IL-32θ downregulates CCL5 expression through its interaction with PKCδ and STAT3

Cellular Signalling 26 (2014) 3007–3015

Contents lists available at ScienceDirect

Cellular Signalling journal homepage: www.elsevier.com/locate/cellsig

IL-32θ downregulates CCL5 expression through its interaction with PKCδ and STAT3 Yesol Bak a, Jeong-Woo Kang a, Man Sub Kim a, Yun Sun Park a, Taeho Kwon a, Soohyun Kim b, Jintae Hong c, Do-Young Yoon a,⁎ a b c

Department of Bioscience and Biotechnology, Bio/Molecular Informatics Center, Konkuk University, Neungdong-ro 120, Gwangjin-gu, Seoul 143-701, Republic of Korea Institute of Biomedical Science and Technology, Konkuk University, Neungdong-ro 120, Gwangjin-gu, Seoul 143-701, Republic of Korea College of Pharmacy and Medical Research Center, Chungbuk National University, 12 Gashin-dong, Heungduk-gu, Cheongju, Chungbuk 361-463, Republic of Korea

a r t i c l e

i n f o

Article history: Received 21 May 2014 Received in revised form 15 August 2014 Accepted 15 September 2014 Available online 2 October 2014 Keywords: Microarray Interleukin-32θ PKCδ STAT3 CCL5

a b s t r a c t Interleukin-32 (IL-32) exists in several isoforms and plays an important role in inflammatory response. Recently, we identified a new isoform, IL-32θ, and performed a microarray analysis to identify IL-32θ-regulated genes in THP-1 myelomonocytic cells. Upon stimulating IL-32θ-expressing THP-1 cells with phorbol myristate acetate (PMA), we found that the CCL5 transcript level was significantly reduced. We confirmed the downregulation of CCL5 protein expression by using an enzyme-linked immunosorbent assay (ELISA). Because STAT3 phosphorylation on Ser727 by PKCδ is reported to suppress CCL5 protein expression, we examined whether IL-32θmediated STAT3 Ser727 phosphorylation occurs through an interaction with PKCδ. In this study, we first demonstrate that IL-32θ interacts with PKCδ and STAT3 using co-immunoprecipitation (Co-IP) and pulldown assay. Moreover, STAT3 was rarely phosphorylated on Ser727 in the absence of IL-32θ, leading to the binding of STAT3 to the CCL5 promoter. These results indicate that IL-32θ, through its interaction with PKCδ, downregulates CCL5 expression by mediating the phosphorylation of STAT3 on Ser727 to render it transcriptionally inactive. Therefore, similar to what we have reported for IL-32α and IL-32β, our data from this study suggests that the newly identified IL-32θ isoform also acts as an intracellular modulator of inflammation. © 2014 Elsevier Inc. All rights reserved.

1. Introduction The function of interleukin (IL)-32, formerly named natural killer cell transcript 4 [1], has been previously described in several studies [2–7]. The protein sequence of IL-32 is distinct in that it is not homologous with any other cytokines [8]. The gene for IL-32 is located in chromosome 16 p13.3, and IL-32 reportedly has 6 isoforms (α, β, γ, δ, ε, and ζ), which arise from alternative mRNA splicing [9–11]. Three isoforms of IL-32 (η, θ, s) were recently identified by our group [12]. The IL-32α and IL-32β isoforms are the most abundant in A549 lung cancer cells and U937 myeloid lymphoma cells, respectively, whereas IL-32ε and IL32ζ are both expressed in T cells [9,13,14]. IL-32 has bifunctional effects on the immune response in that it can induce the expression of not only pro-inflammatory cytokines, including tumor necrosis factor α (TNF-α) and IL-1β [6], but also the anti-inflammatory cytokine, IL-10 [15]. IL-32 was found to be expressed in a TNF-α-dependent manner in biopsied synovial tissue collected from patients with rheumatoid arthritis, suggesting that these factors reciprocally induce the expression of each ⁎ Corresponding author at: Department of Bioscience and Biotechnology, Bio/Molecular Informatics Center, Konkuk University, Hwayang-dong 1, Gwangjin-gu, Seoul 143-701, Republic of Korea. Tel.: +82 2 450 4119; fax: +82 2 444 4218. E-mail address: [email protected] (D.-Y. Yoon).

http://dx.doi.org/10.1016/j.cellsig.2014.09.015 0898-6568/© 2014 Elsevier Inc. All rights reserved.

other [16]. IL-32 is also expressed in the intestinal tissue of patients with Crohn's disease or ulcerative colitis [17,18]. Furthermore, recent reports have shown that IL-32 expression is regulated during human immunodeficiency virus (HIV)-1 and influenza A infection [19,20], and it can inhibit cancer cell growth [7]. However, the cognate receptor for IL-32 is yet to be identified. Proteinase 3 (PR3), which produces the active form of IL-32, is the only known IL-32-binding partner to date [11]. The functional differences and physiological basis for the multitude of these isoforms remain unclear. The heterogeneous protein kinase C (PKC) family of serine-threonine kinases and phospholipid-dependent kinases can be classified into three types of isoenzymes based on their second messenger requirements [21,22]. The family is subdivided as follows: conventional PKCs (α, β, γ) requiring both Ca2+ and diacylglycerol (DAG) or phorbol esters as cofactors, novel PKCs (δ, ε, η, θ) requiring DAG or phorbol 12-myristate 13-acetate (PMA) for activation, and atypical PKCs (ι, ζ) that are insensitive to both Ca2 + and DAG, but sensitive to phosphatidylserine [21, 23–25]. After activation, PKCs translocate to the plasma membrane through interactions with receptors for activated C-kinase (RACK) proteins [26,27]. PKCs exhibit long-term activation, and therefore have lasting effects including stimulating cell proliferation, differentiation, or apoptosis [28–30]. PKCδ activates downstream of several receptors, including p60 tumor necrosis factor receptor (TNFR) and the insulin

