- Email: [email protected]
IL-6 and its soluble receptor augment aggrecanase-mediated proteoglycan catabolism in articular cartilage
Matrix Biology 19 Ž2000. 549᎐553
Short note
IL-6 and its soluble receptor augment aggrecanase-mediated proteoglycan catabolism in articular cartilage Carl R. Flannery a,U , Chris B. Little a , Clare E. Hughes a , Clare L. Curtis a , Bruce Caterson a , Simon A. Jones b a
Connecti¨ e Tissue Biology Research Group, Cardiff School of Biosciences, Cardiff Uni¨ ersity, Museum A¨ enue, Cardiff CF10 3US, UK b Molecular Entomology and Enzymology Research Group, Cardiff School of Biosciences, Cardiff Uni¨ ersity, Museum A¨ enue, Cardiff CF10 3US, UK Received 27 June 2000; received in revised form 24 July 2000; accepted 28 July 2000
Abstract Elevated concentrations of interleukin-6 ŽIL-6. and soluble IL-6 receptor ŽsIL-6R. in the synovial fluids and serum of patients with arthritis have been implicated in the joint tissue destruction associated with these conditions, however studies conducted to date on the role and effects of IL-6 in the process of cartilage proteoglycan Žaggrecan. catabolism are disparate. In the present study, bovine articular cartilage explants were maintained in a model organ culture system in the presence or absence of IL-1␣ or TNF-␣, and under co-stimulation with or without IL-6 andror sIL-6R. After measuring proteoglycan loss from the explants, the proteolytic activity and expression profiles of aggrecanaseŽs. was assessed for each culture condition. Stimulation of cartilage explants with IL-6 andror sIL-6R potentiated aggrecan catabolism and release above that seen in the presence of IL-1␣ or TNF-␣ alone. This catabolism was associated with aggrecanase Žbut not MMP. activity, with correlative mRNA expression for aggrecanase-2. 䊚 2000 Elsevier Science B.V.rInternational Society of Matrix Biology. All rights reserved. Keywords: ADAMTS; Aggrecan; Arthritis; Cytokines; Synovial joint
1. Introduction Erosion of articular cartilage and subsequent loss of joint functionality is a cardinal feature of arthritic diseases. Degradation of the cartilage proteoglycan ŽPG. aggrecan, and its consequent loss from the tissue, is an early and persistent event in this process and ultimately renders articular cartilage incapable of
Abbreviations: GAG, glycosaminoglycan; IL, interleukin; MMP, matrix metalloproteinase; MAb, monoclonal antibody; PG, proteoglycan; sIL-6R, soluble IL-6 receptor; TNF, tumor necrosis factor U Corresponding author. Tel.: q44-29-2087-4593; fax: q44-292087-4594. E-mail address: [email protected] ŽC.R. Flannery..
resisting compressive joint loading. Aggrecan catabolism can be potentiated by exposure to IL-1 and TNF-␣, proinflammatory cytokines which affect the expression andror activities of matrix degrading enzymes. In articular cartilage, it is now well established that the principal proteolytic activity responsible for aggrecan turnover is engendered by ‘aggrecanaseŽs.’ Žfor recent review see Caterson et al., 2000.. IL-1 and TNF-␣ can also stimulate the production of IL-6 by articular cartilage chondrocytes ŽBender et al., 1990; Guerne et al., 1990. and elevated IL-6 levels correlate with inflammatory and erosive arthritides ŽDesgeorges et al., 1997; Uson et al., 1997.. Furthermore, a prominent role for IL-6 participation in the progression of arthritic lesions is emphasized
0945-053Xr00r$ - see front matter 䊚 2000 Elsevier Science B.V.rInternational Society of Matrix Biology. All rights reserved. PII: S 0 9 4 5 - 0 5 3 X Ž 0 0 . 0 0 1 1 1 - 6
550
C.R. Flannery et al. r Matrix Biology 19 (2000) 549᎐553
by recent reports demonstrating that IL-6-deficient mice are not susceptible to collagen- or antigeninduced arthritis ŽAlonzi et al., 1998; Boe et al., 1999.. Contradictory results have been reported on the effects of IL-6 on cartilage PG catabolism. Independent studies have reported that IL-6 can either protect against ŽShingu et al., 1995., enhance ŽJikko et al., 1998., or not affect ŽMalfait et al., 1994. IL-1induced PG catabolism in different culture systems Ži.e. chondrocytes grown as monolayers or embedded in agarose.. However, cellular responses to IL-6 can also be implemented via gp130-mediated signalling through interaction of IL-6 with a soluble form of the IL-6R ŽsIL-6R., which is released by either differential IL-6R mRNA splicing or proteolytic shedding from the cell membrane Žfor recent review see Jones et al., 2000.. In the present study we investigated whether IL-6 and sIL-6R, either separately or in combination, can influence the catabolism of aggrecan in situ in articular cartilage explants maintained in an organ culture system which closely mimics the environment experienced by chondrocytes in vivo.
