotes autophagy and contributes to HSCs activation; however, the mechanism between IGFBPrP1 and autophagy in liver fibrogenesis is yet unknown. Moreover, long noncoding RNA (lncRNA) H19 participates in autophagy regulation and plays a crucial function in liver fibrosis. Aims: To define the relationship between IGFBPrP1 and autophagy and the role of H19 in IGFBPrP1-induced hepatic fibrosis. Methods: IGFBPrP1 and autophagy were detected in bile duct ligation (BDL)-induced hepatic fibrosis. Adenovirus-mediated IGFBPrP1 was transfected into mouse liver and JS-1 cells with or without LY294002 or rapamycin to examine the effects of IGFBPrP1 on HSCs activation and autophagy as well as the PI3K/AKT/ mTOR pathway. lncRNA H19 in liver fibrosis tissues and JS-1 cells induced by IGFBPrP1 were detected, then autophagy and HSCs activation level were detected in JS-1 cells by IGFBPrP1 with H19 overexpression or knowdown. Results: IGFBPrP1 expression and autophagy level were concomitantly increased in liver tissue with BDL-induced hepatic fibrosis. Furthermore, we found that IGFBPrP1 stimulated autophagy and HSCs activation in vivo and in vitro, and PI3K/AKT/mTOR signaling pathway was involved in the regulation of autophagy by IGFBPrP1. In addition, H19 promoted autophagy by interacting with the PI3K/AKT/mTOR pathway in IGFBPrP1-induced HSCs activation. Conclusions: IGFBPrP1 promoted autophagy and contributed to HSCs activation via mutual regulation between H19 and the PI3K/AKT/mTOR pathway.
1. Introduction The mechanism of hepatic fibrosis is the increased secretion of various inflammatory cytokines, especially transforming growth factor β1 (TGFβ1). Thus, quiescent hepatic stellate cells (HSCs) are transformed into myofibroblasts and produce extracellular matrix (ECM). HSCs activation is the central link in the development of hepatic fibrosis. Therefore, HSCs therapy is urgently required. Autophagy is an important player in hepatic fibrosis and has been reported to promote HSCs survival and activation [1]. It has been demonstrated that
autophagy releases lipids to promote liver fibrosis via HSCs activation in both mice and human tissues. Additionally, blocking autophagy in HSCs attenuated liver fibrosis in vivo [2]. Another study confirmed that HSCs autophagy and activation could be blocked by silencing Beclin1, further preventing bile duct ligation (BDL)-induced hepatic fibrosis in mice [3]. Thus, suppressing autophagy to inhibit HSCs activation has increasingly become a promising therapeutic target for liver fibrosis. We previously found that insulin-like growth factor binding proteinassociated protein (IGFBPrP1) activated HSCs and contributed to hepatic fibrosis [4]. Knockdown of IGFBPrP1 attenuated hepatic fibrosis
⁎
Corresponding author at: Department of Gastroenterology and Hepatology and Experimental Center of Science and Research, The First Hospital of Shanxi Medical University, Key Laboratory of Cell Physiology, Department of the Ministry of Education, Shanxi Medical University, NO.85 Jiefang South Road, Yingze District, Taiyuan, Shanxi, 030001, China. E-mail address: [email protected] (L.-X. Liu). https://doi.org/10.1016/j.biopha.2019.109034 Received 7 March 2019; Received in revised form 4 May 2019; Accepted 22 May 2019 0753-3322/ © 2019 Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 116 (2019) 109034
T.-J. Huang, et al.
the bile duct was isolated and ligated in the BDL-operated groups while the bile duct was isolated but not ligated in the sham-operated mice. Because biliary fibrosis was induced after approximately 6 weeks in the pre-experiment, the mice were sacrificed at 2, 4, or 6 weeks and liver tissues were harvested and stored in formalin and liquid nitrogen. For the other animal model, mice were transfected with AdIGFBPrP1 into liver tissue via the tail vein; the recombinant adenoviral vector encoding IGFBPrP1 was synthesized by Sangon Biotech (Shanghai). Concurrently, LY294002 (4 mg/kg, Sigma) and rapamycin (2 mg/kg, Beijing Solarbio) were intraperitoneally injected for one month. Both doses were determined by pre-experimental results. The mice were sacrificed at 1, 2, 4, 8, and 12 weeks (n = 8), and liver tissues were harvested.
[5]. Furthermore, IGFBPrP1 and TGFβ1 likely interact with each other to accelerate liver fibrosis progression [6]. TGFβ1 reportedly significantly promotes autophagy, affecting HSCs activation, which can be decreased by inhibiting autophagy [7]. However, the mechanism between IGFBPrP1 and autophagy in liver fibrogenesis is yet unknown. Autophagy is a self-digestion process aimed at damaged organelles and misfolded proteins in cells. Autophagy occurs less under normal conditions, and increases under conditions of starvation, infection, tumour, and stimulation. Microtubule-associated protein 1 light chain 3B (LC3B) is recognized as an autophagic marker protein. When autophagy occurs, LC3B I is converted to LC3B II, which is essential for autophagosome formation. Beclin1 is an autophagy-promoting protein that regulates autophagosome-lysosome fusion. p62, also known as SQSTM1, is to aggregate and clear ubiquitinated proteins [8]. The regulation of autophagy is complicated, with several pathways being linked to it. The PI3K/Akt/mTOR signalling pathway is the main pathway and plays a crucial role in cell autophagy [9]. In mammalian cells, the PI3K/AKT/mTOR pathway is a classic negative regulatory pathway for autophagy when cells are exposed to certain conditions, such as starvation, infection [10]. The long noncoding RNA (lncRNA) H19 is one of the earliest discovered lncRNAs,which participates in autophagy regulation since evidence has demonstrated that mTOR and Beclin1 were positively regulated by H19 [11]. H19 expression is repressed in adult liver but is markedly increased in fibrotic human and mouse liver [12].Furthermore, H19 can obviously exacerbate the development of obstructive cholestatic liver fibrosis [13].Moreover, H19 promotes autophagy and is associated with PI3K/AKT/mTOR pathway [14,15].Thus, we speculated that H19 was associated with IGFBPrP1induced HSCs activation and the development of liver fibrosis. The mechanism of hepatic fibrosis is HSCs activation. Autophagy is necessary for HSCs activation, and TGFβ1 has been shown to promote HSCs autophagy and activation to aggravate hepatic fibrosis. Considering the interaction between IGFBPrP1 and TGFβ1 in promoting HSCs activation, we speculated that autophagy was involved in HSCs activation by IGFBPrP1, and the precise mechanism between H19 and autophagy was explored. BDL is a common experimental model in research that induces a strong fibrotic response after 21 to –28 days [16]. This model is close to cholestatic liver fibrosis in humans and has several advantages such as short cycle, high stability, non-toxic, and unlikely to spontaneously reverse. In this study, we first employed the mouse BDL model to determine whether the level of IGFBPrP1 and autophagy is regulated in liver fibrosis. If yes, to explore whether IGFBPrP1 participates in autophagy regulation and whether the PI3K/AKT/mTOR pathway is involved in the autophagic process, we evaluated IGFBPrP1 overexpression in vivo and in vitro. For the in vitro experiments, JS-1 cell lines were selected because they are immortalized HSCs lines of mice. Adenovirus-mediated IGFBPrP1 (AdIGFBPrP1) was transfected into mouse liver tissue and JS-1 cells; meanwhile, the autophagy and signalling pathways interfered. H19 was tested in all groups to define its role; then, H19 overexpression or knockdown in vitro was evaluated to elucidate the relationship between H19 and autophagy in HSCs activation induced by IGFBPrP1. Finally, LY294002 and rapamycin were administered based on H19 overexpression to investigate the effect of H19 on HSCs activation.
2.2. Cell culture and treatment JS-1 cells were cultured in DMEM with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin at 37 °C in an incubator with 5% CO2. AdIGFBPrP1 was transfected into JS-1 cells; then, protein or RNA was extracted at 6, 12, 24, 48, and 72 h. LY294002 (10,20,25 μmol/L) and rapamycin (100 nmol/L) (per recommended concentrations in the previous publication) were administered for 24 h. IGFBPrP1 siRNA (Sangon) was transfected into JS-1 cells for 6 h, and cells were cultured for 48 h. the culture medium was changed to serum-free DMEM at the last 4 h. To study the role of H19 in IGFBPrP1-induced liver fibrosis through autophagy, plasmid-transfected H19 and H19 siRNA (Sangon) were constructed. LipoFiter 3.0™ (Hanbio) was used as the transfection reagent. H19 or H19 siRNAs were transfected into JS-1 cells 6 h later, AdIGFBPrP1 was transfected. LY294002 and rapamycin were added 24 h before the cells were collected. Each group in vitro was performed in triplicate. This resulted in 3 replicates used in this study.
2.3. Sirius red staining All paraffin-embedded liver tissues were cut into 4 μm thick sections.After dewaxing, the liver tissues were stained with 2% Brilliant Green (Solarbio) for 15 min, washed with distilled water, and then stained with 0.1% saturated picric acid-sirius red solution (Solarbio) for 20 min, and finally washed with distilled water. The red-stained collagen fibres represented the positive area and were quantified by the percentage per total liver section.
2.4. Immunohistochemistry staining With xylene to dewax, alcohol to hydrate, and 3% hydrogen peroxide to block endogenous peroxidase activity for 15 min, antigen was retrieved in boiled sodium citrate buffer (OriGene) for 2 min. The sections were incubated with anti-α-SMA(Abcam), anti-collagen I(Abcam), anti-LC3B(Abcam), anti-p62(Abcam), and anti-Beclin1(Abcam)for 1 h at 37 °C. Afterwards, specimens were washed and incubated with biotinylated secondary antibody for 30 min at room temperature. Finally, staining was detected using DAB (Beyotime).