3008

Y. Bak et al. / Cellular Signalling 26 (2014) 3007–3015

receptor [31,32], and is responsible for the phosphorylation of numerous factors including PU.1, p21, and signal transducers and activators of transcription 3 (STAT3) [28,33,34]. STATs are activated by various cytokines, growth factors, and several kinases. Seven STAT family members have been identified (STAT1, 2, 3, 4, 5A, 5B, and 6) [35–39]. Constitutive STAT activation leads to cancer development and immune suppression [40,41]. Members of the receptor associated tyrosine kinase family, such as Janus kinase (JAK), activate STATs by phosphorylating them on a target residue at the carboxylterminus, causing STAT3 dimerization, translocation, and binding to DNA of target genes [42,43]. STAT proteins are distinguished from other transcription factors by their Src homology (SH2) domain, which acts as a receptor-binding domain and facilitates STAT protein dimerization [44]. STAT3 can be phosphorylated on both Tyr705 and Ser727 residues. Although Tyr705 is recognized as essential for STAT3 activation [45], the role of Ser727 in STAT3 activation is debated and is not fully understood [46–49]. The gene for chemokine C–C motif ligand 5 (CCL5), encoding the regulated upon activation, normal T cell-expressed and secreted (RANTES) protein, was first found to be expressed during late T-cell activation [50]. CCL5 is a member of the CC chemokine family, which are characterized by two pairs of adjacent cysteine residues residing near their amino termini. Members of this chemokine family display a chemotactic effect on monocytes, T cells, eosinophils, and basophils [51–54]. CCL5 is expressed in various cell types including vascular smooth muscle cells (VSMCs), fibroblasts, epithelial cells, monocytes, and macrophages [55–60]. Reportedly, CCL5 plays pivotal roles in many diseases including asthma, rheumatoid arthritis, atherosclerosis, and cancer [61–65]. The promoter region of the CCL5 gene possesses numerous consensus binding sequences for transcription factors, including nuclear factor of activated T lymphocyte (NFAT), RANTES factor of late activated T lymphocytes-1 (RFLAT-1), and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) [66–69]. In this report, we demonstrate that a newly identified IL-32θ isoform [12] interacts with PKCδ and STAT3, resulting in the regulation of CCL5 expression in THP-1 myelomonocytic cells. Our data indicates that IL32θ interacts with PKCδ to induce STAT3 phosphorylation at Ser727, thereby inhibiting STAT3 from binding to the CCL5 promoter, and resulting in the downregulation of CCL5 expression. 2. Materials and methods 2.1. Reagents and cell culture Human myelomonocytic THP-1 cells were cultured in RPMI 1640 medium (WelGENE; Daegu, Korea) and human embryonic kidney 293 (HEK293) cells were grown in Dulbecco's modified Eagle medium (DMEM; Hyclone; Logan, UT). Both media were supplemented with 10% heat-inactivated fetal bovine serum, 2 mM L-glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin (Hyclone). PMA, rottlerin, and FLAG-tag antibody were purchased from Sigma (St. Louis, MO). Myctag antibody and α-mouse horseradish peroxidase (HRP)-conjugated secondary antibody were purchased from Millipore (Billerica, MA). αRabbit HRP-conjugated secondary antibody was purchased from AbClon (Seoul, Korea). Phosopho-STAT3 Ser727 (p-STAT3 S727) antibody was purchased from Cell Signaling Technology (Beverly, MA). PKCδ, Phosopho-STAT3 Tyr705 (p-STAT3 T705), and normal mouse IgG antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Monoclonal anti-IL-32 antibody, KU32-52 was made as previously reported (70). 2.2. Construction of expression vectors We previously identified and cloned IL-32θ from purified human monocyte-derived dendritic cells (GenBank accession no. FJ985780) [12]. IL-32θ was subcloned into the EcoRI and XhoI sites of the

pcDNA3.1(+)-6 × Myc vector. STAT3 was subcloned into the pCS3MT6 × Myc vector, and PKCδ was subcloned into the pcDNA3.1(+)-5 × FLAG vector using EcoRI and XhoI [70]. 2.3. Generation of stable clones To establish constitutive expression of IL-32, we electroporated cells as previously described [12,70]. Briefly, pcDNA3.1(+)-6 × MycIL-32θ or empty pcDNA3.1 + -6 × Myc vector was transfected into THP-1 myelomonocytic cells using the NeonTM transfection system (Invitrogen; Carlsbad, CA) following the manufacturer's instructions. G-418 (700 μg/ml) selection was performed for three weeks and a single colony of G418-resistant cells was obtained by serial dilution. 2.4. Microarray To identify the genes regulated by the newly identified isoform IL32θ, we performed a microarray analysis using the stable THP-1-IL32θ cell line. Total RNA was extracted using the RNeasy Micro Kit (Qiagen; Doncaster, Australia) according to the manufacturer's instructions. RNA quality was measured by Agilent 2100 Bioanalyser using the RNA 6000 Nano Chip (Agilent Technologies; Amstelveen, The Netherlands), and the quantity was measured by ND-1000 Spectrophotometer (NanoDrop Technologies, Inc.; Wilmington, DE). We used 300 ng of each RNA sample as input in the Affymetrix procedure, according to the manufacturer's instructions (http://www.affymetrix. com). Total RNA from each sample was reverse-transcribed into cDNA. The cDNA was fragmented and end-labeled by terminal transferase reaction to incorporate a biotinylated dideoxynucleotide. Fragmented end-labeled cDNA was then hybridized to the GeneChip® Human Gene 1.0 ST arrays following the manufacturer's instructions. After 16 h of hybridization, the chips were stained and washed using Genechip Fluidics Station 450 (Affymetrix; Santa Clara, CA), and scanned on a Genechip Array scanner 3000 7G (Affymetrix). An Affymetrix GeneChip® Human Gene 1.0 ST Array was used to analyze the transcriptional profiles of the two different cell lines, THP-1 empty vector (THP-1-EV) and THP1-IL-32θ, in the presence or absence of PMA stimulation. The Affymetrix array contains 764,885 25-mer oligonucleotide probes covering 28,869 human genes. The Affymetrix analysis was conducted using the following steps: image acquisition, data extraction, normalization, differentially expressed gene (DEG) selection, and functional grouping. Robust multi-array average (RMA) was used for normalization. The web-based tool, DAVID (the Database for Annotation, Visualization, and Integrated Discovery), was used to identify the biological function of differentially expressed genes. Then, these genes were categorized based on gene function in the Gene Ontology, KEGG Pathway database. (http://david.abcc.ncifcrf.gov/home.jsp). 2.5. Measurement of CCL5 expression levels using reverse transcriptionpolymerase chain reaction (RT-PCR) and enzyme-linked immunosorbent assay (ELISA) CCL5 mRNA expression was detected by RT-PCR. THP-1-EV and IL32θ-expressing cells were treated with PMA for various periods of time. The total RNA from these cells was isolated using R&A-BLUE (iNtRON Biotechnology; SungNam, South Korea) according to the manufacturer's instructions. Reverse transcription was performed using M-MuLV reverse transcriptase (New England Biolabs; Beverly, MA). The CCL5 primer sets used for standard PCR were as follows: 5′GCTGTCATCCTCATTGCTAC-3′ (Forward) and 5′-CATTTCTTCTCTGGGT TGGC-3′ (Reverse). The GAPDH primers used were as follows: 5′TGATGACATCAAGAAGGTGGT-3′ (Forward) and 5′-TCCTTGGAGGCCAT GTAGGCC-3′ (Reverse). GAPDH was used as an internal control. Real-time quantitative PCR was performed with a relative quantification protocol using the Chromo 4 Real-Time PCR system (Bio-Rad; Hercules, CA) and TOPreal™ qPCR 2X PreMIX (SYBR Green)

Y. Bak et al. / Cellular Signalling 26 (2014) 3007–3015

3009

(Enzynomics; Daejeon, Korea). Samples were analyzed using the following primer set: 5′-ACACAGCAGCAGTTACAAAA-3′ (Forward) and 5′-TTAGTAGAGATGGGGTTTCA-3′ (Reverse). The GAPDH primer set used was as follows: 5′-GGCTGCTTTTAACTCTGGTA-3′ (Forward) and 5′-TGGAAGATGGTGATGGGATT-3′ (Reverse). CCL5 transcript levels were normalized to the expression level of the housekeeping gene, GAPDH. The cell culture supernatants were analyzed using the human CCL5/RANTES ELISA kit purchased from R&D Systems (Minneapolis, MN). All samples were assayed in duplicate and the CCL5 protein concentration was evaluated according to the manufacturer's protocol.