2. Results 2.1. Effect of IL-6 and sIL-6R on proteoglycan catabolism and aggrecanase acti¨ ity Articular cartilage explants maintained in the absence of IL-1␣ or TNF-␣ and exposed to IL-6, sIL-6R or IL-6 and sIL-6R together did not release significantly more GAG than unstimulated control cultures ŽFig. 1a.. Cultures maintained in the presence of IL-1 or TNF released significantly more GAG into the medium compared to cultures maintained in the absence of IL-1 or TNF, and co-stimulation of IL-1-treated explants with IL-6 and sIL-6R together, or TNF-treated explants with IL-6, sIL-6R, or IL-6 and sIL-6R together, significantly increased GAG release into the medium, compared to corresponding cultures maintained in the absence of IL-6 andror sIL-6R ŽFig. 1b,c.. Immunoblot analyses of aggrecan fragments released into the culture media revealed the occurrence of aggrecanase activity. A range of MAb BC-3-reactive catabolites Žgenerated by aggrecanase cleavage of the Glu 373 ᎐Ala374 bond. demonstrated proteolysis both within the interglobular domain ŽIGD. as well as within the C-terminal regions of aggrecan core proteins ŽFig. 2.. Interestingly, explants cultured in the absence of IL-1 or TNF, but stimulated with sIL-6R or IL-6 and sIL-6R together, caused an increase in aggrecanase-generated products ŽFig. 2b, lanes 3 and 4. without significantly enhancing GAG loss ŽFig. 1a.. No immunopositive staining was observed for replicate Western blot analyses per-
Fig. 1. Effect of culture conditions on release of proteoglycan Žsulfated GAG. from explant cultures. Bovine articular cartilage explants were cultured for 4 days in the absence Ža. or presence of 0.1 ngrml IL-1␣ Žb. or 100 ngrml TNF-␣ Žc., and under co-stimulation with 50 ngrml IL-6, 250 ngrml sIL-6R, or IL-6 and sIL-6R together. U Significantly different from IL-1- or TNF-treated cultures maintained in the absence of IL-6 andror sIL-6R Ž P F 0.05.. ‡Significantly different from cultures maintained in the presence of IL-6 alone or sIL-6R alone Ž P F 0.05.. n s 6 individual explants for each culture condition.
formed using MAb BC-14, which specifically detects MMP-generated aggrecan catabolites Ždata not shown.. 2.2. mRNA expression in explant cultures Expression of aggrecanase-1 mRNA was not observed in any of the explant cultures ŽTable 1., although the oligonucleotide primers used for those RT-PCR analyses have been previously used to amplify the expected product from bovine chondrocyte mRNA preparations ŽCurtis et al., 2000.. Aggrecanase-2 mRNA was detected in cultures exposed to IL-1-␣ or TNF-␣, both in the presence or absence of co-stimulation with IL-6, sIL-6R or IL-6 and sIL-6R together ŽTable 1.. In addition, expression of IL-6 and gp130 mRNA was detected in explants maintained under all culture conditions ŽTable 1., thus confirming the capacity for chondrocytes to synthesize IL-6 and modulate their own phenotype via this signalling pathway, as well as explicating the source of ligand in explant cultures which responded to sIL-6R in the absence of exogenously added IL-6 Žsee Figs. 1 and 2..
3. Discussion Catabolism of aggrecan in situ in articular cartilage involves aggrecanase-mediated cleavage at specific Glu᎐Xaa peptide bonds located within the core pro-
C.R. Flannery et al. r Matrix Biology 19 (2000) 549᎐553
Fig. 2. Aggrecanase specificity and cytokine-induced activity in explant cultures. Ža. Schematic representation of the aggrecan core protein depicting the relative positions of known aggrecanase cleavage sites ŽGlu-Xaa.. G1r2r3, globular domains 1r2r3; IGD, interglobular domain; KS, keratan sulphate substitution domain; CS, chondroitin sulphate substitution domains. Žb. Bovine articular cartilage explants were cultured for 4 days in the absence Žlanes 1᎐4. or presence of 0.1 ngrml IL-1␣ Žlanes 5᎐8. or 100 ngrml TNF-␣ Žlanes 9᎐12., and under co-stimulation with 50 ngrml IL-6, 250 ngrml sIL-6R, or IL-6 and sIL-6R together. Western blot analyses of aggrecan fragments released into the culture media were performed utilising monoclonal antibody BC-3 which specifically detects the neoepitope sequence 374ARGSV . . . generated by aggrecanase cleavage at the Glu 373 ᎐Ala374 peptide bond. The migration positions of globular protein standards is indicated on the left.