2. Materials and methods
2.5. Western blotting
2.1. Animal models
Equal amounts of protein were separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis on a polyacrylamide gel and transferred to polyvinylidene difluoride membranes (Bio-Rad). The membranes were incubated with primary antibodies for α-SMA, collagen I, LC3B, p62, Beclin1, AKT(Abcam), mTOR(Abcam), and β-actin (Abcam)at 4 °C overnight. The next day, the membranes were incubated with secondary antibodies for 1 h. Proteins were detected by enhanced chemiluminescence (ECL;Bio-Rad).
The experiments were carried out only after the male C57BL/6 mice adapted to their new environment and grew to approximately 20 g. Mice were used according to protocols approved by the Institutional Animal Care and Use Committee. Two liver fibrosis models were required. The first was BDL mice that were sham- or BDL-operated (n = 10). After the mice were anaesthetized with 4% chloral hydrate, 2
Biomedicine & Pharmacotherapy 116 (2019) 109034
T.-J. Huang, et al.
2.7. Transmission electron microscopy
Table 1 Primer sequences for qRT-PCR". Gene
Forward primer (5'-3')
Reverse primer (5'-3')
GAPDH LC3B α-SMA PI3K AKT mTOR H19
GGTTGTCTCCTGCGACTTCA GATAGCTGCTGGCACTTGGG CTCCATCGTCCACCGCAAAT TTGACAGTAGGAGGAGGTTGGA GCTGGAGGACAACGACTACG TTCAGCCCTTCTTTGACAACA GCCTGAGCTAGGGTTGGAGA
TGGTCCAGGGTTTCTTACTCC CCAGGATGAGGACCTGCTGA GGCCAGGGCTACAAGTTAAGG TGCGTCAGCCACATCAAGTAT CTTCTCGTGGTCCTGGTTGTA CGATCATCTCGATTCATACCCT TTCCCAGCAGCTCCCCTTTA
The liver tissues were extracted and fixed with an aldehyde fixative solution (2% glutaraldehyde) for 2 h. After washing with sodium arsophenate for several hours, the tissue was fixed with 1% osmic acid for more than 2 h. Using a gradient of acetone for dehydration at 5–15 min per stage, and the mixture of acetone and embedding agent was soaked at room temperature for 2–4 h. The epoxy resin was embedded for 24 h at 40 °C and polymerized for 48 h at 60 °C. Ultrathin slices were obtained with an ultramicrotome (LKB), placed in uranium acetate and lead citrate dye for 15–30 min, transmission electron microscopy was performed.
2.6. RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR)
2.8. Fluorescent in situ hybridization (FISH) Total mRNA was extracted from liver tissues and cells using TriZol solution (QIAGEN) per the manufacturer's instructions. Total RNA concentration was measured by a spectrophotometer and 1 μg of total RNA was reverse-transcribed using a cDNA Reverse Transcription Kit (QIAGEN). Quantitative primers were designed based on the gene sequences by Sangon Biotech. Quantitative real-time PCR was performed on a StepOne™ PCR System (ABI) in 20 μl reactions using the miScript SYBR Green PCR Kit (QIAGEN). GAPDH was used as the reference gene. The target gene primer sequences are provided in Table 1.
The H19 RNA probes labelled with FAM or TAMRA and kits were purchased from Sangon Biological Technology Company (Shanghai, China). After treatment with AdIGFBPrP1, the JS-1 cells were fixed with 4% polyformaldehyde at room temperature for 10 min and washed with PBS three times for 5 min each time, followed by permeabilization in permeable solution for 5 min. Hybridization was done overnight at 37 °C. The nucleus was stained with DAPI (Beyotime, Shanghai, China) and the fluorescence signals were observed and captured using an BX63 epifluorescence microscope equipped with a Photometric SenSys DP70 CCD camera (Olympus, Tokyo). Raw images were processed using
Fig. 1. IGFBPrP1 and autophagy were enhanced in liver tissue with BDL-induced hepatic fibrosis. (A) H&E was performed to evaluate the establishment of hepatic fibrosis model (original magnification × 200); (B) IGFBPrP1, LC3B, p62 and Beclin1 were semiquantitative detected by immunohistochemical staining (original magnification × 400); (C, D) Correlation between the expression of IGFBPrP1 and LC3B, p62, Beclin1 at different time points; (E) Protein expression of IGFBPrP1, LC3B, p62 and Beclin1 detected with western blotting. Data are presented as the mean ± SD (n = 10). ★★P < 0.01, ▲▲P < 0.01, ##P < 0.01 versus control. 3
Biomedicine & Pharmacotherapy 116 (2019) 109034
T.-J. Huang, et al.
Fig. 2. IGFBPrP1 stimulated autophagy in mouse liver and JS-1 cells. (A, B) Sirius red staining (original magnification × 200) and the detection of ALT and AST by ELISA were performed to assess hepatic fibrosis model. (C) IGFBPrP1, LC3B, p62, and Beclin1 were semiquantitative detected by immunohistochemisty in IGFBPrP1induced liver tissue. (D, E) Protein expression of IGFBPrP1, LC3B, p62, Beclin1, α-SMA, and collagen I detected with western blotting in mouse livers and JS-1 cells transfected with IGFBPrP1. (F) Protein expression of LC3B, p62, Beclin1, α-SMA, and collagen I with western blotting in JS-1 cells transfected with siRNA-IGFBPrP1. Data are presented as the mean ± SD (n = 8 in vivo, n = 3 in vitro). ★★P ＜ 0.01, ##P < 0.01 versus control. △△P ＜ 0.01, ▲▲P ＜ 0.01 versus AdIGFBPrP1 1 w and AdIGFBPrP1 48 h (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).
values) were calculated, with P < 0.05 considered statistically significant.
Photoshop V.7.0 (Adobe Systems Incorporated, San Jose, CA). 2.9. Statistical analysis All data were expressed as the median (range) unless otherwise indicated, and all calculations were performed using SPSS 23.0 statistical software. Statistical significance was evaluated using the MannWhitney U test. In addition, the Spearman correlation coefficients (r 4
Biomedicine & Pharmacotherapy 116 (2019) 109034
T.-J. Huang, et al.
Fig. 3. IGFBPrP1 promoted HSCs activation via autophagy in mouse liver and JS-1 cells. (A, B, C, D) Protein expression of α-SMA, collagen I, LC3B, p62, and Beclin1 with western blotting in mouse livers and JS-1 cells transfected by AdIGFBPrP1 with autophagy inhibitor LY294002 and autophagy enhancer rapamycin injected. (E) Transmission electron microscopy was performed to assess autophagosome (original magnification × 1 μm). (F, H) mRNA expression of α-SMA and LC3B detected with qRT-PCR in mouse livers and JS-1 cells transfected by AdIGFBPrP1 with autophagy inhibitor LY294002 and autophagy enhancer rapamycin injected. Data are presented as the mean ± SD (n = 8 in vivo, n = 3 in vitro). ★★P ＜ 0.01, ##P < 0.01 versus control. △△P ＜ 0.01, ▲▲P ＜ 0.01 versus AdIGFBPrP1.
3. Results
3.3. IGFBPrP1 promoted HSCs activation via autophagy in mouse liver and JS-1 cells
3.1. IGFBPrP1 and autophagy level were enhanced in liver tissue with BDLinduced hepatic fibrosis
IGFBPrP1-induced autophagy was inhibited by LY294002 and promoted by rapamycin in vivo and in vitro. The transmission electron microscope showed that rapamycin increased the formation of the autophagic lysosomes induced by IGFBPrP1 while LY294002 decreased that (Fig. 3E). LY294002 inhibited IGFBPrP1-induced increase in the protein levels of α-SMA and collagen I (Fig. 3A, C). In contrast, rapamycin significantly exacerbated their increases (Fig. 3B, D). qRT-PCR showed that mRNA levels of α-SMA and LC3B were decreased by LY294002 and increased by rapamycin (Fig. 3F, H), consistent with the western blot results. All results suggested that IGFBPrP1 induced autophagy to promote HSCs activation in vivo and in vitro.
To investigate whether there is a relationship between IGFBPrP1 and autophagy, both were detected in BDL-induced hepatic fibrotic tissue. As shown in Fig. 1A, H&E staining of the livers from BDL treated mice showed increased in centrilobular necrosis, hydropic degeneration, and dilation of the bile duct, proliferation of small bile ducts, as well as infiltration of inflammatory cells in the portal area and around the bile duct. Western blotting showed that IGFBPrP1 expression significantly increased (Fig. 1E), and the ratio of LC3B II/LC3B I and Beclin1 in the BDL group were gradually up-regulated while p62 decreased (Fig. 1E), which was consistent with immunohistochemical staining (Fig. 1B–D). Both α-SMA and collagen I participate in the synthesis of ECM and were significantly increased in a time-dependent manner in BDL group (Fig. 1E).
3.4. PI3K/AKT/mTOR signalling pathway was involved in the regulation of autophagy by IGFBPrP1 Here,we determined whether the PI3K/AKT/mTOR signalling pathway participated in autophagy regulation. As shown in Fig. 4A, B, p-AKT/AKT and p-mTOR/mTOR displayed a lower level in AdIGFBPrP1 group than in the control group. Following LY294002 and rapamycin treatment, the degree of decrease was more pronounced. The in vitro experiment showed the same results (Fig. 4C, D). These results indicated that IGFBPrP1 promoted autophagy via PI3K/AKT/mTOR pathway.