NaCl, 5% glycerol, 20 mM β-glycerophosphate, 1% Nonidet P-40, 0.5% Triton X-100, 1 mM EDTA, and 1 mM EGTA. For immunoprecipitation, cell lysates were mixed with 3 μg of either α-Myc, α-FLAG, or KU3252 antibody [72] for 1 h and precipitated with 40 μl of protein G agarose beads (KPL; Gaithersburg, MD) overnight at 4 °C. After washing with lysis buffer three times, beads were boiled to denature protein-bead complex. The proteins were separated by 8% SDS polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred to polyvinylidene difluoride membranes (Millipore, Billerica, MA). Western blotting was performed using an Myc-tag antibody (Millipore-Upstate, Bedford, MA) and FLAG antibody (Sigma).

2.6. PKCδ siRNA transfection

2.10. Pull down assay

Scramble siRNA and PKCδ siRNA were synthesized and purified by Dharmacon (Chicago, IL). siRNA was transfected into THP-1 EV cells and THP-1-IL-32θ cells using the NeonTM transfection system (Invitrogen; Carlsbad, CA) according to the manufacturer's protocol. Twenty-four hours after siRNA transfection, THP-1 EV cells and THP1-IL-32θ were incubated for 24 h with PMA. The PKCδ siRNA target sequences was: AACTCTACCGTGCCACGTTT [71].

To generate PKCδ expression vector, we used pPROEX HTb-his tag vector and PKCδ-pcDNA3.1(+)-5 × FLAG vector. We cut both vectors with BamH1 and Xho1 for 1 h and ligated with T4 ligase overnight. After checking sequencing, we transformed vector to BL21-RIL competent cells, picked colony, incubated for overnight. If O.D reached to 0.6–0.8, we added IPTG to induce protein production. After incubation for 4 h at 30 °C, we did Escherichia coli sonication, ran column chromatography, and got PKCδ-His tag protein from dialysis. PKCδ-His tag protein was prey protein. THP-1 EV and THP-1-IL-32θ were stimulated and lysed with lysis buffer. Cell lyastes which contained bait protein (STAT3, IL-32θ) were incubated with PKCδ-His tag protein for 1 h. We washed three times with RIPA buffer, eluted, then evaluated protein by SDSPAGE.

2.7. Immunofluorescence A549 cells were seeded on sterilized coverslips and incubated overnight. STAT3 and IL-32θ were transfected into each well and further incubated for 20 h. Transfected cells were stimulated with PMA for 90 min. After stimulation, cells attached coverslip were washed twice with Hank's Balanced Salt Solution (HBSS) (Supplier; Supplier's Location), fixed, and permeabilized with cold acetone on ice for 10 min. The coverslips were washed with DPBS three times and blocked with 0.1% bovine serum albumin (BSA) in DPBS at room temperature (RT) for 30 min. Primary antibody (STAT3, Myc, PKCδ) was diluted at 1:100 in 0.1% BSA in DPBS and added to the coverslip at 4 °C overnight. After washing with DPBS three times, the coverslips were incubated with secondary antibody (goat anti-mouse IgG-FITC conjugated, goat anti-rabbit IgG-rhodamine conjugated, Millipore, Billerica, MA) diluted at 1:200 in 0.1% BSA in DPBS for 1 h at RT. The slips were then washed three times with DPBS, exposed to DAPI (1:1,000) for 10 s and washed with DPBS twice. The stained cells were visualized using a confocal microscope (LSM510Meta; Carl Zeiss, Jena, German) and images captured by Zeiss LSM Image Browser program. 2.8. CCL5 reporter plasmid construction and luciferase assay CCL5 cDNA was synthesized using THP-1 genomic DNA. The targeted CCL5 promoter region (position-719 to -33) was amplified by PCR using the following primer set: 5′-GCGGTACCGCACTTTTCCCAAA GGTCGC-3′ (Forward) and 5′-GCCTCGAGGTGCGTCTTGATCCTCTGC-3′ (Reverse). The PCR product was digested with KpnI and XhoI, and then ligated into the pGL3-Basic vector. THP-1 cells were transfected with the following plasmids: pGL3-CCL5 promoter, pcDNA3.1(+)-5 × FLAG-PKCδ, pCS3MT-6 × Myc-STAT3, and pcDNA3.1(+)-6 × Myc-IL32θ. The transfected cells were incubated overnight, stimulated with PMA for an additional 24 h, and then lysed. The promoter activity was measured by using the Luciferase Reporter Assay System (Promega; Madison, WI).

2.11. Chromatin immunoprecipitation (ChIP) assay The ChIP assay was performed using the SimpleChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology) according to the manufacturer's instructions. Briefly, THP-1-EV and THP-1-IL-32 cells (1 × 107) were stimulated with PMA for 24 h and cross-linked with 1% (v/v) formaldehyde (Sigma) for 10 min at RT. Subsequently, glycine was added to stop the reaction and cells were washed with phosphate-buffered saline twice. Cells were lysed with buffer A/B and the chromatin was digested with micrococcal nuclease for 20 min at 37 °C. The chromatin digest was stopped by adding 0.5 M EDTA and nuclei were sonicated with three, 20-s pulses at 30% amplitude to generate DNA fragments. Cross-linked chromatin was incubated with 2 μg of anti-STAT3 (Santa Cruz Biotechnology) overnight at 4 °C with rotation. After incubation with 20 μl of ChIP-grade protein G agarose beads for 2 h at 4 °C, the antibody–DNA–protein complexes were eluted from the beads and digested with proteinase K for 2 h at 65 °C. The DNA was purified by a spin column and amplified by PCR. Quantitative PCR was performed using the following primers that amplify the STAT3 binding site in the CCL5 promoter: 5′-AGCAAGTAAATGGGAGAGAC-3′ (Forward) and 5′-ATTGAGGCAGTTGATCTGAG-3′ (Reverse). To quantify these results, we used a formula described elsewhere [73]. 2.12. Statistical analysis The data presented are the mean ± standard error measurement (SEM) calculated from at least three independent experiments. Statistical significance was assessed with the Student's t-test. *p b 0.05 was interpreted to be statistically significant.

2.9. Western blotting and co-immunoprecipitation

3. Results

HEK293 cells were cotransfected with various combinations of pcDNA3.1(+)-6 × Myc-IL-32θ, pCS3MT-6 × Myc-STAT3, and pcDNA3.1 + 5 × FLAG-PKCδ. Following an overnight incubation, cotransfected cells were pretreated with 10 μM rottlerin for 1 h and subsequently treated with 10 nM PMA for 90 min. Cells were harvested and lysed with a buffer containing 50 mM HEPES (pH 7.5), 150 mM

3.1. The effect of IL-32θ on gene expression in THP-1 myelomonocytic cells Our group previously identified the regulatory roles for IL-32α and IL-32β in the inflammatory response [15,70]. In these studies, we also investigated the intracellular role of IL-32θ, a newly identified isoform previously cloned in our lab (GenBank accession no. FJ985780, [12]).