551
1999.. Whilst it is well established that cytokines such as IL-1 and TNF-␣ can upregulate chondrocyte aggrecanase activity ŽArner et al., 1998 and references therein ., relatively little is known about the effects of other cytokines implicated in this process. Elevated levels of IL-6 and IL-6R in the serum and synovial fluids of patients with various arthropathies ŽDesgeorges et al., 1997; Uson et al., 1997. strongly suggests a role for this pleiotropic cohort in synovial joint tissue destruction. In the present study, IL-6 and sIL-6R were shown to augment aggrecanase-mediated protoeoglycan catabolism under conditions of elevated matrix degradation in situ in articular cartilage explants, potentiating the effects of both IL-1␣ and TNF-␣. While both IL-6 and sIL-6R together were required to further increase aggrecan degradation in IL-1-treated cultures ŽFig. 1b., either IL-6 alone or sIL-6R alone enhanced TNF-␣ induced aggrecanolysis ŽFig. 1c.. Co-stimulation of TNF-treated explants with both IL-6 and sIL-6R together resulted in an even greater loss of aggrecan from the tissue ŽFig. 1c., thereby illustrating the capacity for discrete metabolic changes in chondrocytes in response to the particular medley of cytokines Žand other effector molecules. which they encounter. In vivo, the effects of IL-6 andror sIL-6R on articular cartilage are thus likely to be dependent on both the typeŽs. and concentration Žs. of other cytokines present Ži.e. IL-1 andror TNF-␣ ., and as such may be elicited in a temporal fashion during the progression of arthritic diseases.
4. Experimental procedures tein Žsee Fig. 2a.. Primary cleavage at Glu 373 ᎐Ala374 within the aggrecan interglobular domain separates the hyaluronan-binding G1 domain from the molecule, thus allowing GAG-bearing fragments to diffuse from the cartilage. Recently, two members of the ‘A Disintegrin and Metalloproteinase with Thrombospondin motifs’ ŽADAMTS. gene family with aggrecanase activity have been identified and designated aggrecanase-1rADAMTS-4 ŽTortorella et al., 1999. and aggrecanase-2rADAMTS-5r-11 ŽAbbaszade et al.,
4.1. Cartilage isolation and culture Bovine articular cartilage was obtained from the metacarpophalangeal joints of 1᎐2 week-old-calves. Explant cultures Ž10᎐20 mg wet wt. of cartilage. were established as described ŽLittle et al., 1999. and maintained for 4 days in 1 ml of DMEM in the presence or absence of 0.1 ngrml recombinant human IL-1␣ or 100 ngrml recombinant human TNF-␣ ŽSigma-
Table 1 mRNA expression in cartilage explant cultures Ž⭋, not detected; 6, detected. Culture treatment
Aggrecanase-1
Aggrecanase-2
IL-6
gp130
No IL-1 or TNF qIL-1 qTNF
⭋ ⭋ ⭋ ⭋ ⭋ ⭋ ⭋ ⭋ ⭋ ⭋ ⭋ ⭋
⭋ ⭋ ⭋ ⭋ 6 6 6 6 6 6 6 6
6 6 6 6 6 6 6 6 6 6 6 6
6 6 6 6 6 6 6 6 6 6 6 6
IL-6 sIL-6R
Iqyq IIHH
IHIH IIHH
IHIH IIHH
IHI H IIH H
552
C.R. Flannery et al. r Matrix Biology 19 (2000) 549᎐553
Aldrich Co.., and in the presence or absence of 50 ngrml recombinant human IL-6 ŽPromega UK., 250 ngrml recombinant human sIL-6R ŽR&D Systems Europe, Ltd.., or both IL-6 and sIL-6R together. Following this culture period, conditioned media was collected and analyzed for proteoglycan content and for evidence of aggrecanase or MMP activities, and the explant tissue was processed for mRNA analyses Žsee below..
GTRGAAGCA and GGTGCTYTRGATGGTCTRTCT; GenBank TM accession numbers M57230 and X62646.. PCR products were separated on 3% agarose gels stained with ethidium bromide, and their nucleotide sequences verified using an ABI 310 Genetic Analyzer.
4.2. Quantification of proteoglycans
This research was funded by the Arthritis Research Campaign ŽARC., UK. Dr C.R. Flannery and Dr C.E. Hughes are ARC Postdoctoral Research Fellows.