3.2. IGFBPrP1 stimulated autophagy in mouse liver and JS-1 cells To understand whether IGFBPrP1 induced HSCs autophagy, AdIGFBPrP1 was transfected into mouse liver and JS-1 HSCs. Sirius red staining showed increased collagen fibrils (Fig. 2A). Western blot showed the ratio of LC3B II/LC3B I and Beclin1 expression was upregulated, while p62 was down-regulated in the AdIGFBPrP1 group, suggesting that autophagy was enhanced by IGFBPrP1 (Fig. 2D, E). Immunohistochemical staining showed the same result (Fig. 2C). IGFBPrP1 stimulated autophagy to a maximum level at 1 week in vivo experiment, while autophagy peaked at 48 h in vitro study. When siRNA-IGFBPrP1 infection, the ratio of LC3B II/LC3B I and the expression levels of the Beclin1 protein were decreased and p62 increased, compared with levels in the siRNA-NC group (Fig. 2F).
3.5. lncRNA H19 promoted autophagy by interacting with the PI3K/AKT/ mTOR pathway The in vivo and in vitro results showed H19 was up-regulated in AdIGFBPrP1 group (Fig. 5A, B). The in situ hybridization showed that H19 is localized in JS-1 cells cytoplasm (Fig. 5C). The expression increase of H19 could be inhibited by LY294002 and strengthened by 5
Biomedicine & Pharmacotherapy 116 (2019) 109034
T.-J. Huang, et al.
Fig. 4. PI3K/AKT/mTOR pathway was involved in the regulation of autophagy induced by IGFBPrP. (A, B, C, D) Protein expression of p-AKT, AKT, p-mTOR, and mTOR with western blotting in mouse livers (A, B) and in JS-1 cells (C, D). Data are presented as the mean ± SD (n = 8 in vivo, n = 3 in vitro). ★★ P ＜ 0.01 versus control. △△P ＜ 0.01, ▲▲P ＜ 0.01 versus AdIGFBPrP1.
2, 4, and 6 weeks. LC3B and Beclin1 were increased while p62 was decreased in BDL-operated mice, consistent with previous reports that autophagy level increased with BDL [17]. Correlation analysis showed that IGFBPrP1 and autophagy increased concomitantly with each other, indicating that the increase in autophagy might be correlated with IGFBPrP1. Adenovirus has long been used as a popular viral vector for gene transfection due to its ability to affect both dividing and non-dividing cells without integrating into the host cell genome [18]. Adenovirus not only has high efficiency but can also infect cells both in vivo and in vitro [19]. To understand the effect of IGFBPrP1 on autophagy, AdIGFBPrP1 was transfected into mice livers and JS-1 cells and siRNA-IGFBPrP1 was transfected into JS-1 cells. The results showed that α-SMA and collagen I were increased by AdIGFBPrP1 and decreased by siRNA-IGFBPrP1, indicating that IGFBPrP1 overexpression induced while IGFBPrP1 knockdown attenuated HSCs activation, consistent with our previous findings [4–6]. It is reported that activated autophagy served energy for activation of HSCs by degrading lipid droplets [1]. Our results indicated that autophagy level was increased along with HSCs activation and the development of hepatic fibrosis induced by IGFBPrP1, which was characterized by the increased ratio of LC3B II/LC3B I and increased expression of Beclin1 as well as decreased expression of p62 at all time points, no matter in vivo or in vitro. As was expected, knockdown of IGFBPrP1 reduced autophagy. Simultaneously, the in vivo data revealed that autophagy significantly increased at week 1 and decreased at
rapamycin, indicating that as a downstream site, H19 was regulated by PI3K/AKT/mTOR pathway in IGFBPrP1-induced HSCs activation. To define whether H19 has an effect on autophagy, H19 was overexpressed or knocked-down in IGFBPrP1-transfected JS-1 cells. Western blotting showed that H19 overexpression significantly increased LC3B II/LC3B I, Beclin1, α-SMA, collagen I, and decreased p62. When H19 was knocked down, the trend was the opposite (Fig. 5D, E). Next, to elucidate the specific mechanism of H19 in autophagy, cells were treated with both LY294002 and rapamycin along with H19 overexpression. Western blots showed that LY294002 significantly inhibited α-SMA and collagen I protein expression increased by H19, while rapamycin caused the opposite changes (Fig. 5F). All the above demonstrated that H19 promoted HSCs activation by autophagy. Additionally, compared to the AdIGFBPrP1 group, p-AKT and p-mTOR were distinctly decreased by H19; their levels were further decreased by LY294002 and rapamycin (Fig. 5F). These results indicated that H19 promoted IGFBPrP1-induced autophagy to activate HSCs through the PI3K/AKT/mTOR pathway. 4. Discussion The hepatic fibrosis model was induced through BDL. α-SMA and collagen I protein expression in BDL showed a marked increase during fibrogenesis, indicating that the hepatic fibrosis model was established successfully. Then we found that IGFBPrP1 levels gradually increased at 6
Biomedicine & Pharmacotherapy 116 (2019) 109034
T.-J. Huang, et al.
Fig. 5. H19 promoted autophagy by interacting with PI3K/AKT/mTOR pathway. (A, B) mRNA expression of H19 detected with qRT-PCR in mouse livers (A) and JS-1 cells (B) transfected by IGFBPrP1 with LY294002 and rapamycin treated. ★★P < 0.01 versus control; △△P < 0.01▲▲P < 0.01 versus AdIGFBPrP1. (C) Detection of H19 transcripts in JS-1 cells by FISH (×10 μm). (D, E) Protein expression of α-SMA, collagen I, LC3B, p62, Beclin1 with western blotting in JS-1 cells transfected by IGFBPrP1 with H19 overexpression or knockdown. ★★P < 0.01, ##P < 0.01 versus Control; △△P < 0.01, ▲▲P < 0.01 versus AdIGFBPrP1. (F) Protein expression of α-SMA, collagen I, LC3B, p62, Beclin1, p-AKT/AKT and p-mTOR/mTOR with western blotting in JS-1 cells transfected by IGFBPrP1 and H19 with LY294002 and rapamycin treated. ★★P < 0.01, ##P < 0.01 versus AdIGFBPrP1; △△P < 0.01, ▲▲P < 0.01 versus AdIGFBPrP1 + H19. Data are presented as the mean ± SD (n = 8 in vivo, n = 3 in vitro).
IGFBPrP1 promotes HSCs autophagy and activation, resulting in liver fibrosis. Numerous studies have demonstrated that the PI3K/AKT/mTOR pathway is involved in HSCs activation and ECM synthesis in the progression of liver fibrosis [24]. A study found that spironolactone promotes autophagy via inhibiting PI3K/AKT/mTOR signalling pathway [25]. Comparable results were observed in our experiment, p-AKT and p-mTOR protein levels were inhibited by IGFBPrP1, indicating that IGFBPrP1 promoted HSCs autophagy and activation via inhibiting PI3K/AKT/mTOR pathway. LY294002 can effectively inhibit the synthesis of class I/III PI3K. Furthermore, class I PI3K plays an important role in inhibiting autophagy while class III PI3K initiates autophagy [26]. Our datas showed that compared with AdIGFBPrP1 group, p-AKT and p-mTOR protein levels were further inhibited by LY294002 and rapamycin. The mechanism might be that LY294002 inhibited class III PI3K to block autophagy, and rapamycin inhibited mTOR to promote autophagy. These results strongly indicated that IGFBPrP1 induced HSCs autophagy and activation via PI3K/AKT/
weeks 2, 4, 8, and 12, but still higher than that of the control group, while in vitro data showed that autophagy peaked at 48 h. The highest time point of autophagy was consistent with that of IGFBPrP1, which agreed with the idea that autophagy regulation is a dynamic process with a dose- and time-dependent pattern [20]. These results suggest that IGFBPrP1 stimulated autophagy. mTOR is regulated by nutrients. Under deprivation of nutrients or growth factors, mTOR signalling is inhibited, thereby inducing autophagy [21]. Rapamycin inhibits mTOR and is a typical autophagy promoter. LY294002 is a PI3K inhibitor and is often used as an autophagy inhibitor [22]. To further evaluate the relationship between IGFBPrP1 and autophagy, we used LY294002 to inhibit and rapamycin to promote autophagy induced by IGFBPrP1. The increased number of autophagosomes induced by IGFBPrP1 was reduced by LY294002 and increased by rapamycin. Simultaneously, the high expression of α-SMA and collagen I induced by IGFBPrP1 was inhibited by LY294002 but enhanced by rapamycin, consistent with a previous study that showed that inhibition of autophagy attenuated HSCs activation [23]. Consequently, 7
Biomedicine & Pharmacotherapy 116 (2019) 109034
T.-J. Huang, et al.
mTOR pathway inhibition. H19 is drastically induced in human liver specimens from patients with fibrosis and cirrhosis [12]. Our results showed that H19 was upregulated in IGFBPrP1-induced hepatic fibrosis. A previous publication linked H19 expression to the PI3K/AKT pathway in response to TGFβ1 treatment [27]. Here, we found that LY294002 down-regulated the expression of H19 increased by IGFBPrP1, while the opposite occurred with rapamycin, consistent with the report showing that PI3K/AKT inhibition abolished H19 up-regulation [15]. The results indicated that as a downstream site, H19 was regulated by PI3K/AKT/mTOR pathway in IGFBPrP1-induced HSCs activation. The specific mechanism is mediated by the IGFBPrP1/PI3K/AKT/mTOR/H19/autophagy axis. Then, to investigate the effect of H19 on autophagy in IGFBPrP1induced HSCs activation, we overexpressed or knocked down H19 in IGFBPrP1-induced JS-1 cells. Accumulating studies have shown that H19 induced activation of autophagy [14,28]. Our results showed that H19 increased the autophagy level stimulated by IGFBPrP1 while decreased by H19 knockdown. Further study demonstrated that H19 overexpression exacerbates, whereas H19-deficiency ameliorates obstructive cholestatic liver fibrosis [13]. These results showed that H19 overexpression increased, while H19-deficiency reduced the IGFBPrP1induced α-SMA and collagen I expression. These data suggest that H19 promoted autophagy and contributed to IGFBPrP1-induced HSCs activation. For further mechanism, we studied the effect of H19 on the PI3K/AKT/mTOR pathway. H19 overexpression promotes autophagy via PI3K/AKT/mTOR pathways in trophoblast cells [14]. In our study, H19 overexpression inhibited the PI3K/AKT/mTOR pathway inhibited by IGFBPrP1, while LY294002 and rapamycin further enhanced the inhibition. These results provide evidence that H19 promotes HSCs activation induced by IGFBPrP1 through the PI3K/AKT/mTOR pathway and the mechanism is mediated by the IGFBPrP1/H19/PI3K/AKT/ mTOR/ autophagy axis. Our study demonstrated that IGFBPrP1 promoted HSCs activation in vivo and in vitro by autophagy. Importantly, the PI3K/AKT/mTOR signalling pathway was involved in the regulation of autophagy. Further, we found that lncRNA H19 was highly expressed by IGFBPrP1. Finally, H19 was identified to contribute to IGFBPrP1-induced HSCs activation through the mutual regulation with the PI3K/AKT/mTOR pathway to promote autophagy. Our research is a preliminary study that might provide new insights into the prevention and treatment of liver fibrosis.