3010

Y. Bak et al. / Cellular Signalling 26 (2014) 3007–3015

Fig. 1. Microarray analysis of THP-1-EV and THP-1-IL-32θ cells stimulated with 10 nM phorbol myristate acetate (PMA) for 24 h. (A) Hierarchical clustering showing the distinct gene expression profiles of the cells. (B) Pie-charts showing the classification of genes expressed in these cells based on their molecular function.

IL-32θ shows sequence similarities with IL-32β, but lacks exon 6 (Supplemental Fig. 1). We generated stable THP-1 myelomonocytic cell lines that constitutively express IL-32θ (THP-1-IL-32θ) or an empty vector (THP-1-EV) (Supplemental Fig. 2) and performed microarray analyses following PMA stimulation. The gene expression profiles of these cells showed distinct patterns in hierarchical clustering (Fig. 1A). Green indicates low intensity, whereas red indicates a high intensity of gene expression. Ninety-three probes were detected in both cell lines, representing the genes that were unaffected by IL-32θ or PMA. In IL-32θ-expressing THP-1 cells, 90 genes were upregulated and 181 genes were downregulated relative to EV control cells. Next, we classified these genes based on their known molecular functions (Fig. 1B). Interestingly, several immune response-related genes were downregulated by IL-32θ (Table 1). Of the IL-32θ-regulated genes we identified, CCL5 showed the greatest magnitude of downregulation.

3.2. IL-32θ downregulates CCL5 expression at both the mRNA and protein levels Based on our microarray findings, we further explored the effect of IL-32θ on CCL5 downregulation. To validate these results, we performed RT-PCR and ELISA assays in THP-1-EV and THP-1-IL-32θ cells following stimulation with PMA for 24 h. We observed a significant increase in the number of CCL5 transcripts in response to PMA treatment in THP-1 EV cells, whereas the level of CCL5 transcripts in THP-1-IL-32θ cells dramatically decreased upon PMA stimulation (Fig. 2A). We also evaluated CCL5 mRNA levels at various time points to determine whether the kinetics of this process was altered by IL-32θ expression. We observed that CCL5 mRNA levels gradually increased in THP-1-EV cells in a time-dependent manner (Fig. 2B). By contrast, CCL5 mRNA in THP-1IL-32θ cells was rarely detected prior to PMA stimulation (Fig. 2B). Next, we sought to determine whether CCL5 protein expression was also affected by IL-32θ expression. We measured the protein level

of CCL5 in PMA-stimulated cells by ELISA. Cell culture media were collected after 24 h (Fig. 3A) and at several additional time points (Fig. 3B) after PMA treatment. Similar to our mRNA data, the levels of CCL5 protein in THP-1-IL-32θ cells were far lower than those in THP1-EV cells. The level of CCL5 protein production in PMA-treated THP1-EV cells steeply increased in a time-dependent manner, but protein levels in THP-1-IL-32θ cells significantly diminished. This data suggests that IL-32θ downregulates CCL5 expression.

3.3. Upon PMA stimulation, IL-32θ phosphorylates STAT3 at Ser727 To investigate the mechanism underlying IL-32θ-dependent CCL5 downregulation, we sought to identify the signaling pathway that potentially mediates this phenomenon. It is known that CCL5 expression is regulated by STAT3 through binding to the CCL5 promoter [56, 57]. STAT3 activity is regulated by the phosphorylation of Tyr705 and Ser727 [28]. Notably, STAT3 phosphorylation on Ser727 showed ambilaterality, and its function is poorly understood. We examined whether STAT3 levels would be affected by IL-32θ expression using western blot analysis. While the level of total STAT3 protein was not significantly altered by IL-32θ at the time points analyzed, we observed that STAT3 was phosphorylated at Ser727 to a greater extent and increased in a time-dependent manner in IL-32θ-expressing THP-1 cells, but not THP-1-EV cells (Fig. 4A, Supplementary Fig. 3). STAT3 was rarely phosphorylated after PMA stimulation in THP-1 EV cells. However, STAT3 Ser727 phosphorylation was induced by PMA treatment in THP-1-IL-32θ at early time points. In comparison, STAT3 phosphorylation at Tyr705 was not induced upon PMA stimulation, as revealed by Kuroki et al. [74]. We further confirmed this observation as shown in Fig. 4. Since PKCδ is activated by PMA and phosphorylates STAT3 [28,75], we next investigated the role of PKCδ within this mechanism. We found that STAT3 Ser727 phosphorylation was inhibited by the PKCδ-specific inhibitor, rottlerin, in both cell lines (Fig. 4B). To verify

Y. Bak et al. / Cellular Signalling 26 (2014) 3007–3015

3011

Table 1 IL-32 inducible genes by micro array. Gene accession ID

Gene description

Gene symbol

GO biological process term

Up-regulation NM_003853 NM_001831 NM_005021

Interleukin 18 receptor accessory protein Clusterin Ectonucleotide pyrophosphatase/phosphodiesterase 3

IL18RAP CLU ENPP3

Immune response/signal transduction Anti-apoptosis/complement activation Phosphate metabolic process/immune response

Down-regulation NM_002985 NM_000575 NM_000576 NM_000878 NM_001558 NM_000640 NM_001562 NM_006850 NM_005531 NM_002974 NM_003810 NM_001803

Chemokine (C–C motif) ligand 5 Interleukin 1, alpha Interleukin 1, beta Interleukin 2 receptor, beta Interleukin 10 receptor, alpha Interleukin 13 receptor, alpha 2 Interleukin 18 (interferon-gamma-inducing factor) Interleukin 24 Interferon, gamma-inducible protein 16 Serpin peptidase inhibitor, clade B (ovalbumin), member 4 Tumor necrosis factor (ligand) superfamily, member 10 CD52 molecule

CCL5 IL1A IL1B IL2RB IL10RA IL13RA2 IL18 IL24 IFI16 SERPINB4 TNFSF10 CD52

Chemotaxis/inflammatory response/immune response Inflammatory response/immune response/cell proliferation Inflammatory response/immune response Signal transduction/cytokine-mediated signaling pathway Blood coagulation/response to lipopolysaccharide

NM_000758 NM_006435 NM_004951

Colony stimulating factor 2 (granulocyte-macrophage) Interferon induced transmembrane protein 2 (1-8D) G protein-coupled receptor 183

CSF2 IFITM2 GPR183

NM_022148 NM_004079 NM_002116 NM_005514 NM_002117 NM_033554

Cytokine receptor-like factor 2 Cathepsin S Major histocompatibility complex, class I, A Major histocompatibility complex, class I, B Major histocompatibility complex, class I, C Major histocompatibility complex, class II, DP alpha 1

NM_005516 NM_002127

Major histocompatibility complex, class I, E Major histocompatibility complex, class I, G

CRLF2 CTSS HLA-A HLA-B HLA-C HLADPA1 HLA-E HLA-G

these results, we transfected PKCδ siRNA in both cell lines (Fig. 4C). Significantly, STAT3 Ser727 phosphorylation was present at higher level THP-1-IL-32θ cells transfected with scrambled siRNA, as compared with THP-1 EV cells and decreased after PKCδ siRNA transfection in both cell lines. As such, we concluded that the phosphorylation of STAT3 at Ser727 is mediated by PKCδ in this system. Taken together, these results suggest that IL-32θ-mediated STAT3 Ser727 phosphorylation by PKCδ occurs upon PMA treatment and IL-32θ plays a role in the regulation of CCL5 expression.