Proteoglycan content in the medium of cartilage explant cultures was measured by dimethylmethylene blue assay as described ŽLittle et al., 1999.. Differences in the release of sulfated GAG Žexpressed as g GAG per mg wet wt. of cartilage. associated with culture treatment were assessed using a two-factor analysis of variance and Fisher’s post hoc analysis of least significant difference. All data were analysed using the Stat View software package for Macintosh ŽAcura., with P values F 0.05 being considered statistically significant. 4.3. Western blot analyses of aggrecanase- or MMPgenerated aggrecan catabolites Portions of conditioned media containing an equivalent quantity of proteoglycan metabolites Žmeasured as sulfated GAG. were analyzed by SDS-PAGE and Western blotting as previously described ŽLittle et al., 1999.. Aggrecan fragments were electrophoretically transferred to nitrocellulose membranes and immunodetected using monoclonal antibody BC-3 Žwhich specifically recognizes the aggrecanase-generated neoepitope N-terminal sequence 374ARGSV... on aggrecan metabolites; see Fig. 2a. or monoclonal antibody BC-14 Žwhich specifically recognizes the MMPgenerated neoepitope N-terminal sequence 342 FFGVG... on aggrecan metabolites. ŽLittle et al., 1999. . 4.4. RNA extraction and RT-PCR analyses Total RNA was extracted from cartilage samples and analyzed by RT-PCR as described ŽFlannery et al., 1999. using oligonucleotide primers corresponding to cDNA sequences for human aggrecanase-1 ŽACCACTTTGACACAGCCATTC and ACCCCCACAGGTCCGAGAGCA; GenBank TM accession number AF148213., human aggrecanase-2 ŽTGTGCTG TG A TTG A A G A CG A T and G A CT GCAGGAGCGGTAGATGG; GenBank TM accession number AF142099., bovine IL-6 ŽTGGAGGAAAAGGACGGATGCT and TGGCTGGAGTGGTTATTAGAT; GenBank TM accession number X57317., and human and mouse gp130 ŽATTGAAGTCTGG-
Acknowledgements
References Abbaszade, I., Liu, R.-Q., Yang, F. et al., 1999. Cloning and characterization of ADAMTS11, an aggrecanase from the ADAMTS family. J. Biol. Chem. 274, 23443᎐23450. Alonzi, T., Fattori, E., Lazzaro, D. et al., 1998. Interleukin 6 is required for the development of collagen-induced arthritis. J. Exp. Med. 187, 461᎐468. Arner, E.C., Hughes, C.E., Decicco, C.P., Caterson, B., Tortorella, M.D., 1998. Cytokine-induced cartilage proteoglycan degradation is mediated by aggrecanase. Osteoarthritis Cartilage 6, 214᎐228. Bender, S., Haubeck, H.-D., Van de Leur, E. et al., 1990. Interleukin-1beta induces synthesis and secretion of interleukin-6 in human chondrocytes. FEBS Lett. 263, 321᎐324. Boe, A., Baiocchi, M., Carbonatto, M., Papoian, R., Serlupi-Crescenzi, O., 1999. Interleukin 6 knock-out mice are resistant to antigen-induced experimental arthritis. Cytokine 11, 1057᎐1064. Caterson, B., Flannery, C.R., Hughes, C.E., Little, C.B., 2000. Mechanisms involved in cartilage proteoglycan catabolism. Matrix Biol 19, 333᎐344. Curtis, C.L., Hughes, C.E., Flannery, C.R., Little, C.B., Harwood, J.L., Caterson, B., 2000. n-3 fatty acids specifically modulate catabolic factors involved in articular cartilage degradation. J. Biol. Chem. 275, 721᎐724. Desgeorges, A., Gabay, C., Silacci, P. et al., 1997. Concentrations and origins of soluble interleukin 6 receptor-alpha in serum and synovial fluid. J. Rheumatol. 24, 1510᎐1516. Flannery, C.R., Little, C.B., Caterson, B., Hughes, C.E., 1999. Effects of culture conditions and exposure to catabolic stimulators ŽIL-1 and retinoic acid. on the expression of matrix metalloproteinases ŽMMPs. and disintegrin metalloproteinases ŽADAMs. by articular cartilage chondrocytes. Matrix Biol. 18, 225᎐237. Guerne, P.A., Carson, D.A., Lotz, M., 1990. IL-6 production by human articular chondrocytes. Modulation of its synthesis by cytokines, growth factors, and hormones in vitro. J. Immunol. 144, 499᎐505. Jikko, A., Wakisaka, T., Iwamoto, M. et al., 1998. Effects of interleukin-6 on proliferation and proteoglycan metabolism in articular chondrocyte cultures. Cell Biol. Int. 22, 615᎐621. Jones, S.A., Horiuchi, S., Topley, N., Yamamoto, N., Fuller, G.M., 2000. The soluble interleukin-6 receptor: mechanisms of production and implications in disease. FASEB J., in press. Little, C.B., Flannery, C.R., Hughes, C.E. et al., 1999. Aggrecanase versus matrix metalloproteinases in the catabolism of the interglobular domain of aggrecan in vitro. Biochem. J. 344, 61᎐68. Malfait, A.M., Verbruggen, G., Veys, E.M., Lambert, J., De Ridder, L., Cornelissen, M., 1994. Comparative and combined effects of interleukin 6, interleukin 1 beta, and tumor necrosis factor alpha
C.R. Flannery et al. r Matrix Biology 19 (2000) 549᎐553 on proteoglycan metabolism of human articular chondrocytes cultured in agarose. J. Rheumatol. 21, 314᎐320. Shingu, M., Miyauchi, S., Nagai, Y., Yasutake, C., Horie, K., 1995. The role of IL-4 and IL-6 in IL-1-dependent cartilage matrix degradation. Br. J. Rheum. 34, 101᎐106. Tortorella, M.D., Burn, T.C., Pratta, M.D. et al., 1999. Purification
553
and cloning of aggrecanase-1: a member of the ADAMTS family of proteins. Science 284, 1664᎐1666. Uson, J., Balsa, A., Pascual-Salcedo, D. et al., 1997. Soluble interleukin 6 ŽIL-6. receptor and IL-6 levels in serum and synovial fluid of patients with different arthropathies. J. Rheumatol. 24, 2069᎐2075.