[4]
[5]
[6]
[7]
[8] [9]
[10] [11] [12]
[13]
[14]
[15]
[16]
[17]
[18] [19] [20]
[21]
Conflicts of interest
[22]
The authors declare that they have no conflict of interest. [23]
Acknowledgement [24]
This study was supported by grants from National Natural Science Foundation of China (81670559) and Key Research and Development Program of Shanxi Province (201603D421023).
[25]
References
[26] [27]
[1] L.F. Thoen, E.L. Guimaraes, L. Dolle, I. Mannaerts, M. Najimi, E. Sokal, L.A. van Grunsven, A role for autophagy during hepatic stellate cell activation, J. Hepatol. 55 (2011) 1353–1360. [2] V. Hernandez-Gea, Z. Ghiassi-Nejad, R. Rozenfeld, R. Gordon, M.I. Fiel, Z. Yue, M.J. Czaja, S.L. Friedman, Autophagy releases lipid that promotes fibrogenesis by activated hepatic stellate cells in mice and in human tissues, Gastroenterology 142 (2012) 938–946. [3] J. Chen, Y. Yu, S. Li, Y. Liu, S. Zhou, S. Cao, J. Yin, G. Li, MicroRNA‐30a ameliorates
[28]
8
hepatic fibrosis by inhibiting Beclin1‐mediated autophagy, J. Cell. Mol. Med. 21 (2017) 3679–3692. Y. Guo, Y. Zhang, Q. Zhang, X. Guo, H. Zhang, G. Zheng, L. Liu, Insulin-like growth factor binding protein-related protein 1 (IGFBPrP1) contributes to liver inflammation and fibrosis via activation of the ERK1/2 pathway, Hepatol. Int. 9 (2015) 130–141. J.J. Ren, T.J. Huang, Q.Q. Zhang, H.Y. Zhang, X.H. Guo, H.Q. Fan, R.K. Li, L.X. Liu, Insulin-like growth factor binding protein related protein 1 knockdown attenuates hepatic fibrosis via the regulation of MMPs/TIMPs in mice, HBPD INT 18 (2019) 38–47. X.Q. Li, Q.Q. Zhang, H.Y. Zhang, X.H. Guo, H.Q. Fan, L.X. Liu, Interaction between insulin-like growth factor binding protein-related protein 1 and transforming growth factor beta 1 in primary hepatic stellate cells, HBPD INT 16 (2017) 395–404. M. Lin, Y. Chang, F. Xie, Y. Shi, L. Pang, D. Chen, ASPP2 inhibits the profibrotic effects of transforming growth Factor-beta1 in hepatic stellate cells by reducing autophagy, Dig. Dis. Sci. 63 (2018) 146–154. T.P. Yao, The role of ubiquitin in autophagy-dependent protein aggregate processing, Genes Cancer 1 (2010) 779–786. J. Yang, C. Pi, G. Wang, Inhibition of PI3K/Akt/mTOR pathway by apigenin induces apoptosis and autophagy in hepatocellular carcinoma cells, Biomed. Pharmacother. 103 (2018) 699–707. J. Everse, P.W. Coates, Neurodegeneration and peroxidases, Neurobiol. Aging 30 (2009) 1011–1025. L. Yang, H. Wang, Q. Shen, L. Feng, H. Jin, Long non-coding RNAs involved in autophagy regulation, Cell Death Dis. 8 (2017) e3073. Y. Zhang, C. Liu, O. Barbier, R. Smalling, H. Tsuchiya, S. Lee, D. Delker, A. Zou, C.H. Hagedorn, L. Wang, Bcl2 is a critical regulator of bile acid homeostasis by dictating Shp and lncRNA H19 function, Sci. Rep. 6 (2016) 20559. Y. Song, C. Liu, X. Liu, J. Trottier, M. Beaudoin, L. Zhang, C. Pope, G. Peng, O. Barbier, X. Zhong, L. Li, L. Wang, H19 promotes cholestatic liver fibrosis by preventing ZEB1-mediated inhibition of epithelial cell adhesion molecule, Hepatology 66 (2017) 1183–1196. J. Xu, Y. Xia, H. Zhang, H. Guo, K. Feng, C. Zhang, Overexpression of long noncoding RNA H19 promotes invasion and autophagy via the PI3K/AKT/mTOR pathways in trophoblast cells, Biomed. Pharmacother. 101 (2018) 691–697. W. Yang, X. Li, S. Qi, X. Li, K. Zhou, S. Qing, Y. Zhang, M.Q. Gao, lncRNA H19 is involved in TGF-beta1-induced epithelial to mesenchymal transition in bovine epithelial cells through PI3K/AKT signaling Pathway, PeerJ 5 (2017) e3950. C.G. Tag, S. Sauer-Lehnen, S. Weiskirchen, E. Borkham-Kamphorst, R.H. Tolba, F. Tacke, R. Weiskirchen, Bile duct ligation in mice: induction of inflammatory liver injury and fibrosis by obstructive cholestasis, Journal of visualized experiments: JoVE 10 (96) (2015) 52438. Y. Mao, S. Zhang, F. Yu, H. Li, C. Guo, X. Fan, Ghrelin attenuates liver fibrosis through regulation of TGF-β1 expression and autophagy, Int. J. Mol. Sci. 16 (2015) 21911–21930. H. Cao, D.R. Koehler, J. Hu, Adenoviral vectors for gene replacement therapy, Viral Immunol. 17 (2004) 327–333. R. Alba, A.H. Baker, S.A. Nicklin, Vector systems for prenatal gene therapy: principles of adenovirus design and production, Methods Mol. Biol. 891 (2012) 55–84. P. Kuang, H. Deng, H. Liu, H. Cui, J. Fang, Z. Zuo, J. Deng, Y. Li, X. Wang, L. Zhao, Sodium fluoride induces splenocyte autophagy via the mammalian targets of rapamycin (mTOR) signaling pathway in growing mice, Aging 10 (2018) 1649–1665. E. Jacinto, M.N. Hall, Tor signalling in bugs, brain and brawn, nature reviews, Molecular cell biology 4 (2003) 117–126. Y. Wang, J.L. Wang, H.C. Ma, Z.T. Tang, H.R. Ding, X.L. Shi, Mesenchymal stem cells increase heme oxygenase 1-activated autophagy in treatment of acute liver failure, Biochem. Biophys. Res. Commun. 508 (2019) 682–689. Y. Wang, Y. Sun, L. Zuo, Y. Wang, Y. Huang, ASIC1a promotes high glucose and PDGF-induced hepatic stellate cell activation by inducing autophagy through CaMKKbeta/ERK signaling pathway, Toxicol. Lett. 300 (2019) 1–9. L. Wei, Q. Chen, A. Guo, J. Fan, R. Wang, H. Zhang, Asiatic acid attenuates CCl4induced liver fibrosis in rats by regulating the PI3K/AKT/mTOR and Bcl-2/Bax signaling pathways, Int. Immunopharmacol. 60 (2018) 1–8. D. Li, Z. Lu, Z. Xu, J. Ji, Z. Zheng, S. Lin, T. Yan, Spironolactone promotes autophagy via inhibiting PI3K/AKT/mTOR signalling pathway and reduce adhesive capacity damage in podocytes under mechanical stress, Biosci. Rep. 36 (2016). C. Burman, N.T. Ktistakis, Regulation of autophagy by phosphatidylinositol 3phosphate, FEBS Lett. 584 (2010) 1302–1312. I.J. Matouk, E. Raveh, R. Abu-lail, S. Mezan, M. Gilon, E. Gershtain, T. Birman, J. Gallula, T. Schneider, M. Barkali, C. Richler, Y. Fellig, V. Sorin, A. Hubert, A. Hochberg, A. Czerniak, Oncofetal H19 RNA promotes tumor metastasis, Biochim. Biophys. Acta 1843 (2014) 1414–1426. J. Wang, B. Cao, D. Han, M. Sun, J. Feng, Long non-coding RNA H19 induces cerebral ischemia reperfusion injury via activation of autophagy, Aging Dis. 8 (2017) 71–84.