Angiogenesis/immune response/cell–cell signaling Apoptosis Regulation of transcription, DNA-dependent/cell proliferation Immune response/regulation of proteolysis Immune response/signal transduction Elevation of cytosolic calcium ion concentration/respiratory burst Immune response/positive regulation of cell proliferation Immune response/response to virus Immune response/G-protein coupled receptor protein signaling pathway Proteolysis/immune response Immune response/antigen processing and presentation Immune response/antigen processing and presentation Immune response/antigen processing and presentation Immune response Immune response/antigen processing and presentation Immune response/cellular defense response/antigen processing and presentation

Fold change (log2 ratio) 1.5 1.3 1 −2.9 −1.9 -1 −1.2 −1.5 -2.4 −1 −1.1 −1.1 −1 −1.2 −1.2 −1.3 −1.4 −1.4 −1.4 −1.6 −1.2 −1.5 −1 −1.1 −1.2 −1.4

3.4. IL-32θ-mediated STAT3 phosphorylation by PKCδ suppresses the binding of STAT3 to the CCL5 promoter We previously demonstrated that IL-32α induces PKCε-mediated STAT3 Ser727 phosphorylation in THP-1 cells [70]. Therefore, we investigated whether IL-32θ could interact with PKCδ to mediate STAT3 phosphorylation in a similar manner. To test this hypothesis, we transiently transfected HEK293 cells with IL-32θ and PKCδ and subsequently performed co-immunoprecipitations using Myc and FLAG antibodies.

Fig. 2. IL-32θ decreases CCL5 mRNA levels upon PMA stimulation. CCL5 mRNA levels were detected in THP-1-EV and THP-1-IL-32θ cells. The two cell lines were stimulated with 10 nM PMA or the vehicle control (DMSO) for 24 h (A) and for the additional time periods indicated (B). Cells were harvested, and RNA extractions were performed. CCL5 transcript levels were analyzed by quantitative reverse transcription polymerase chain reaction (RT-PCR). GAPDH was used as a loading control. There was a statistically significant difference in the expression of CCL5 between the THP-1-EV cells and the THP-1-IL-32θ cells incubated for 24 h, *p b 0.05.

3012

Y. Bak et al. / Cellular Signalling 26 (2014) 3007–3015

is involved in the interaction between PKCδ and STAT3, we explored the interactions between IL-32θ, PKCδ, and STAT3 by immunoprecipitation. We immunoprecipitated the cell lysates using PKCδ antibody, and subsequently immunoblotted using the IL-32 monoclonal antibody, KU32-52, as well as antibodies specific to p-STAT3, Myc and PKCδ (Fig. 5C). We determined that PKCδ could weakly interact with STAT3 in the absence of IL-32θ, and that IL-32θ interacted with both PKCδ and STAT3. To further confirm these results, we did His-tag pull down assay. Pull down assay can show the in vitro direct interaction between proteins using His-tag-PKCδ protein and THP-1 EV, THP-1-IL-32θ cells. PKCδ binds with STAT3 in both cell lines and PKCδ interacted with IL32θ. Importantly, IL-32θ formed an immunocomplex with PKCδ and STAT3, suggesting that PKCδ might be a bridge of this complex formation. This implies that IL-32θ mediates the interaction between PKCδ with STAT3 and, subsequently, the PKCδ-induced phosphorylation of STAT3 on Ser727.

3.5. IL-32θ represses the transcriptional activity of STAT3 by mediating the phosphorylation of Ser727

Fig. 3. IL-32θ inhibits CCL5 protein expression upon PMA stimulation. CCL5 protein levels were assayed by enzyme-linked immunosorbent assay (ELISA) after PMA stimulation. Cell supernatants were collected at the indicated times, and each experiment was performed in triplicate. (A) The CCL5 protein level in THP-1-EV and THP-1-IL-32θ cells stimulated with PMA for 24 h. (B) The level of CCL5 protein measured at different time points in the two cell lines after PMA stimulation. There was a significant difference in protein levels between the THP-1-EV cells and the THP-1-IL-32θ cells incubated for 24 h, *p b 0.05.

As shown in Fig. 5A, IL-32θ interacted with PMA-activated PKCδ. To confirm this observation, we also examined the interaction between IL-32θ and the endogenous PKCδ in THP-1 cells (Fig. 5B). Notably, endogenous PKCδ interacts with IL-32θ upon PMA stimulation. This data is in concordance with exogenous PKCδ data (Fig. 5A). PKCδ phosphorylates STAT3 at Ser727 to induce the transcriptional repressor activity of STAT3 [28]. To understand whether IL-32θ

To study the functional consequence of the IL-32θ/PKCδ/STAT3 interaction, we investigated whether IL-32θ could sequester the STAT3 promoter binding affinity that results from Ser727 phosphorylation. We examined the human CCL5 promoter to identify STAT3 consensus binding sites that possess the sequence, TTCNNNGAA [76]. Based on this consensus sequence, we designed primers that could be used to explore whether IL-32θ affects STAT3 binding to its cognate DNA sequence. The ChIP assay revealed that STAT3 bound to the CCL5 promoter upon PMA stimulation in THP-1-EV cells; however, the localization of STAT3 to the CCL5 promoter was greatly diminished in THP-1IL-32θ cells (Fig. 6A). In view of the fact that STAT3 phosphorylation on Ser727 by IL-32θ inhibits STAT3 binding to DNA, we measured CCL5 promoter activity using a luciferase assay. We speculated that the phosphorylation of the Ser727 residue modulates the affinity of STAT3 for the CCL5 promoter. Luciferase activity was measured in cells that were cotransfected with the pGL3-CCL5 promoter plasmid and plasmids encoding STAT3 and IL-32θ. As shown in Fig. 6B, the CCL5 promoter was activated by STAT3 alone upon PMA stimulation and this effect was impeded in the presence of IL-32θ. These findings indicate that the IL-32θ-mediated phosphorylation of STAT3 was concomitant with the inhibition of CCL5 promoter activity.

Fig. 4. IL-32θ phosphorylates STAT3 after PMA stimulation. THP-1-EV and THP-1-IL-32θ cells were stimulated by 10 nM PMA for the indicated times. Cells were harvested, lysed, and the protein was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinyldifluoride (PVDF) membranes. (A) STAT3 phosphorylation in two cell lines at the indicated time points. Actin was used as an internal control. (B) THP-1-EV and THP-1-IL-32θ cells were preincubated for 1 h in 10 μM of the PKCδ inhibitor rottlerin, and subsequently incubated in 10 nM PMA for 24 h. (C) THP-1-EV and THP-1-IL-32θ cells were transfected with scrambled siRNA or PKCδ siRNA. After 48 h of incubation, the cells were stimulated with PMA for 24 h.