Short note
IL-6 and its soluble receptor augment aggrecanase-mediated proteoglycan catabolism in articular cartilage Carl R. Flannery a,U , Chris B. Little a , Clare E. Hughes a , Clare L. Curtis a , Bruce Caterson a , Simon A. Jones b a
Connecti¨ e Tissue Biology Research Group, Cardiff School of Biosciences, Cardiff Uni¨ ersity, Museum A¨ enue, Cardiff CF10 3US, UK b Molecular Entomology and Enzymology Research Group, Cardiff School of Biosciences, Cardiff Uni¨ ersity, Museum A¨ enue, Cardiff CF10 3US, UK Received 27 June 2000; received in revised form 24 July 2000; accepted 28 July 2000
Abstract Elevated concentrations of interleukin-6 ŽIL-6. and soluble IL-6 receptor ŽsIL-6R. in the synovial fluids and serum of patients with arthritis have been implicated in the joint tissue destruction associated with these conditions, however studies conducted to date on the role and effects of IL-6 in the process of cartilage proteoglycan Žaggrecan. catabolism are disparate. In the present study, bovine articular cartilage explants were maintained in a model organ culture system in the presence or absence of IL-1␣ or TNF-␣, and under co-stimulation with or without IL-6 andror sIL-6R. After measuring proteoglycan loss from the explants, the proteolytic activity and expression profiles of aggrecanaseŽs. was assessed for each culture condition. Stimulation of cartilage explants with IL-6 andror sIL-6R potentiated aggrecan catabolism and release above that seen in the presence of IL-1␣ or TNF-␣ alone. This catabolism was associated with aggrecanase Žbut not MMP. activity, with correlative mRNA expression for aggrecanase-2. 䊚 2000 Elsevier Science B.V.rInternational Society of Matrix Biology. All rights reserved. Keywords: ADAMTS; Aggrecan; Arthritis; Cytokines; Synovial joint
1. Introduction Erosion of articular cartilage and subsequent loss of joint functionality is a cardinal feature of arthritic diseases. Degradation of the cartilage proteoglycan ŽPG. aggrecan, and its consequent loss from the tissue, is an early and persistent event in this process and ultimately renders articular cartilage incapable of
Abbreviations: GAG, glycosaminoglycan; IL, interleukin; MMP, matrix metalloproteinase; MAb, monoclonal antibody; PG, proteoglycan; sIL-6R, soluble IL-6 receptor; TNF, tumor necrosis factor U Corresponding author. Tel.: q44-29-2087-4593; fax: q44-292087-4594. E-mail address: [email protected] ŽC.R. Flannery..
resisting compressive joint loading. Aggrecan catabolism can be potentiated by exposure to IL-1 and TNF-␣, proinflammatory cytokines which affect the expression andror activities of matrix degrading enzymes. In articular cartilage, it is now well established that the principal proteolytic activity responsible for aggrecan turnover is engendered by ‘aggrecanaseŽs.’ Žfor recent review see Caterson et al., 2000.. IL-1 and TNF-␣ can also stimulate the production of IL-6 by articular cartilage chondrocytes ŽBender et al., 1990; Guerne et al., 1990. and elevated IL-6 levels correlate with inflammatory and erosive arthritides ŽDesgeorges et al., 1997; Uson et al., 1997.. Furthermore, a prominent role for IL-6 participation in the progression of arthritic lesions is emphasized
0945-053Xr00r$ - see front matter 䊚 2000 Elsevier Science B.V.rInternational Society of Matrix Biology. All rights reserved. PII: S 0 9 4 5 - 0 5 3 X Ž 0 0 . 0 0 1 1 1 - 6
550
C.R. Flannery et al. r Matrix Biology 19 (2000) 549᎐553
by recent reports demonstrating that IL-6-deficient mice are not susceptible to collagen- or antigeninduced arthritis ŽAlonzi et al., 1998; Boe et al., 1999.. Contradictory results have been reported on the effects of IL-6 on cartilage PG catabolism. Independent studies have reported that IL-6 can either protect against ŽShingu et al., 1995., enhance ŽJikko et al., 1998., or not affect ŽMalfait et al., 1994. IL-1induced PG catabolism in different culture systems Ži.e. chondrocytes grown as monolayers or embedded in agarose.. However, cellular responses to IL-6 can also be implemented via gp130-mediated signalling through interaction of IL-6 with a soluble form of the IL-6R ŽsIL-6R., which is released by either differential IL-6R mRNA splicing or proteolytic shedding from the cell membrane Žfor recent review see Jones et al., 2000.. In the present study we investigated whether IL-6 and sIL-6R, either separately or in combination, can influence the catabolism of aggrecan in situ in articular cartilage explants maintained in an organ culture system which closely mimics the environment experienced by chondrocytes in vivo.