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
IGFBPrP1 accelerates autophagy and activation of hepatic stellate cells via mutual regulation between H19 and PI3K/AKT/mTOR pathway
T
Ting-Juan Huanga, Jun-Jie Rena, Qian-Qian Zhanga,b,c, Yang-Yang Konga, Hai-Yan Zhanga,b,c, ⁎ Xiao-Hong Guoa,b,c, Hui-Qin Fana,b,c, Li-Xin Liua,b,c, a
Department of Gastroenterology and Hepatology, The First Hospital of Shanxi Medical University, Taiyuan, 030001, China Experimental Center of Science and Research, The First Hospital of Shanxi Medical University, Taiyuan, 030001, China c Key Laboratory of Cell Physiology, Department of the Ministry of Education, Shanxi Medical University, Taiyuan, 030001, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Autophagy Hepatic stellate cells Hepatic fibrosis Insulin-like growth factor binding proteinrelated protein 1 PI3K/AKT/mTOR LncRNA H19
Background: Our previous study found that insulin-like growth factor binding protein-associated protein (IGFBPrP1) drives hepatic stellate cells (HSCs) activation, and IGFBPrP1 and transforming growth factor β1 (TGFβ1) likely interact with each other to promote HSCs activation. TGFβ1 reportedly promotes autophagy and contributes to HSCs activation; however, the mechanism between IGFBPrP1 and autophagy in liver fibrogenesis is yet unknown. Moreover, long noncoding RNA (lncRNA) H19 participates in autophagy regulation and plays a crucial function in liver fibrosis. Aims: To define the relationship between IGFBPrP1 and autophagy and the role of H19 in IGFBPrP1-induced hepatic fibrosis. Methods: IGFBPrP1 and autophagy were detected in bile duct ligation (BDL)-induced hepatic fibrosis. Adenovirus-mediated IGFBPrP1 was transfected into mouse liver and JS-1 cells with or without LY294002 or rapamycin to examine the effects of IGFBPrP1 on HSCs activation and autophagy as well as the PI3K/AKT/ mTOR pathway. lncRNA H19 in liver fibrosis tissues and JS-1 cells induced by IGFBPrP1 were detected, then autophagy and HSCs activation level were detected in JS-1 cells by IGFBPrP1 with H19 overexpression or knowdown. Results: IGFBPrP1 expression and autophagy level were concomitantly increased in liver tissue with BDL-induced hepatic fibrosis. Furthermore, we found that IGFBPrP1 stimulated autophagy and HSCs activation in vivo and in vitro, and PI3K/AKT/mTOR signaling pathway was involved in the regulation of autophagy by IGFBPrP1. In addition, H19 promoted autophagy by interacting with the PI3K/AKT/mTOR pathway in IGFBPrP1-induced HSCs activation. Conclusions: IGFBPrP1 promoted autophagy and contributed to HSCs activation via mutual regulation between H19 and the PI3K/AKT/mTOR pathway.
1. Introduction The mechanism of hepatic fibrosis is the increased secretion of various inflammatory cytokines, especially transforming growth factor β1 (TGFβ1). Thus, quiescent hepatic stellate cells (HSCs) are transformed into myofibroblasts and produce extracellular matrix (ECM). HSCs activation is the central link in the development of hepatic fibrosis. Therefore, HSCs therapy is urgently required. Autophagy is an important player in hepatic fibrosis and has been reported to promote HSCs survival and activation [1]. It has been demonstrated that
autophagy releases lipids to promote liver fibrosis via HSCs activation in both mice and human tissues. Additionally, blocking autophagy in HSCs attenuated liver fibrosis in vivo [2]. Another study confirmed that HSCs autophagy and activation could be blocked by silencing Beclin1, further preventing bile duct ligation (BDL)-induced hepatic fibrosis in mice [3]. Thus, suppressing autophagy to inhibit HSCs activation has increasingly become a promising therapeutic target for liver fibrosis. We previously found that insulin-like growth factor binding proteinassociated protein (IGFBPrP1) activated HSCs and contributed to hepatic fibrosis [4]. Knockdown of IGFBPrP1 attenuated hepatic fibrosis
⁎
Corresponding author at: Department of Gastroenterology and Hepatology and Experimental Center of Science and Research, The First Hospital of Shanxi Medical University, Key Laboratory of Cell Physiology, Department of the Ministry of Education, Shanxi Medical University, NO.85 Jiefang South Road, Yingze District, Taiyuan, Shanxi, 030001, China. E-mail address: [email protected] (L.-X. Liu). https://doi.org/10.1016/j.biopha.2019.109034 Received 7 March 2019; Received in revised form 4 May 2019; Accepted 22 May 2019 0753-3322/ © 2019 Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 116 (2019) 109034
T.-J. Huang, et al.
the bile duct was isolated and ligated in the BDL-operated groups while the bile duct was isolated but not ligated in the sham-operated mice. Because biliary fibrosis was induced after approximately 6 weeks in the pre-experiment, the mice were sacrificed at 2, 4, or 6 weeks and liver tissues were harvested and stored in formalin and liquid nitrogen. For the other animal model, mice were transfected with AdIGFBPrP1 into liver tissue via the tail vein; the recombinant adenoviral vector encoding IGFBPrP1 was synthesized by Sangon Biotech (Shanghai). Concurrently, LY294002 (4 mg/kg, Sigma) and rapamycin (2 mg/kg, Beijing Solarbio) were intraperitoneally injected for one month. Both doses were determined by pre-experimental results. The mice were sacrificed at 1, 2, 4, 8, and 12 weeks (n = 8), and liver tissues were harvested.
[5]. Furthermore, IGFBPrP1 and TGFβ1 likely interact with each other to accelerate liver fibrosis progression [6]. TGFβ1 reportedly significantly promotes autophagy, affecting HSCs activation, which can be decreased by inhibiting autophagy [7]. However, the mechanism between IGFBPrP1 and autophagy in liver fibrogenesis is yet unknown. Autophagy is a self-digestion process aimed at damaged organelles and misfolded proteins in cells. Autophagy occurs less under normal conditions, and increases under conditions of starvation, infection, tumour, and stimulation. Microtubule-associated protein 1 light chain 3B (LC3B) is recognized as an autophagic marker protein. When autophagy occurs, LC3B I is converted to LC3B II, which is essential for autophagosome formation. Beclin1 is an autophagy-promoting protein that regulates autophagosome-lysosome fusion. p62, also known as SQSTM1, is to aggregate and clear ubiquitinated proteins [8]. The regulation of autophagy is complicated, with several pathways being linked to it. The PI3K/Akt/mTOR signalling pathway is the main pathway and plays a crucial role in cell autophagy [9]. In mammalian cells, the PI3K/AKT/mTOR pathway is a classic negative regulatory pathway for autophagy when cells are exposed to certain conditions, such as starvation, infection [10]. The long noncoding RNA (lncRNA) H19 is one of the earliest discovered lncRNAs,which participates in autophagy regulation since evidence has demonstrated that mTOR and Beclin1 were positively regulated by H19 [11]. H19 expression is repressed in adult liver but is markedly increased in fibrotic human and mouse liver [12].Furthermore, H19 can obviously exacerbate the development of obstructive cholestatic liver fibrosis [13].Moreover, H19 promotes autophagy and is associated with PI3K/AKT/mTOR pathway [14,15].Thus, we speculated that H19 was associated with IGFBPrP1induced HSCs activation and the development of liver fibrosis. The mechanism of hepatic fibrosis is HSCs activation. Autophagy is necessary for HSCs activation, and TGFβ1 has been shown to promote HSCs autophagy and activation to aggravate hepatic fibrosis. Considering the interaction between IGFBPrP1 and TGFβ1 in promoting HSCs activation, we speculated that autophagy was involved in HSCs activation by IGFBPrP1, and the precise mechanism between H19 and autophagy was explored. BDL is a common experimental model in research that induces a strong fibrotic response after 21 to –28 days [16]. This model is close to cholestatic liver fibrosis in humans and has several advantages such as short cycle, high stability, non-toxic, and unlikely to spontaneously reverse. In this study, we first employed the mouse BDL model to determine whether the level of IGFBPrP1 and autophagy is regulated in liver fibrosis. If yes, to explore whether IGFBPrP1 participates in autophagy regulation and whether the PI3K/AKT/mTOR pathway is involved in the autophagic process, we evaluated IGFBPrP1 overexpression in vivo and in vitro. For the in vitro experiments, JS-1 cell lines were selected because they are immortalized HSCs lines of mice. Adenovirus-mediated IGFBPrP1 (AdIGFBPrP1) was transfected into mouse liver tissue and JS-1 cells; meanwhile, the autophagy and signalling pathways interfered. H19 was tested in all groups to define its role; then, H19 overexpression or knockdown in vitro was evaluated to elucidate the relationship between H19 and autophagy in HSCs activation induced by IGFBPrP1. Finally, LY294002 and rapamycin were administered based on H19 overexpression to investigate the effect of H19 on HSCs activation.
2.2. Cell culture and treatment JS-1 cells were cultured in DMEM with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin at 37 °C in an incubator with 5% CO2. AdIGFBPrP1 was transfected into JS-1 cells; then, protein or RNA was extracted at 6, 12, 24, 48, and 72 h. LY294002 (10,20,25 μmol/L) and rapamycin (100 nmol/L) (per recommended concentrations in the previous publication) were administered for 24 h. IGFBPrP1 siRNA (Sangon) was transfected into JS-1 cells for 6 h, and cells were cultured for 48 h. the culture medium was changed to serum-free DMEM at the last 4 h. To study the role of H19 in IGFBPrP1-induced liver fibrosis through autophagy, plasmid-transfected H19 and H19 siRNA (Sangon) were constructed. LipoFiter 3.0™ (Hanbio) was used as the transfection reagent. H19 or H19 siRNAs were transfected into JS-1 cells 6 h later, AdIGFBPrP1 was transfected. LY294002 and rapamycin were added 24 h before the cells were collected. Each group in vitro was performed in triplicate. This resulted in 3 replicates used in this study.
2.3. Sirius red staining All paraffin-embedded liver tissues were cut into 4 μm thick sections.After dewaxing, the liver tissues were stained with 2% Brilliant Green (Solarbio) for 15 min, washed with distilled water, and then stained with 0.1% saturated picric acid-sirius red solution (Solarbio) for 20 min, and finally washed with distilled water. The red-stained collagen fibres represented the positive area and were quantified by the percentage per total liver section.