Y. Bak et al. / Cellular Signalling 26 (2014) 3007–3015

3013

Fig. 5. IL-32θ interacts with PKCδ and phosphorylates STAT3 at Ser727 through a PMA-activated PKCδ-dependent pathway. (A) HEK293 cells were cotransfected with plasmids encoding 6 × Myc-IL-32θ and 5 × FLAG-PKCδ for 20 h, treated with rottlerin for 1 h, and then stimulated with 10 nM PMA for an additional 90 min. Reciprocal immunoprecipitation with myc (2 μg) and FLAG (2 μg) antibodies were performed. (B) Endogenous PKCδ was immunoprecipitated from lysate obtained from THP-1-IL-32θ cells that were pretreated with rottlerin for 1 h and stimulated with PMA for 24 h, using the Myc antibody (3 μg). (C) HEK293 cells were cotransfected with constructs encoding 5 × FLAG-PKCδ, 6 × Myc-IL-32θ, and 6 × Myc-STAT3 for 20 h, treated with 10 μM rottlerin for 1 h, and subsequently stimulated with 10 nM PMA for 90 min. Immunoprecipitation with PKCδ (3 μg) and KU-32-52 (3 μg) antibodies was performed. Immunoprecipitated proteins were probed with the indicated antibody. In all experiments, proteins were immunoprecipitated using protein G agarose. Whole cell lysates were probed with each antibody to compare transfection efficiency. Normal IgG was used as a negative control. (D) THP-1 EV and THP-1-IL-32θ were stimulated with PMA for 24 h, lysed, and incubated with 6 × His-PKCδ for 1 h for pull down assay.

4. Discussion IL-32 is a cytokine that has different roles in many diseases, and its function has been extensively documented in several studies [6,7,10, 16]. IL-32 has been reported to induce apoptosis and cell differentiation [10,77]. To date, several isoforms of IL-32 have been reported, but the function of each isoform remains unclear. In earlier work, we identified a previously undescribed isoform, IL-32θ (GenBank accession no. FJ985780) [12]. With this discovery, we investigated the functional role of IL-32θ in the immune response. Despite the conflicting data pertaining to the role of IL-32 in regulating the inflammatory response [2–5], this study revealed that IL-32θ can regulate CCL5 expression in human myelomonocytic THP-1 cells. Although many reports have emphasized the importance of CCL5 in the development of disease [58,61,62,65], few studies have investigated the mechanisms mediating the effects of IL-32 on CCL5 expression. Here, we demonstrated that IL32θ modulates CCL5 expression. Using both RT-PCR and ELISA, we confirmed that IL-32θ markedly inhibits CCL5 transcript and protein expression. We conducted several experiments to verify the mechanism by which IL-32θ regulates CCL5. Because a recent study reported that CCL5 expression is regulated by STAT3 [56], we examined whether STAT3 signaling is required for IL-32θ-mediated CCL5 transcriptional inhibition. Our data demonstrates that STAT3 is phosphorylated on Ser727 in THP-1-IL-32θ cells. Therefore, we can conclude that IL-32θ mediates phosphorylation of STAT3 at Ser727, leading to its inactivation. After finding that STAT3 is involved in IL-32θ signaling, we examined the mechanism by which IL-32θ regulates STAT3 phosphorylation. PKCδ is activated by PMA [74,78] and is an established regulator of STAT3 activity [46]. Thus, we investigated whether PKCδ is involved in this regulatory pathway. It has been previously shown that PKCδ interacts with STAT3 and mediates its phosphorylation at Ser727 [28]. We observed that PKCδ interacted with IL-32θ upon PMA stimulation,

forming a trimeric complex with IL-32θ and STAT3. These results suggest that this complex formation facilitates the IL-32θ induction of STAT3 phosphorylation on Ser727, which is regulated by PKCδ. We also identified that this action of IL-32θ is mediated by PKCδ, and it inhibits STAT3 activity. Through its physical interaction with PKCδ, STAT3 is phosphorylated at Ser727, inhibiting its trans-activating activity, and thereby repressing STAT3-mediated CCL5 expression. Based on this finding, it is conceivable that IL-32θ interacts with PMA-activated PKCδ, resulting in STAT3 phosphorylation at Ser727. In addition, IL32θ-mediated phosphorylation of STAT3 on Ser727 hinders its capacity to bind DNA and inhibits CCL5 gene transcription. To further confirm these results, we performed immunofluorescence to track STAT3 translocation to the nucleus (Supplementary Fig. 4). It is well known that STAT3 translocates to nucleus to induce gene transcription [79]. IL-32θ inhibits STAT3 translocation even under PMA stimulation. These results are in coincidence with a previous report that the transcriptional activation of the CCL5 promoter occurs by the binding of STAT3 to regulatory elements in the CCL5 promoter [56]. Furthermore, unphosphorylated STAT3 has been shown to compete with IκB to form a transcriptional complex with unphosphorylated NF-κB to induce CCL5 expression [57] . Further study is required to determine whether the phosphorylation of STAT3 at Ser727 induces a conformational change in STAT3, resulting in transcriptional inactivation of the CCL5 promoter. Our data provide evidence that PKCδ acts as a serine kinase of STAT3 during IL-32θ signaling, and that IL-32θ inhibits CCL5 by inducing STAT3 phosphorylation. Furthermore, the interaction of IL-32θ with PKCδ facilitates its serine kinase activity. Overall, this study demonstrates that IL32θ is a potent anti-inflammatory cytokine that can block CCL5 signaling by regulating STAT3 phosphorylation on Ser727. This study provides additional insights into the cellular biological role of IL-32θ as an intracellular modulator in inflammation and cancer progression, and highlights its potential as a therapeutic target.

3014

Y. Bak et al. / Cellular Signalling 26 (2014) 3007–3015

Fig. 6. IL-32θ regulates CCL5 promoter activity through STAT3 phosphorylation. (A) A chromatin immunoprecipitation (ChIP) assay was performed with THP-1-EV cells and THP-1-IL-32 cells stimulated with 10 nM PMA. The consensus binding site sequence of STAT3 and its putative binding site on the CCL5 promoter are shown. STAT3-DNA interactions were measured by quantitative real-time PCR. (B) The CCL5 promoter-firefly luciferase reporter plasmid (1 μg), STAT3 (1 μg), and IL-32θ (1 μg) were transfected into THP-1 cells in pairwise combinations. After an overnight incubation, cells were stimulated with 10 nM PMA for an additional 24 h. Data are expressed as the mean ± SEM. A significant difference in STAT3 binding in the presence of IL-32θ was observed, *p b 0.05.

Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.cellsig.2014.09.015. Acknowledgments This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean Government (2012R1A2A2A 02008751, 2013-A423-0061). DYY was partially supported by the Priority Research Centers Programs (2012-0006686). References [1] C.A. Dahl, R.P. Schall, H.L. He, J.S. Cairns, J. Immunol. 148 (1992) 597–603. [2] J. Choi, S. Bae, J. Hong, S. Ryoo, H. Jhun, K. Hong, D. Yoon, S. Lee, E. Her, W. Choi, J. Kim, T. Azam, C.A. Dinarello, S. Kim, Proc. Natl. Acad. Sci. U. S. A. 107 (2010) 21082–21086. [3] J.A. Zepp, C.A. Nold-Petry, C.A. Dinarello, M.F. Nold, J. Immunol. 186 (2011) 4110–4118.