2. Results 2.1. Effect of IL-6 and sIL-6R on proteoglycan catabolism and aggrecanase acti¨ ity Articular cartilage explants maintained in the absence of IL-1␣ or TNF-␣ and exposed to IL-6, sIL-6R or IL-6 and sIL-6R together did not release significantly more GAG than unstimulated control cultures ŽFig. 1a.. Cultures maintained in the presence of IL-1 or TNF released significantly more GAG into the medium compared to cultures maintained in the absence of IL-1 or TNF, and co-stimulation of IL-1-treated explants with IL-6 and sIL-6R together, or TNF-treated explants with IL-6, sIL-6R, or IL-6 and sIL-6R together, significantly increased GAG release into the medium, compared to corresponding cultures maintained in the absence of IL-6 andror sIL-6R ŽFig. 1b,c.. Immunoblot analyses of aggrecan fragments released into the culture media revealed the occurrence of aggrecanase activity. A range of MAb BC-3-reactive catabolites Žgenerated by aggrecanase cleavage of the Glu 373 ᎐Ala374 bond. demonstrated proteolysis both within the interglobular domain ŽIGD. as well as within the C-terminal regions of aggrecan core proteins ŽFig. 2.. Interestingly, explants cultured in the absence of IL-1 or TNF, but stimulated with sIL-6R or IL-6 and sIL-6R together, caused an increase in aggrecanase-generated products ŽFig. 2b, lanes 3 and 4. without significantly enhancing GAG loss ŽFig. 1a.. No immunopositive staining was observed for replicate Western blot analyses per-
Fig. 1. Effect of culture conditions on release of proteoglycan Žsulfated GAG. from explant cultures. Bovine articular cartilage explants were cultured for 4 days in the absence Ža. or presence of 0.1 ngrml IL-1␣ Žb. or 100 ngrml TNF-␣ Žc., and under co-stimulation with 50 ngrml IL-6, 250 ngrml sIL-6R, or IL-6 and sIL-6R together. U Significantly different from IL-1- or TNF-treated cultures maintained in the absence of IL-6 andror sIL-6R Ž P F 0.05.. ‡Significantly different from cultures maintained in the presence of IL-6 alone or sIL-6R alone Ž P F 0.05.. n s 6 individual explants for each culture condition.
formed using MAb BC-14, which specifically detects MMP-generated aggrecan catabolites Ždata not shown.. 2.2. mRNA expression in explant cultures Expression of aggrecanase-1 mRNA was not observed in any of the explant cultures ŽTable 1., although the oligonucleotide primers used for those RT-PCR analyses have been previously used to amplify the expected product from bovine chondrocyte mRNA preparations ŽCurtis et al., 2000.. Aggrecanase-2 mRNA was detected in cultures exposed to IL-1-␣ or TNF-␣, both in the presence or absence of co-stimulation with IL-6, sIL-6R or IL-6 and sIL-6R together ŽTable 1.. In addition, expression of IL-6 and gp130 mRNA was detected in explants maintained under all culture conditions ŽTable 1., thus confirming the capacity for chondrocytes to synthesize IL-6 and modulate their own phenotype via this signalling pathway, as well as explicating the source of ligand in explant cultures which responded to sIL-6R in the absence of exogenously added IL-6 Žsee Figs. 1 and 2..
3. Discussion Catabolism of aggrecan in situ in articular cartilage involves aggrecanase-mediated cleavage at specific Glu᎐Xaa peptide bonds located within the core pro-
C.R. Flannery et al. r Matrix Biology 19 (2000) 549᎐553
Fig. 2. Aggrecanase specificity and cytokine-induced activity in explant cultures. Ža. Schematic representation of the aggrecan core protein depicting the relative positions of known aggrecanase cleavage sites ŽGlu-Xaa.. G1r2r3, globular domains 1r2r3; IGD, interglobular domain; KS, keratan sulphate substitution domain; CS, chondroitin sulphate substitution domains. Žb. Bovine articular cartilage explants were cultured for 4 days in the absence Žlanes 1᎐4. or presence of 0.1 ngrml IL-1␣ Žlanes 5᎐8. or 100 ngrml TNF-␣ Žlanes 9᎐12., and under co-stimulation with 50 ngrml IL-6, 250 ngrml sIL-6R, or IL-6 and sIL-6R together. Western blot analyses of aggrecan fragments released into the culture media were performed utilising monoclonal antibody BC-3 which specifically detects the neoepitope sequence 374ARGSV . . . generated by aggrecanase cleavage at the Glu 373 ᎐Ala374 peptide bond. The migration positions of globular protein standards is indicated on the left.
