- Email: [email protected]
c mice vaccinated with DNA vaccine encoding Toxoplasma gondii actin depolymerizing factor gene
Veterinary Parasitology 179 (2011) 1–6
Contents lists available at ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
Immune response and protective efficacy against homologous challenge in BALB/c mice vaccinated with DNA vaccine encoding Toxoplasma gondii actin depolymerizing factor gene Jianhua Li ∗,1 , Xiangsheng Huang 1 , Guocai Zhang, Pengtao Gong, Xichen Zhang ∗ , Ling Wu College of Animal Science and Veterinary Medicine, Jilin University, 5333 Xi’an Road, Changchun, Jilin 130062, China
a r t i c l e
i n f o
Article history: Received 26 July 2010 Received in revised form 4 January 2011 Accepted 3 March 2011 Keywords: Toxoplasma gondii DNA vaccine Actin depolymerizing factor BALB/c mice
a b s t r a c t A DNA vaccine (pVAX1-TgADF) encoding Toxoplasma gondii actin depolymerizing factor (ADF) gene was constructed and the immune response and protective efficacy of this vaccine against homologous challenge in BALB/c mice were evaluated. High titers of specific antibody and increases in the percentage of CD4+ and CD8+ T lymphocyte cells were observed from BALB/c mice vaccinated with pVAX1-TgADF (P < 0.05), when PBS group was used as control. The survival time of BALB/c mice in pVAX1-TgADF group was longer than those in control groups. The numbers of brain cysts in the experimental BALB/c mice immunized with pVAX1-TgADF reduced significantly compared with those in PBS group (P < 0.05), and the rate of reduction could reach to around 42.8%. These results suggested that the DNA vaccine pVAX1-TgADF could generate specific humoral and cellular immune responses, prolong survival times, and reduce brain cysts load against T. gondii infection in BALB/c mice. © 2011 Elsevier B.V. All rights reserved.
1. Introduction Toxoplasma gondii, the etiological agent of toxoplasmosis, is an apicomplexan protozoan parasite infecting most warm-blooded animals and humans, especially in the immunocompromised individuals, such as AIDS patients. T. gondii is the cause for a variety of clinical syndromes. During pregnancy, the primary infection could lead to congenital toxoplasmosis and vertical transmission to the fetus (Black and Boothroyd, 2000). T. gondii infections in livestock cause major economic losses due to abortion and neonatal death, mainly in sheep and goats (Dubey, 1990). Treatment of toxoplasmosis was difficult due to toxicities of available drugs, and re-infection occurs rapidly.
∗ Corresponding authors. Fax: +86 431 87981351. E-mail addresses: [email protected] (J. Li), [email protected] (X. Zhang). 1 These authors contributed equally to this study. 0304-4017/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2011.03.003
Under the present scenario, development of an effective vaccine was an attractive alternative (Bhopale, 2003). There was no vaccine available against human infection with T. gondii, only a live attenuated one has been available for veterinary use for several years in some countries. However, this live attenuated vaccine was expensive and had the possibility to revert to a pathogenic strain (Mateus-Pinilla et al., 1999; Liu et al., 2008). In order to overcome these problems, DNA vaccine was proposed recently (Bout et al., 2002). Several studies have demonstrated that DNA vaccination with genes encoding T. gondii antigens showed certain protection and increased the survival time of animals and reduced the number of brain cysts in rodents (Vercammen et al., 2000; Leyva et al., 2001; Dautu et al., 2007; Jongert et al., 2007; Zhang et al., 2007; Xue et al., 2008; Fang et al., 2009; Liu et al., 2009; Wang et al., 2009). In recent years, significant progress has been made in the identification of vaccine candidates in T. gondii which could elicit a protective immune response. Most of the works have been focused on genes encoding surface
2
J. Li et al. / Veterinary Parasitology 179 (2011) 1–6
and excretory secretory antigens (Saavedra et al., 1996; Ismael et al., 2003; Beghetto et al., 2005). Among the targets that have been studied, actin and actin-binding proteins seem promising. Recent studies have suggested that actin cytoskeleton plays critical roles in the process of T. gondii invasion (Allen et al., 1997; Dobrowolski and Sibley, 1997; Morrissette and Sibley, 2002; Fowler et al., 2004; Hu et al., 2006). One of the actin-binding proteins, actin-depolymerization factor (ADF)/cofilins (AC) was an essential F- and G-actin binding protein that modulate microfilament turnover (Maciver and Hussey, 2002). A member of the ADF/cofilins family has been identified and characterized in T. gondii, but no detailed studies have been reported as whether it can be used as a DNA vaccine to induce immune response and provide protection against homologous challenge in mice. In the present study, pVAX1-TgADF DNA plasmid encoding T. gondii ADF gene was constructed. Specific humoral and cellular immune responses were elicited in BALB/c mice immunized pVAX1-TgADF. After challenged with T. gondii tachyzoites, the survival time of the experimental mice was prolonged and the number of brain cysts in theses mice was also reduced significantly compared with those in control groups. 