2.4. Immunohistochemistry staining With xylene to dewax, alcohol to hydrate, and 3% hydrogen peroxide to block endogenous peroxidase activity for 15 min, antigen was retrieved in boiled sodium citrate buffer (OriGene) for 2 min. The sections were incubated with anti-α-SMA(Abcam), anti-collagen I(Abcam), anti-LC3B(Abcam), anti-p62(Abcam), and anti-Beclin1(Abcam)for 1 h at 37 °C. Afterwards, specimens were washed and incubated with biotinylated secondary antibody for 30 min at room temperature. Finally, staining was detected using DAB (Beyotime).
2. Materials and methods
2.5. Western blotting
2.1. Animal models
Equal amounts of protein were separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis on a polyacrylamide gel and transferred to polyvinylidene difluoride membranes (Bio-Rad). The membranes were incubated with primary antibodies for α-SMA, collagen I, LC3B, p62, Beclin1, AKT(Abcam), mTOR(Abcam), and β-actin (Abcam)at 4 °C overnight. The next day, the membranes were incubated with secondary antibodies for 1 h. Proteins were detected by enhanced chemiluminescence (ECL;Bio-Rad).
The experiments were carried out only after the male C57BL/6 mice adapted to their new environment and grew to approximately 20 g. Mice were used according to protocols approved by the Institutional Animal Care and Use Committee. Two liver fibrosis models were required. The first was BDL mice that were sham- or BDL-operated (n = 10). After the mice were anaesthetized with 4% chloral hydrate, 2
Biomedicine & Pharmacotherapy 116 (2019) 109034
T.-J. Huang, et al.
2.7. Transmission electron microscopy
Table 1 Primer sequences for qRT-PCR". Gene
Forward primer (5'-3')
Reverse primer (5'-3')
GAPDH LC3B α-SMA PI3K AKT mTOR H19
GGTTGTCTCCTGCGACTTCA GATAGCTGCTGGCACTTGGG CTCCATCGTCCACCGCAAAT TTGACAGTAGGAGGAGGTTGGA GCTGGAGGACAACGACTACG TTCAGCCCTTCTTTGACAACA GCCTGAGCTAGGGTTGGAGA
TGGTCCAGGGTTTCTTACTCC CCAGGATGAGGACCTGCTGA GGCCAGGGCTACAAGTTAAGG TGCGTCAGCCACATCAAGTAT CTTCTCGTGGTCCTGGTTGTA CGATCATCTCGATTCATACCCT TTCCCAGCAGCTCCCCTTTA
The liver tissues were extracted and fixed with an aldehyde fixative solution (2% glutaraldehyde) for 2 h. After washing with sodium arsophenate for several hours, the tissue was fixed with 1% osmic acid for more than 2 h. Using a gradient of acetone for dehydration at 5–15 min per stage, and the mixture of acetone and embedding agent was soaked at room temperature for 2–4 h. The epoxy resin was embedded for 24 h at 40 °C and polymerized for 48 h at 60 °C. Ultrathin slices were obtained with an ultramicrotome (LKB), placed in uranium acetate and lead citrate dye for 15–30 min, transmission electron microscopy was performed.
2.6. RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR)
2.8. Fluorescent in situ hybridization (FISH) Total mRNA was extracted from liver tissues and cells using TriZol solution (QIAGEN) per the manufacturer's instructions. Total RNA concentration was measured by a spectrophotometer and 1 μg of total RNA was reverse-transcribed using a cDNA Reverse Transcription Kit (QIAGEN). Quantitative primers were designed based on the gene sequences by Sangon Biotech. Quantitative real-time PCR was performed on a StepOne™ PCR System (ABI) in 20 μl reactions using the miScript SYBR Green PCR Kit (QIAGEN). GAPDH was used as the reference gene. The target gene primer sequences are provided in Table 1.
The H19 RNA probes labelled with FAM or TAMRA and kits were purchased from Sangon Biological Technology Company (Shanghai, China). After treatment with AdIGFBPrP1, the JS-1 cells were fixed with 4% polyformaldehyde at room temperature for 10 min and washed with PBS three times for 5 min each time, followed by permeabilization in permeable solution for 5 min. Hybridization was done overnight at 37 °C. The nucleus was stained with DAPI (Beyotime, Shanghai, China) and the fluorescence signals were observed and captured using an BX63 epifluorescence microscope equipped with a Photometric SenSys DP70 CCD camera (Olympus, Tokyo). Raw images were processed using
Fig. 1. IGFBPrP1 and autophagy were enhanced in liver tissue with BDL-induced hepatic fibrosis. (A) H&E was performed to evaluate the establishment of hepatic fibrosis model (original magnification × 200); (B) IGFBPrP1, LC3B, p62 and Beclin1 were semiquantitative detected by immunohistochemical staining (original magnification × 400); (C, D) Correlation between the expression of IGFBPrP1 and LC3B, p62, Beclin1 at different time points; (E) Protein expression of IGFBPrP1, LC3B, p62 and Beclin1 detected with western blotting. Data are presented as the mean ± SD (n = 10). ★★P < 0.01, ▲▲P < 0.01, ##P < 0.01 versus control. 3
Biomedicine & Pharmacotherapy 116 (2019) 109034
T.-J. Huang, et al.
Fig. 2. IGFBPrP1 stimulated autophagy in mouse liver and JS-1 cells. (A, B) Sirius red staining (original magnification × 200) and the detection of ALT and AST by ELISA were performed to assess hepatic fibrosis model. (C) IGFBPrP1, LC3B, p62, and Beclin1 were semiquantitative detected by immunohistochemisty in IGFBPrP1induced liver tissue. (D, E) Protein expression of IGFBPrP1, LC3B, p62, Beclin1, α-SMA, and collagen I detected with western blotting in mouse livers and JS-1 cells transfected with IGFBPrP1. (F) Protein expression of LC3B, p62, Beclin1, α-SMA, and collagen I with western blotting in JS-1 cells transfected with siRNA-IGFBPrP1. Data are presented as the mean ± SD (n = 8 in vivo, n = 3 in vitro). ★★P ＜ 0.01, ##P < 0.01 versus control. △△P ＜ 0.01, ▲▲P ＜ 0.01 versus AdIGFBPrP1 1 w and AdIGFBPrP1 48 h (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).
values) were calculated, with P < 0.05 considered statistically significant.
Photoshop V.7.0 (Adobe Systems Incorporated, San Jose, CA). 2.9. Statistical analysis All data were expressed as the median (range) unless otherwise indicated, and all calculations were performed using SPSS 23.0 statistical software. Statistical significance was evaluated using the MannWhitney U test. In addition, the Spearman correlation coefficients (r 4
Biomedicine & Pharmacotherapy 116 (2019) 109034
T.-J. Huang, et al.
Fig. 3. IGFBPrP1 promoted HSCs activation via autophagy in mouse liver and JS-1 cells. (A, B, C, D) Protein expression of α-SMA, collagen I, LC3B, p62, and Beclin1 with western blotting in mouse livers and JS-1 cells transfected by AdIGFBPrP1 with autophagy inhibitor LY294002 and autophagy enhancer rapamycin injected. (E) Transmission electron microscopy was performed to assess autophagosome (original magnification × 1 μm). (F, H) mRNA expression of α-SMA and LC3B detected with qRT-PCR in mouse livers and JS-1 cells transfected by AdIGFBPrP1 with autophagy inhibitor LY294002 and autophagy enhancer rapamycin injected. Data are presented as the mean ± SD (n = 8 in vivo, n = 3 in vitro). ★★P ＜ 0.01, ##P < 0.01 versus control. △△P ＜ 0.01, ▲▲P ＜ 0.01 versus AdIGFBPrP1.
3. Results
3.3. IGFBPrP1 promoted HSCs activation via autophagy in mouse liver and JS-1 cells
3.1. IGFBPrP1 and autophagy level were enhanced in liver tissue with BDLinduced hepatic fibrosis
IGFBPrP1-induced autophagy was inhibited by LY294002 and promoted by rapamycin in vivo and in vitro. The transmission electron microscope showed that rapamycin increased the formation of the autophagic lysosomes induced by IGFBPrP1 while LY294002 decreased that (Fig. 3E). LY294002 inhibited IGFBPrP1-induced increase in the protein levels of α-SMA and collagen I (Fig. 3A, C). In contrast, rapamycin significantly exacerbated their increases (Fig. 3B, D). qRT-PCR showed that mRNA levels of α-SMA and LC3B were decreased by LY294002 and increased by rapamycin (Fig. 3F, H), consistent with the western blot results. All results suggested that IGFBPrP1 induced autophagy to promote HSCs activation in vivo and in vitro.
To investigate whether there is a relationship between IGFBPrP1 and autophagy, both were detected in BDL-induced hepatic fibrotic tissue. As shown in Fig. 1A, H&E staining of the livers from BDL treated mice showed increased in centrilobular necrosis, hydropic degeneration, and dilation of the bile duct, proliferation of small bile ducts, as well as infiltration of inflammatory cells in the portal area and around the bile duct. Western blotting showed that IGFBPrP1 expression significantly increased (Fig. 1E), and the ratio of LC3B II/LC3B I and Beclin1 in the BDL group were gradually up-regulated while p62 decreased (Fig. 1E), which was consistent with immunohistochemical staining (Fig. 1B–D). Both α-SMA and collagen I participate in the synthesis of ECM and were significantly increased in a time-dependent manner in BDL group (Fig. 1E).
3.4. PI3K/AKT/mTOR signalling pathway was involved in the regulation of autophagy by IGFBPrP1 Here,we determined whether the PI3K/AKT/mTOR signalling pathway participated in autophagy regulation. As shown in Fig. 4A, B, p-AKT/AKT and p-mTOR/mTOR displayed a lower level in AdIGFBPrP1 group than in the control group. Following LY294002 and rapamycin treatment, the degree of decrease was more pronounced. The in vitro experiment showed the same results (Fig. 4C, D). These results indicated that IGFBPrP1 promoted autophagy via PI3K/AKT/mTOR pathway.