551
1999.. Whilst it is well established that cytokines such as IL-1 and TNF-␣ can upregulate chondrocyte aggrecanase activity ŽArner et al., 1998 and references therein ., relatively little is known about the effects of other cytokines implicated in this process. Elevated levels of IL-6 and IL-6R in the serum and synovial fluids of patients with various arthropathies ŽDesgeorges et al., 1997; Uson et al., 1997. strongly suggests a role for this pleiotropic cohort in synovial joint tissue destruction. In the present study, IL-6 and sIL-6R were shown to augment aggrecanase-mediated protoeoglycan catabolism under conditions of elevated matrix degradation in situ in articular cartilage explants, potentiating the effects of both IL-1␣ and TNF-␣. While both IL-6 and sIL-6R together were required to further increase aggrecan degradation in IL-1-treated cultures ŽFig. 1b., either IL-6 alone or sIL-6R alone enhanced TNF-␣ induced aggrecanolysis ŽFig. 1c.. Co-stimulation of TNF-treated explants with both IL-6 and sIL-6R together resulted in an even greater loss of aggrecan from the tissue ŽFig. 1c., thereby illustrating the capacity for discrete metabolic changes in chondrocytes in response to the particular medley of cytokines Žand other effector molecules. which they encounter. In vivo, the effects of IL-6 andror sIL-6R on articular cartilage are thus likely to be dependent on both the typeŽs. and concentration Žs. of other cytokines present Ži.e. IL-1 andror TNF-␣ ., and as such may be elicited in a temporal fashion during the progression of arthritic diseases.
4. Experimental procedures tein Žsee Fig. 2a.. Primary cleavage at Glu 373 ᎐Ala374 within the aggrecan interglobular domain separates the hyaluronan-binding G1 domain from the molecule, thus allowing GAG-bearing fragments to diffuse from the cartilage. Recently, two members of the ‘A Disintegrin and Metalloproteinase with Thrombospondin motifs’ ŽADAMTS. gene family with aggrecanase activity have been identified and designated aggrecanase-1rADAMTS-4 ŽTortorella et al., 1999. and aggrecanase-2rADAMTS-5r-11 ŽAbbaszade et al.,
4.1. Cartilage isolation and culture Bovine articular cartilage was obtained from the metacarpophalangeal joints of 1᎐2 week-old-calves. Explant cultures Ž10᎐20 mg wet wt. of cartilage. were established as described ŽLittle et al., 1999. and maintained for 4 days in 1 ml of DMEM in the presence or absence of 0.1 ngrml recombinant human IL-1␣ or 100 ngrml recombinant human TNF-␣ ŽSigma-
Table 1 mRNA expression in cartilage explant cultures Ž⭋, not detected; 6, detected. Culture treatment
Aggrecanase-1
Aggrecanase-2
IL-6
gp130
No IL-1 or TNF qIL-1 qTNF
⭋ ⭋ ⭋ ⭋ ⭋ ⭋ ⭋ ⭋ ⭋ ⭋ ⭋ ⭋
⭋ ⭋ ⭋ ⭋ 6 6 6 6 6 6 6 6
6 6 6 6 6 6 6 6 6 6 6 6
6 6 6 6 6 6 6 6 6 6 6 6
IL-6 sIL-6R
Iqyq IIHH
IHIH IIHH
IHIH IIHH
IHI H IIH H
552
C.R. Flannery et al. r Matrix Biology 19 (2000) 549᎐553
Aldrich Co.., and in the presence or absence of 50 ngrml recombinant human IL-6 ŽPromega UK., 250 ngrml recombinant human sIL-6R ŽR&D Systems Europe, Ltd.., or both IL-6 and sIL-6R together. Following this culture period, conditioned media was collected and analyzed for proteoglycan content and for evidence of aggrecanase or MMP activities, and the explant tissue was processed for mRNA analyses Žsee below..
GTRGAAGCA and GGTGCTYTRGATGGTCTRTCT; GenBank TM accession numbers M57230 and X62646.. PCR products were separated on 3% agarose gels stained with ethidium bromide, and their nucleotide sequences verified using an ABI 310 Genetic Analyzer.
4.2. Quantification of proteoglycans
This research was funded by the Arthritis Research Campaign ŽARC., UK. Dr C.R. Flannery and Dr C.E. Hughes are ARC Postdoctoral Research Fellows.