2. Materials and methods 2.1. Anti-T. gondii tachyzoites polyclonal antibody T. gondii highly virulent RH strain tachyzoites were propagated by intraperitoneal passages through 8–12 weeks old male Kunming mice. All experimental procedures were conducted according to the guidelines of appropriate Local Ethics Commission for Experiments on Animals. Tachyzoites were harvested from the peritoneal fluid of Kunming mice after infected with 1 × 103 tachyzoites. The peritoneal fluid was separated by low speed centrifugation (100 × g for 10 min) at 4 ◦ C to remove the cellular debris. The parasites in the supernatant were precipitated by centrifugation at 600 × g for 10 min and then washed in 0.01 M PBS (pH 7.2). The tachyzoites were used for preparing toxoplasma lysate antigen (TLA) for immunization according to previously reported methods (Vercammen et al., 2000). For immunization, each BALB/C mouse was first injected with 100 g of TLA emulsified with an equal volume of Freund’s complete adjuvant. Each mouse was injected again at the second week with the same amount of antigen mixed with an equal volume of Freund’s incomplete adjuvant. Two weeks later, a boost injection with antigen only was given. One week later, polyclonal antibody was collected according to standard procedures as described previously (Xiao et al., 2004; Guo et al., 2005; Wang et al., 2007). Anti-T. gondii tachyzoites polyclonal antibody was used to indirect immunofluorescence assay (IFA). 2.2. pVAX1-TgADF plasmid construction Total RNA of T. gondii tachyzoites was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA). The first strand cDNA was synthesized by AMV reverse transcrip-
tase using oligo (dT) as primer. The complete TgADF open reading frame (ORF) was obtained by PCR amplification with cDNA as template, using primers: (forward primer): 5 - CGCGGATCCGCGCATCGCAGCCTGAACCAC -3 (reverse primer): 5 - CCCAAGCTTGGGCACGAGGGACACTAGCACA3 , in which the BamHI and HindIII restriction sites were introduced, respectively. PCR conditions: pre-denaturation 95 ◦ C for 5 min; denaturation 94 ◦ C for 50 s, annealing 56 ◦ C for 50 s, and extension 72 ◦ C for 1 min, followed by 30 cycles; final extension 72 ◦ C for 10 min. The amplified DNA fragment was cloned into the eukaryotic expression vector pVAX1 which has been double digested with BamHI and HindIII. The recombinant plasmids were identified by PCR, double restriction enzyme digestion and sequencing. The positive plasmid was designated pVAX1-TgADF. The DNA concentration was determined by measuring the optical density at 260 nm (OD260). The OD 260/280 ratios of the purified DNA were 1.60–1.80, indicating that preparations were free of any major protein or RNA contamination. 2.3. In vitro pVAX1-TgADF plasmid expression Recombinant plasmid pVAX1-TgADF (25–40 g/well) was transfected into Hela cells with lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions in 6-well tissue culture plates. Forty-eight hours after transfection, cells were fixed with 30% formaldehyde and processed for IFA. The cells were incubated with mouse anti- T. gondii tachyzoites polyclonal antibody (37 ◦ C for 2 h) in a humidified box. After washing with PBST for three times, the plates were incubated with fluorescein isothiocyanate (FITC) labeled goat antimouse IgG antibody (1:2000) at 37 ◦ C for 1 h. After washed with PBST for three times, fluorescence was observed under a fluorescence microscope. Hela cells transfected with pVAX1 served as the negative control. 2.4. DNA vaccine immunization 6–8 weeks old female BALB/c mice were randomly divided into three groups (fifteen mice each group). For experimental group, pVAX1-TgADF (100 g/each) was immunized by intramuscular. As negative controls, the empty vector pVAX1 (100 g/each) or PBS (100 l/each) were injected. All groups were vaccinated three times at weeks 0, 2 and 4, respectively. The serum of all groups were collected from venous plexus of mice tails before each immunization and stored at −20 ◦ C for ELISA. 2.5. T. gondii-specific antibodies response induced by DNA vaccine For evaluating specific antibodies by an indirect ELISA test, the microtiter plates were coated overnight at 4 ◦ C with crude T. gondii tachyzoites antigens (10 mg/ml), and blocked with 5% bovine serum albumin (BSA) in PBS at room temperature (RT) for 2 h. Then washed with PBST three times, sera diluted at 1:6400 in 1% BSA–PBS were incubated at 37 ◦ C for 1 h. After washed with PBST for three times, the plates were incubated with HRPlabeled goat anti-mouse IgG antibody (1:2 000) at 37 ◦ C
J. Li et al. / Veterinary Parasitology 179 (2011) 1–6
3
for 1 h, then washed again. Finally, substrate solution containing 15 l H2 O2 , 10 ml citrate-phosphate and 4 mg O-phenylenediamine (OPD) were added (100 l/well). The reaction was stopped by 2 M H2 SO4 and the optical density (OD) values were read at 490 nm. 2.6. Cellular immune response induced by DNA vaccine Two weeks after the last immunization, suspensions of splenocytes were obtained by gentle squeezing of whole spleens of mice in FACS buffer (phosphate-buffered saline with 5% fetal calf serum, and 0.1% sodium azide). Residual debris was removed by centrifugation. Cells suspension was stained with optimal concentrations of FITC conjugated anti-immunoglobulin (Ig) antibody (100 g/ml), PE conjugated anti-CD4 antibody (5 g/ml), PE conjugated anti-CD8 antibody (12.5 g/ml) (PharMingen, San Diego, CA). Cells were then incubated with propidium iodide (PI). Cells were incubated at 4 ◦ C for 20 min washed by PBS, and finally detected by flow cytometry (FACSan; Becton–Dickinson Immunocytometry Systems, Mountain View, CA).