3.2. IGFBPrP1 stimulated autophagy in mouse liver and JS-1 cells To understand whether IGFBPrP1 induced HSCs autophagy, AdIGFBPrP1 was transfected into mouse liver and JS-1 HSCs. Sirius red staining showed increased collagen fibrils (Fig. 2A). Western blot showed the ratio of LC3B II/LC3B I and Beclin1 expression was upregulated, while p62 was down-regulated in the AdIGFBPrP1 group, suggesting that autophagy was enhanced by IGFBPrP1 (Fig. 2D, E). Immunohistochemical staining showed the same result (Fig. 2C). IGFBPrP1 stimulated autophagy to a maximum level at 1 week in vivo experiment, while autophagy peaked at 48 h in vitro study. When siRNA-IGFBPrP1 infection, the ratio of LC3B II/LC3B I and the expression levels of the Beclin1 protein were decreased and p62 increased, compared with levels in the siRNA-NC group (Fig. 2F).
3.5. lncRNA H19 promoted autophagy by interacting with the PI3K/AKT/ mTOR pathway The in vivo and in vitro results showed H19 was up-regulated in AdIGFBPrP1 group (Fig. 5A, B). The in situ hybridization showed that H19 is localized in JS-1 cells cytoplasm (Fig. 5C). The expression increase of H19 could be inhibited by LY294002 and strengthened by 5
Biomedicine & Pharmacotherapy 116 (2019) 109034
T.-J. Huang, et al.
Fig. 4. PI3K/AKT/mTOR pathway was involved in the regulation of autophagy induced by IGFBPrP. (A, B, C, D) Protein expression of p-AKT, AKT, p-mTOR, and mTOR with western blotting in mouse livers (A, B) and in JS-1 cells (C, D). Data are presented as the mean ± SD (n = 8 in vivo, n = 3 in vitro). ★★ P ＜ 0.01 versus control. △△P ＜ 0.01, ▲▲P ＜ 0.01 versus AdIGFBPrP1.
2, 4, and 6 weeks. LC3B and Beclin1 were increased while p62 was decreased in BDL-operated mice, consistent with previous reports that autophagy level increased with BDL [17]. Correlation analysis showed that IGFBPrP1 and autophagy increased concomitantly with each other, indicating that the increase in autophagy might be correlated with IGFBPrP1. Adenovirus has long been used as a popular viral vector for gene transfection due to its ability to affect both dividing and non-dividing cells without integrating into the host cell genome [18]. Adenovirus not only has high efficiency but can also infect cells both in vivo and in vitro [19]. To understand the effect of IGFBPrP1 on autophagy, AdIGFBPrP1 was transfected into mice livers and JS-1 cells and siRNA-IGFBPrP1 was transfected into JS-1 cells. The results showed that α-SMA and collagen I were increased by AdIGFBPrP1 and decreased by siRNA-IGFBPrP1, indicating that IGFBPrP1 overexpression induced while IGFBPrP1 knockdown attenuated HSCs activation, consistent with our previous findings [4–6]. It is reported that activated autophagy served energy for activation of HSCs by degrading lipid droplets [1]. Our results indicated that autophagy level was increased along with HSCs activation and the development of hepatic fibrosis induced by IGFBPrP1, which was characterized by the increased ratio of LC3B II/LC3B I and increased expression of Beclin1 as well as decreased expression of p62 at all time points, no matter in vivo or in vitro. As was expected, knockdown of IGFBPrP1 reduced autophagy. Simultaneously, the in vivo data revealed that autophagy significantly increased at week 1 and decreased at
rapamycin, indicating that as a downstream site, H19 was regulated by PI3K/AKT/mTOR pathway in IGFBPrP1-induced HSCs activation. To define whether H19 has an effect on autophagy, H19 was overexpressed or knocked-down in IGFBPrP1-transfected JS-1 cells. Western blotting showed that H19 overexpression significantly increased LC3B II/LC3B I, Beclin1, α-SMA, collagen I, and decreased p62. When H19 was knocked down, the trend was the opposite (Fig. 5D, E). Next, to elucidate the specific mechanism of H19 in autophagy, cells were treated with both LY294002 and rapamycin along with H19 overexpression. Western blots showed that LY294002 significantly inhibited α-SMA and collagen I protein expression increased by H19, while rapamycin caused the opposite changes (Fig. 5F). All the above demonstrated that H19 promoted HSCs activation by autophagy. Additionally, compared to the AdIGFBPrP1 group, p-AKT and p-mTOR were distinctly decreased by H19; their levels were further decreased by LY294002 and rapamycin (Fig. 5F). These results indicated that H19 promoted IGFBPrP1-induced autophagy to activate HSCs through the PI3K/AKT/mTOR pathway. 4. Discussion The hepatic fibrosis model was induced through BDL. α-SMA and collagen I protein expression in BDL showed a marked increase during fibrogenesis, indicating that the hepatic fibrosis model was established successfully. Then we found that IGFBPrP1 levels gradually increased at 6
Biomedicine & Pharmacotherapy 116 (2019) 109034
T.-J. Huang, et al.
Fig. 5. H19 promoted autophagy by interacting with PI3K/AKT/mTOR pathway. (A, B) mRNA expression of H19 detected with qRT-PCR in mouse livers (A) and JS-1 cells (B) transfected by IGFBPrP1 with LY294002 and rapamycin treated. ★★P < 0.01 versus control; △△P < 0.01▲▲P < 0.01 versus AdIGFBPrP1. (C) Detection of H19 transcripts in JS-1 cells by FISH (×10 μm). (D, E) Protein expression of α-SMA, collagen I, LC3B, p62, Beclin1 with western blotting in JS-1 cells transfected by IGFBPrP1 with H19 overexpression or knockdown. ★★P < 0.01, ##P < 0.01 versus Control; △△P < 0.01, ▲▲P < 0.01 versus AdIGFBPrP1. (F) Protein expression of α-SMA, collagen I, LC3B, p62, Beclin1, p-AKT/AKT and p-mTOR/mTOR with western blotting in JS-1 cells transfected by IGFBPrP1 and H19 with LY294002 and rapamycin treated. ★★P < 0.01, ##P < 0.01 versus AdIGFBPrP1; △△P < 0.01, ▲▲P < 0.01 versus AdIGFBPrP1 + H19. Data are presented as the mean ± SD (n = 8 in vivo, n = 3 in vitro).
IGFBPrP1 promotes HSCs autophagy and activation, resulting in liver fibrosis. Numerous studies have demonstrated that the PI3K/AKT/mTOR pathway is involved in HSCs activation and ECM synthesis in the progression of liver fibrosis [24]. A study found that spironolactone promotes autophagy via inhibiting PI3K/AKT/mTOR signalling pathway [25]. Comparable results were observed in our experiment, p-AKT and p-mTOR protein levels were inhibited by IGFBPrP1, indicating that IGFBPrP1 promoted HSCs autophagy and activation via inhibiting PI3K/AKT/mTOR pathway. LY294002 can effectively inhibit the synthesis of class I/III PI3K. Furthermore, class I PI3K plays an important role in inhibiting autophagy while class III PI3K initiates autophagy [26]. Our datas showed that compared with AdIGFBPrP1 group, p-AKT and p-mTOR protein levels were further inhibited by LY294002 and rapamycin. The mechanism might be that LY294002 inhibited class III PI3K to block autophagy, and rapamycin inhibited mTOR to promote autophagy. These results strongly indicated that IGFBPrP1 induced HSCs autophagy and activation via PI3K/AKT/
weeks 2, 4, 8, and 12, but still higher than that of the control group, while in vitro data showed that autophagy peaked at 48 h. The highest time point of autophagy was consistent with that of IGFBPrP1, which agreed with the idea that autophagy regulation is a dynamic process with a dose- and time-dependent pattern [20]. These results suggest that IGFBPrP1 stimulated autophagy. mTOR is regulated by nutrients. Under deprivation of nutrients or growth factors, mTOR signalling is inhibited, thereby inducing autophagy [21]. Rapamycin inhibits mTOR and is a typical autophagy promoter. LY294002 is a PI3K inhibitor and is often used as an autophagy inhibitor [22]. To further evaluate the relationship between IGFBPrP1 and autophagy, we used LY294002 to inhibit and rapamycin to promote autophagy induced by IGFBPrP1. The increased number of autophagosomes induced by IGFBPrP1 was reduced by LY294002 and increased by rapamycin. Simultaneously, the high expression of α-SMA and collagen I induced by IGFBPrP1 was inhibited by LY294002 but enhanced by rapamycin, consistent with a previous study that showed that inhibition of autophagy attenuated HSCs activation [23]. Consequently, 7
Biomedicine & Pharmacotherapy 116 (2019) 109034
T.-J. Huang, et al.