Proteoglycan content in the medium of cartilage explant cultures was measured by dimethylmethylene blue assay as described ŽLittle et al., 1999.. Differences in the release of sulfated GAG Žexpressed as g GAG per mg wet wt. of cartilage. associated with culture treatment were assessed using a two-factor analysis of variance and Fisher’s post hoc analysis of least significant difference. All data were analysed using the Stat View software package for Macintosh ŽAcura., with P values F 0.05 being considered statistically significant. 4.3. Western blot analyses of aggrecanase- or MMPgenerated aggrecan catabolites Portions of conditioned media containing an equivalent quantity of proteoglycan metabolites Žmeasured as sulfated GAG. were analyzed by SDS-PAGE and Western blotting as previously described ŽLittle et al., 1999.. Aggrecan fragments were electrophoretically transferred to nitrocellulose membranes and immunodetected using monoclonal antibody BC-3 Žwhich specifically recognizes the aggrecanase-generated neoepitope N-terminal sequence 374ARGSV... on aggrecan metabolites; see Fig. 2a. or monoclonal antibody BC-14 Žwhich specifically recognizes the MMPgenerated neoepitope N-terminal sequence 342 FFGVG... on aggrecan metabolites. ŽLittle et al., 1999. . 4.4. RNA extraction and RT-PCR analyses Total RNA was extracted from cartilage samples and analyzed by RT-PCR as described ŽFlannery et al., 1999. using oligonucleotide primers corresponding to cDNA sequences for human aggrecanase-1 ŽACCACTTTGACACAGCCATTC and ACCCCCACAGGTCCGAGAGCA; GenBank TM accession number AF148213., human aggrecanase-2 ŽTGTGCTG TG A TTG A A G A CG A T and G A CT GCAGGAGCGGTAGATGG; GenBank TM accession number AF142099., bovine IL-6 ŽTGGAGGAAAAGGACGGATGCT and TGGCTGGAGTGGTTATTAGAT; GenBank TM accession number X57317., and human and mouse gp130 ŽATTGAAGTCTGG-
Acknowledgements
References Abbaszade, I., Liu, R.-Q., Yang, F. et al., 1999. Cloning and characterization of ADAMTS11, an aggrecanase from the ADAMTS family. J. Biol. Chem. 274, 23443᎐23450. Alonzi, T., Fattori, E., Lazzaro, D. et al., 1998. Interleukin 6 is required for the development of collagen-induced arthritis. J. Exp. Med. 187, 461᎐468. Arner, E.C., Hughes, C.E., Decicco, C.P., Caterson, B., Tortorella, M.D., 1998. Cytokine-induced cartilage proteoglycan degradation is mediated by aggrecanase. Osteoarthritis Cartilage 6, 214᎐228. Bender, S., Haubeck, H.-D., Van de Leur, E. et al., 1990. Interleukin-1beta induces synthesis and secretion of interleukin-6 in human chondrocytes. FEBS Lett. 263, 321᎐324. Boe, A., Baiocchi, M., Carbonatto, M., Papoian, R., Serlupi-Crescenzi, O., 1999. Interleukin 6 knock-out mice are resistant to antigen-induced experimental arthritis. Cytokine 11, 1057᎐1064. Caterson, B., Flannery, C.R., Hughes, C.E., Little, C.B., 2000. Mechanisms involved in cartilage proteoglycan catabolism. Matrix Biol 19, 333᎐344. Curtis, C.L., Hughes, C.E., Flannery, C.R., Little, C.B., Harwood, J.L., Caterson, B., 2000. n-3 fatty acids specifically modulate catabolic factors involved in articular cartilage degradation. J. Biol. Chem. 275, 721᎐724. Desgeorges, A., Gabay, C., Silacci, P. et al., 1997. Concentrations and origins of soluble interleukin 6 receptor-alpha in serum and synovial fluid. J. Rheumatol. 24, 1510᎐1516. Flannery, C.R., Little, C.B., Caterson, B., Hughes, C.E., 1999. Effects of culture conditions and exposure to catabolic stimulators ŽIL-1 and retinoic acid. on the expression of matrix metalloproteinases ŽMMPs. and disintegrin metalloproteinases ŽADAMs. by articular cartilage chondrocytes. Matrix Biol. 18, 225᎐237. Guerne, P.A., Carson, D.A., Lotz, M., 1990. IL-6 production by human articular chondrocytes. Modulation of its synthesis by cytokines, growth factors, and hormones in vitro. J. Immunol. 144, 499᎐505. Jikko, A., Wakisaka, T., Iwamoto, M. et al., 1998. Effects of interleukin-6 on proliferation and proteoglycan metabolism in articular chondrocyte cultures. Cell Biol. Int. 22, 615᎐621. Jones, S.A., Horiuchi, S., Topley, N., Yamamoto, N., Fuller, G.M., 2000. The soluble interleukin-6 receptor: mechanisms of production and implications in disease. FASEB J., in press. Little, C.B., Flannery, C.R., Hughes, C.E. et al., 1999. Aggrecanase versus matrix metalloproteinases in the catabolism of the interglobular domain of aggrecan in vitro. Biochem. J. 344, 61᎐68. Malfait, A.M., Verbruggen, G., Veys, E.M., Lambert, J., De Ridder, L., Cornelissen, M., 1994. Comparative and combined effects of interleukin 6, interleukin 1 beta, and tumor necrosis factor alpha
C.R. Flannery et al. r Matrix Biology 19 (2000) 549᎐553 on proteoglycan metabolism of human articular chondrocytes cultured in agarose. J. Rheumatol. 21, 314᎐320. Shingu, M., Miyauchi, S., Nagai, Y., Yasutake, C., Horie, K., 1995. The role of IL-4 and IL-6 in IL-1-dependent cartilage matrix degradation. Br. J. Rheum. 34, 101᎐106. Tortorella, M.D., Burn, T.C., Pratta, M.D. et al., 1999. Purification
553
and cloning of aggrecanase-1: a member of the ADAMTS family of proteins. Science 284, 1664᎐1666. Uson, J., Balsa, A., Pascual-Salcedo, D. et al., 1997. Soluble interleukin 6 ŽIL-6. receptor and IL-6 levels in serum and synovial fluid of patients with different arthropathies. J. Rheumatol. 24, 2069᎐2075.