[4] E. Turner-Brannen, K.Y. Choi, R. Arsenault, H. El-Gabalawy, S. Napper, N. Mookherjee, J. Immunol. 186 (2011) 7127–7135. [5] S. Cheon, J.H. Lee, S. Park, S.I. Bang, W.J. Lee, D.Y. Yoon, S.S. Yoon, T. Kim, H. Min, B.J. Cho, H.J. Lee, K.W. Lee, S.H. Jeong, H. Park, D. Cho, J. Biol. Chem. 286 (2011) 12049–12055. [6] J. Hong, S. Bae, Y. Kang, D. Yoon, X. Bai, E.D. Chan, T. Azam, C.A. Dinarello, S. Lee, E. Her, G. Rho, S. Kim, Cytokine 49 (2010) 171–176. [7] J.H. Oh, M.C. Cho, J.H. Kim, S.Y. Lee, H.J. Kim, E.S. Park, J.O. Ban, J.W. Kang, D.H. Lee, J.H. Shim, S.B. Han, D.C. Moon, Y.H. Park, D.Y. Yu, J.M. Kim, S.H. Kim, D.Y. Yoon, J.T. Hong, Oncogene 30 (2011) 3345–3359. [8] S.H. Kim, S.Y. Han, T. Azam, D.Y. Yoon, C.A. Dinarello, Immunity 22 (2005) 131–142. [9] J.D. Choi, S.Y. Bae, J.W. Hong, T. Azam, C.A. Dinarello, E. Her, W.S. Choi, B.K. Kim, C.K. Lee, D.Y. Yoon, S.J. Kim, S.H. Kim, Immunology 126 (2009) 535–542. [10] C. Goda, T. Kanaji, S. Kanaji, G. Tanaka, K. Arima, S. Ohno, K. Izuhara, Int. Immunol. 18 (2006) 233–240. [11] D. Novick, M. Rubinstein, T. Azam, A. Rabinkov, C.A. Dinarello, S.H. Kim, Proc. Natl. Acad. Sci. U. S. A. 103 (2006) 3316–3321. [12] J.W. Kang, Y.S. Park, D.H. Lee, M.S. Kim, Y. Bak, S.Y. Ham, S.H. Park, H. Kim, J.H. Ahn, J.T. Hong, D.Y. Yoon, Biochimie 101 (2014) 248–251. [13] J.W. Kang, Y.S. Park, M.S. Kim, D.H. Lee, Y. Bak, S.Y. Ham, S.H. Park, J.T. Hong, D.Y. Yoon, J. Biol. Chem. 288 (2013) 23650–23658. [14] N.Y. Ko, S.H. Mun, S.H. Lee, J.W. Kim, D.K. Kim, H.S. Kim, E. Her, S.H. Kim, H.S. Won, H.S. Shin, H.S. Kim, Y.M. Kim, W.S. Choi, Immunobiology 216 (2011) 32–40. [15] J.W. Kang, S.C. Choi, M.C. Cho, H.J. Kim, J.H. Kim, J.S. Lim, S.H. Kim, J.Y. Han, D.Y. Yoon, Immunology 128 (2009) e532–e540. [16] L.A. Joosten, M.G. Netea, S.H. Kim, D.Y. Yoon, B. Oppers-Walgreen, T.R. Radstake, P. Barrera, F.A. van de Loo, C.A. Dinarello, W.B. van den Berg, Proc. Natl. Acad. Sci. U. S. A. 103 (2006) 3298–3303. [17] M. Shioya, A. Nishida, Y. Yagi, A. Ogawa, T. Tsujikawa, S. Kim-Mitsuyama, A. Takayanagi, N. Shimizu, Y. Fujiyama, A. Andoh, Clin. Exp. Immunol. 149 (2007) 480–486. [18] M.G. Netea, T. Azam, G. Ferwerda, S.E. Girardin, M. Walsh, J.S. Park, E. Abraham, J.M. Kim, D.Y. Yoon, C.A. Dinarello, S.H. Kim, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 16309–16314. [19] S.T. Rasool, H. Tang, J. Wu, W. Li, M.M. Mukhtar, J. Zhang, Y. Mu, H.X. Xing, Y. Zhu, Immunol. Lett. 117 (2008) 161–167. [20] W. Li, Y. Liu, M.M. Mukhtar, R. Gong, Y. Pan, S.T. Rasool, Y. Gao, L. Kang, Q. Hao, G. Peng, Y. Chen, X. Chen, J. Wu, Y. Zhu, PLoS One 3 (2008) e1985. [21] L.V. Dekker, P.J. Parker, Trends Biochem. Sci. 19 (1994) 73–77. [22] A. Toker, Front. Biosci. 3 (1998) D1134–D1147. [23] D. Ron, M.G. Kazanietz, FASEB J. 13 (1999) 1658–1676. [24] C.M. Liedtke, T. Cole, M. Ikebe, Am. J. Physiol. 273 (1997) C937–C943. [25] P.J. Parker, J. Murray-Rust, J. Cell Sci. 117 (2004) 131–132. [26] D. Mochly-Rosen, Science 268 (1995) 247–251. [27] D. Mochly-Rosen, H. Khaner, J. Lopez, Proc. Natl. Acad. Sci. U. S. A. 88 (1991) 3997–4000. [28] N. Jain, T. Zhang, W.H. Kee, W. Li, X. Cao, J. Biol. Chem. 274 (1999) 24392–24400. [29] Y. Nishizuka, FASEB J. 9 (1995) 484–496. [30] A.C. Newton, Curr. Opin. Cell Biol. 9 (1997) 161–167. [31] L.E. Kilpatrick, Y.H. Song, M.W. Rossi, H.M. Korchak, Am. J. Physiol. Cell Physiol. 279 (2000) C2011–C2018. [32] L. Braiman, A. Alt, T. Kuroki, M. Ohba, A. Bak, T. Tennenbaum, S.R. Sampson, Mol. Endocrinol. 15 (2001) 565–574. [33] F. De Vita, M. Riccardi, D. Malanga, M. Scrima, C. De Marco, G. Viglietto, Cell Cycle 11 (2012) 1583–1592. [34] M. Hamdorf, A. Berger, S. Schule, J. Reinhardt, E. Flory, Stem Cells 29 (2011) 297–306. [35] C.M. Horvath, Trends Biochem. Sci. 25 (2000) 496–502. [36] S. Akira, Stem Cells 17 (1999) 138–146. [37] S. Akira, Oncogene 19 (2000) 2607–2611. [38] J.E. Darnell Jr., I.M. Kerr, G.R. Stark, Science 264 (1994) 1415–1421. [39] D.E. Levy, J.E. Darnell Jr., Nat. Rev. Mol. Cell Biol. 3 (2002) 651–662. [40] E.B. Haura, J. Turkson, R. Jove, Nat. Clin. Pract. Oncol. 2 (2005) 315–324. [41] D.R. Hodge, E.M. Hurt, W.L. Farrar, Eur. J. Cancer 41 (2005) 2502–2512. [42] N. Stahl, T.J. Farruggella, T.G. Boulton, Z. Zhong, J.E. Darnell Jr., G.D. Yancopoulos, Science 267 (1995) 1349–1353. [43] J. Bromberg, J.E. Darnell Jr., Oncogene 19 (2000) 2468–2473. [44] J.N. Ihle, Cell 84 (1996) 331–334. [45] J.F. Bromberg, C.M. Horvath, D. Besser, W.W. Lathem, J.E. Darnell Jr., Mol. Cell. Biol. 18 (1998) 2553–2558. [46] M. Gartsbein, A. Alt, K. Hashimoto, K. Nakajima, T. Kuroki, T. Tennenbaum, J. Cell Sci. 119 (2006) 470–481. [47] C.P. Lim, X. Cao, J. Biol. Chem. 274 (1999) 31055–31061. [48] T. Decker, P. Kovarik, Oncogene 19 (2000) 2628–2637. [49] J. Turkson, T. Bowman, J. Adnane, Y. Zhang, J.Y. Djeu, M. Sekharam, D.A. Frank, L.B. Holzman, J. Wu, S. Sebti, R. Jove, Mol. Cell. Biol. 19 (1999) 7519–7528. [50] T.J. Schall, J. Jongstra, B.J. Dyer, J. Jorgensen, C. Clayberger, M.M. Davis, A.M. Krensky, J. Immunol. 141 (1988) 1018–1025. [51] T.J. Schall, K. Bacon, K.J. Toy, D.V. Goeddel, Nature 347 (1990) 669–671. [52] Y. Kameyoshi, A. Dorschner, A.I. Mallet, E. Christophers, J.M. Schroder, J. Exp. Med. 176 (1992) 587–592. [53] A. Rot, M. Krieger, T. Brunner, S.C. Bischoff, T.J. Schall, C.A. Dahinden, J. Exp. Med. 176 (1992) 1489–1495. [54] C.A. Dahinden, T. Geiser, T. Brunner, V. von Tscharner, D. Caput, P. Ferrara, A. Minty, M. Baggiolini, J. Exp. Med. 179 (1994) 751–756.