mTOR pathway inhibition. H19 is drastically induced in human liver specimens from patients with fibrosis and cirrhosis [12]. Our results showed that H19 was upregulated in IGFBPrP1-induced hepatic fibrosis. A previous publication linked H19 expression to the PI3K/AKT pathway in response to TGFβ1 treatment [27]. Here, we found that LY294002 down-regulated the expression of H19 increased by IGFBPrP1, while the opposite occurred with rapamycin, consistent with the report showing that PI3K/AKT inhibition abolished H19 up-regulation [15]. The results indicated that as a downstream site, H19 was regulated by PI3K/AKT/mTOR pathway in IGFBPrP1-induced HSCs activation. The specific mechanism is mediated by the IGFBPrP1/PI3K/AKT/mTOR/H19/autophagy axis. Then, to investigate the effect of H19 on autophagy in IGFBPrP1induced HSCs activation, we overexpressed or knocked down H19 in IGFBPrP1-induced JS-1 cells. Accumulating studies have shown that H19 induced activation of autophagy [14,28]. Our results showed that H19 increased the autophagy level stimulated by IGFBPrP1 while decreased by H19 knockdown. Further study demonstrated that H19 overexpression exacerbates, whereas H19-deficiency ameliorates obstructive cholestatic liver fibrosis [13]. These results showed that H19 overexpression increased, while H19-deficiency reduced the IGFBPrP1induced α-SMA and collagen I expression. These data suggest that H19 promoted autophagy and contributed to IGFBPrP1-induced HSCs activation. For further mechanism, we studied the effect of H19 on the PI3K/AKT/mTOR pathway. H19 overexpression promotes autophagy via PI3K/AKT/mTOR pathways in trophoblast cells [14]. In our study, H19 overexpression inhibited the PI3K/AKT/mTOR pathway inhibited by IGFBPrP1, while LY294002 and rapamycin further enhanced the inhibition. These results provide evidence that H19 promotes HSCs activation induced by IGFBPrP1 through the PI3K/AKT/mTOR pathway and the mechanism is mediated by the IGFBPrP1/H19/PI3K/AKT/ mTOR/ autophagy axis. Our study demonstrated that IGFBPrP1 promoted HSCs activation in vivo and in vitro by autophagy. Importantly, the PI3K/AKT/mTOR signalling pathway was involved in the regulation of autophagy. Further, we found that lncRNA H19 was highly expressed by IGFBPrP1. Finally, H19 was identified to contribute to IGFBPrP1-induced HSCs activation through the mutual regulation with the PI3K/AKT/mTOR pathway to promote autophagy. Our research is a preliminary study that might provide new insights into the prevention and treatment of liver fibrosis.
[4]
[5]
[6]
[7]
[8] [9]
[10] [11] [12]
[13]
[14]
[15]
[16]
[17]
[18] [19] [20]
[21]
Conflicts of interest
[22]
The authors declare that they have no conflict of interest. [23]
Acknowledgement [24]
This study was supported by grants from National Natural Science Foundation of China (81670559) and Key Research and Development Program of Shanxi Province (201603D421023).
[25]
References
[26] [27]
[1] L.F. Thoen, E.L. Guimaraes, L. Dolle, I. Mannaerts, M. Najimi, E. Sokal, L.A. van Grunsven, A role for autophagy during hepatic stellate cell activation, J. Hepatol. 55 (2011) 1353–1360. [2] V. Hernandez-Gea, Z. Ghiassi-Nejad, R. Rozenfeld, R. Gordon, M.I. Fiel, Z. Yue, M.J. Czaja, S.L. Friedman, Autophagy releases lipid that promotes fibrogenesis by activated hepatic stellate cells in mice and in human tissues, Gastroenterology 142 (2012) 938–946. [3] J. Chen, Y. Yu, S. Li, Y. Liu, S. Zhou, S. Cao, J. Yin, G. Li, MicroRNA‐30a ameliorates
[28]
8
hepatic fibrosis by inhibiting Beclin1‐mediated autophagy, J. Cell. Mol. Med. 21 (2017) 3679–3692. Y. Guo, Y. Zhang, Q. Zhang, X. Guo, H. Zhang, G. Zheng, L. Liu, Insulin-like growth factor binding protein-related protein 1 (IGFBPrP1) contributes to liver inflammation and fibrosis via activation of the ERK1/2 pathway, Hepatol. Int. 9 (2015) 130–141. J.J. Ren, T.J. Huang, Q.Q. Zhang, H.Y. Zhang, X.H. Guo, H.Q. Fan, R.K. Li, L.X. Liu, Insulin-like growth factor binding protein related protein 1 knockdown attenuates hepatic fibrosis via the regulation of MMPs/TIMPs in mice, HBPD INT 18 (2019) 38–47. X.Q. Li, Q.Q. Zhang, H.Y. Zhang, X.H. Guo, H.Q. Fan, L.X. Liu, Interaction between insulin-like growth factor binding protein-related protein 1 and transforming growth factor beta 1 in primary hepatic stellate cells, HBPD INT 16 (2017) 395–404. M. Lin, Y. Chang, F. Xie, Y. Shi, L. Pang, D. Chen, ASPP2 inhibits the profibrotic effects of transforming growth Factor-beta1 in hepatic stellate cells by reducing autophagy, Dig. Dis. Sci. 63 (2018) 146–154. T.P. Yao, The role of ubiquitin in autophagy-dependent protein aggregate processing, Genes Cancer 1 (2010) 779–786. J. Yang, C. Pi, G. Wang, Inhibition of PI3K/Akt/mTOR pathway by apigenin induces apoptosis and autophagy in hepatocellular carcinoma cells, Biomed. Pharmacother. 103 (2018) 699–707. J. Everse, P.W. Coates, Neurodegeneration and peroxidases, Neurobiol. Aging 30 (2009) 1011–1025. L. Yang, H. Wang, Q. Shen, L. Feng, H. Jin, Long non-coding RNAs involved in autophagy regulation, Cell Death Dis. 8 (2017) e3073. Y. Zhang, C. Liu, O. Barbier, R. Smalling, H. Tsuchiya, S. Lee, D. Delker, A. Zou, C.H. Hagedorn, L. Wang, Bcl2 is a critical regulator of bile acid homeostasis by dictating Shp and lncRNA H19 function, Sci. Rep. 6 (2016) 20559. Y. Song, C. Liu, X. Liu, J. Trottier, M. Beaudoin, L. Zhang, C. Pope, G. Peng, O. Barbier, X. Zhong, L. Li, L. Wang, H19 promotes cholestatic liver fibrosis by preventing ZEB1-mediated inhibition of epithelial cell adhesion molecule, Hepatology 66 (2017) 1183–1196. J. Xu, Y. Xia, H. Zhang, H. Guo, K. Feng, C. Zhang, Overexpression of long noncoding RNA H19 promotes invasion and autophagy via the PI3K/AKT/mTOR pathways in trophoblast cells, Biomed. Pharmacother. 101 (2018) 691–697. W. Yang, X. Li, S. Qi, X. Li, K. Zhou, S. Qing, Y. Zhang, M.Q. Gao, lncRNA H19 is involved in TGF-beta1-induced epithelial to mesenchymal transition in bovine epithelial cells through PI3K/AKT signaling Pathway, PeerJ 5 (2017) e3950. C.G. Tag, S. Sauer-Lehnen, S. Weiskirchen, E. Borkham-Kamphorst, R.H. Tolba, F. Tacke, R. Weiskirchen, Bile duct ligation in mice: induction of inflammatory liver injury and fibrosis by obstructive cholestasis, Journal of visualized experiments: JoVE 10 (96) (2015) 52438. Y. Mao, S. Zhang, F. Yu, H. Li, C. Guo, X. Fan, Ghrelin attenuates liver fibrosis through regulation of TGF-β1 expression and autophagy, Int. J. Mol. Sci. 16 (2015) 21911–21930. H. Cao, D.R. Koehler, J. Hu, Adenoviral vectors for gene replacement therapy, Viral Immunol. 17 (2004) 327–333. R. Alba, A.H. Baker, S.A. Nicklin, Vector systems for prenatal gene therapy: principles of adenovirus design and production, Methods Mol. Biol. 891 (2012) 55–84. P. Kuang, H. Deng, H. Liu, H. Cui, J. Fang, Z. Zuo, J. Deng, Y. Li, X. Wang, L. Zhao, Sodium fluoride induces splenocyte autophagy via the mammalian targets of rapamycin (mTOR) signaling pathway in growing mice, Aging 10 (2018) 1649–1665. E. Jacinto, M.N. Hall, Tor signalling in bugs, brain and brawn, nature reviews, Molecular cell biology 4 (2003) 117–126. Y. Wang, J.L. Wang, H.C. Ma, Z.T. Tang, H.R. Ding, X.L. Shi, Mesenchymal stem cells increase heme oxygenase 1-activated autophagy in treatment of acute liver failure, Biochem. Biophys. Res. Commun. 508 (2019) 682–689. Y. Wang, Y. Sun, L. Zuo, Y. Wang, Y. Huang, ASIC1a promotes high glucose and PDGF-induced hepatic stellate cell activation by inducing autophagy through CaMKKbeta/ERK signaling pathway, Toxicol. Lett. 300 (2019) 1–9. L. Wei, Q. Chen, A. Guo, J. Fan, R. Wang, H. Zhang, Asiatic acid attenuates CCl4induced liver fibrosis in rats by regulating the PI3K/AKT/mTOR and Bcl-2/Bax signaling pathways, Int. Immunopharmacol. 60 (2018) 1–8. D. Li, Z. Lu, Z. Xu, J. Ji, Z. Zheng, S. Lin, T. Yan, Spironolactone promotes autophagy via inhibiting PI3K/AKT/mTOR signalling pathway and reduce adhesive capacity damage in podocytes under mechanical stress, Biosci. Rep. 36 (2016). C. Burman, N.T. Ktistakis, Regulation of autophagy by phosphatidylinositol 3phosphate, FEBS Lett. 584 (2010) 1302–1312. I.J. Matouk, E. Raveh, R. Abu-lail, S. Mezan, M. Gilon, E. Gershtain, T. Birman, J. Gallula, T. Schneider, M. Barkali, C. Richler, Y. Fellig, V. Sorin, A. Hubert, A. Hochberg, A. Czerniak, Oncofetal H19 RNA promotes tumor metastasis, Biochim. Biophys. Acta 1843 (2014) 1414–1426. J. Wang, B. Cao, D. Han, M. Sun, J. Feng, Long non-coding RNA H19 induces cerebral ischemia reperfusion injury via activation of autophagy, Aging Dis. 8 (2017) 71–84.