Y. Bak et al. / Cellular Signalling 26 (2014) 3007–3015 [55] A. Schober, D. Manka, P. von Hundelshausen, Y. Huo, P. Hanrath, I.J. Sarembock, K. Ley, C. Weber, Circulation 106 (2002) 1523–1529. [56] J.C. Kovacic, R. Gupta, A.C. Lee, M. Ma, F. Fang, C.N. Tolbert, A.D. Walts, L.E. Beltran, H. San, G. Chen, C. St Hilaire, M. Boehm, J. Clin. Invest. 120 (2010) 303–314. [57] J. Yang, X. Liao, M.K. Agarwal, L. Barnes, P.E. Auron, G.R. Stark, Genes Dev. 21 (2007) 1396–1408. [58] J.J. Yun, M.P. Fischbein, H. Laks, Y. Irie, M.L. Espejo, M.C. Fishbein, J.A. Berliner, A. Ardehali, Transplantation 71 (2001) 1649–1656. [59] Y.S. Bae, J.H. Lee, S.H. Choi, S. Kim, F. Almazan, J.L. Witztum, Y.I. Miller, Circ. Res. 104 (2009) 210–218 (21p following 218). [60] O. Devergne, A. Marfaing-Koka, T.J. Schall, M.B. Leger-Ravet, M. Sadick, M. Peuchmaur, M.C. Crevon, K.J. Kim, T.T. Schall, T. Kim, J. Exp. Med. 179 (1994) 1689–1694. [61] R. Alam, J. York, M. Boyars, S. Stafford, J.A. Grant, J. Lee, P. Forsythe, T. Sim, N. Ida, Am. J. Respir. Crit. Care Med. 153 (1996) 1398–1404. [62] L. Boiardi, P. Macchioni, R. Meliconi, L. Pulsatelli, A. Facchini, C. Salvarani, Clin. Exp. Rheumatol. 17 (1999) 419–425. [63] V. Braunersreuther, S. Steffens, C. Arnaud, G. Pelli, F. Burger, A. Proudfoot, F. Mach, Arterioscler. Thromb. Vasc. Biol. 28 (2008) 1090–1096. [64] S.C. Robinson, K.A. Scott, J.L. Wilson, R.G. Thompson, A.E. Proudfoot, F.R. Balkwill, Cancer Res. 63 (2003) 8360–8365. [65] G. Soria, A. Ben-Baruch, Cancer Lett. 267 (2008) 271–285. [66] P.J. Nelson, H.T. Kim, W.C. Manning, T.J. Goralski, A.M. Krensky, J. Immunol. 151 (1993) 2601–2612.

3015

[67] A. Song, T. Nikolcheva, A.M. Krensky, Immunol. Rev. 177 (2000) 236–245. [68] P.J. Nelson, B.D. Ortiz, J.M. Pattison, A.M. Krensky, J. Immunol. 157 (1996) 1139–1148. [69] H. Moriuchi, M. Moriuchi, A.S. Fauci, J. Immunol. 158 (1997) 3483–3491. [70] J.W. Kang, Y.S. Park, D.H. Lee, J.H. Kim, M.S. Kim, Y. Bak, J. Hong, D.Y. Yoon, J. Biol. Chem. 287 (2012) 35556–35564. [71] P.J. Wermuth, S. Addya, S.A. Jimenez, PLoS One 6 (2011) e27110. [72] K.H. Kim, J.H. Shim, E.H. Seo, M.C. Cho, J.W. Kang, S.H. Kim, D.Y. Yu, E.Y. Song, H.G. Lee, J.H. Sohn, J. Kim, C.A. Dinarello, D.Y. Yoon, J. Immunol. Methods 333 (2008) 38–50. [73] T. Czymai, D. Viemann, C. Sticht, G. Molema, M. Goebeler, M. Schmidt, J. Biol. Chem. 285 (2010) 10163–10178. [74] M. Kuroki, J.T. O'Flaherty, J. Biochem, 341 (Pt 3) (1999) 691–696. [75] N. Furukawa, T. Shirotani, E. Araki, K. Kaneko, M. Todaka, K. Matsumoto, K. Tsuruzoe, H. Motoshima, K. Yoshizato, H. Kishikawa, M. Shichiri, Endocr. J. 46 (1999) 43–58. [76] G.B. Ehret, P. Reichenbach, U. Schindler, C.M. Horvath, S. Fritz, M. Nabholz, P. Bucher, J. Biol. Chem. 276 (2001) 6675–6688. [77] G. Mabilleau, A. Sabokbar, PLoS One 4 (2009) e4173. [78] M. Shanmugam, N.L. Krett, C.A. Peters, E.T. Maizels, F.M. Murad, H. Kawakatsu, S.T. Rosen, M. Hunzicker-Dunn, Oncogene 16 (1998) 1649–1654. [79] Y. Yahata, Y. Shirakata, S. Tokumaru, K. Yamasaki, K. Sayama, Y. Hanakawa, M. Detmar, K. Hashimoto, J. Biol. Chem. 278 (2003) 40026–40031.