Fig. 1. Construction of plasmid pVAX1-TgADF. TgADF-cDNA fragment was RT-PCR amplified and inserted into pVAX1 at the sites of BamHI and HindIII.
2.7. Protective efficacy of DNA vaccine against T. gondii
3. Results
Two weeks after the last immunization, eight mice were selected randomly from each group and challenged intraperitoneally with lethal dose 1 × 103 tachyzoites of T. gondii (RH strain). Then the survival times were recorded. The numbers of brain cysts were counted immediately after the mice were dead. Briefly, 1 g of mouse brain tissue was homogenized with a mortar and pestle in 1 ml of PBS. Then the numbers of brain cysts in this suspension was counted in a hemocytometer.
3.1. Identification of recombinant plasmid pVAX1-TgADF The complete TgADF ORF fragment was amplified by RT-PCR and inserted into pVAX1 eukaryotic expression vector and the resultant plasmid was named pVAX1-TgADF (Fig. 1). The insert of TgADF ORF was verified by DNA sequencing. 3.2. Recombinant protein expression in Hela cells revealed by IFA
2.8. Statistical analysis Statistical analysis was performed using SPSS 14.0 software for variance (ANOVA) and Duncan’s multiple ranges. P < 0.05 was considered statistically significant.
After immune-fluorescence staining, green fluorescence could be seen in Hela cells transfected with plasmid pVAX1-TgADF 48 h after transfection, but not in cells transfected with pVAX1 vector plasmid. The results indicate that
Fig. 2. pVAX1-TgADF expression in Hela cells detected through Indirect fluorescence staining. (A) Hela cells transfected with pVAX1-TgADF; (B) Hela cells transfected with pVAX1vector.
4
J. Li et al. / Veterinary Parasitology 179 (2011) 1–6 Table 2 Number of brain cysts immunized BALB/c mice after challenged with T. gondii tachyzoites. Groups
Number of brain cysts per gram (n = 6)
pVAX1-TgADF (A) pVAX1 (B) PBS (C)
1600.00 ± 126.48* 2406.68 ± 181.40 2793.32 ± 184.88
Note: The number of brain cysts was counted per gram brain issue after the mice dead. The rate of reduction in group A could reach to around 42.8% compared with group C. * Significantly different from the control groups (P < 0.05). 120%
Table 1 Percentages of CD4+ and CD8+ T cells in splenocytes from plasmid immunized BABL/c mice. +
+
Groups
CD4 (%: mean ± S.E., n = 6)
CD8 (%: mean ± S.E., n = 6)
pVAX1-TgADF (A) pVAX1 (B) PBS (C)
28.340 ± 2.922* 24.575 ± 1.138 20.125 ± 1.204
14.080 ± 1.730* 11.828 ± 0.797 10.925 ± 1.746
*
P < 0.05 as compared with group C.
recombinant ADF protein has been expressed successfully in Hela cells (Fig. 2). 3.3. Humoral immune response induced by DNA vaccination Vaccination with plasmid pVAX1-TgADF induced a strong IgG antibody response. Two weeks after the third immunization, the specific IgG titers reached to a very high level in the experimental mice (Fig. 3). Compared with the control groups immunized with pVAX1 or PBS, the differences of antibody responses were significant (P < 0.05). 3.4. Cellular immune response induced by DNA vaccination
100%
% Survival rate
Fig. 3. Humoral immune responses by pVAX1-TgADF DNA vaccination. BALB/c mice were immunized with pVAX1-TgADF, pVAX1 vector, and PBS under the same conditions. Serum samples diluted at 1:6400 from 6 randomly chosen mice in each group were checked for specific anti- T. gondii tachyzoites antibodies in an ELISA. Each bar represents the mean OD readings (±S.E., n = 6).
pVAX1-TgADF pVAX1
80%
PBS
60% 40% 20% 0%
0
-20%
2
4
6
8
10
Days post-infection
Fig. 4. Survival time of the immunized BALB/c mice after T. gondii tachyzoites challenge. Each group of mice (n = 6) was immunized with 100 g of DNA at 0, 2, and 4 weeks. 2 weeks after the last immunization, mice were challenged intraperitoneally with 103 T. gondii tachyzoites of RH strain. Survival times were monitored daily for 9 days after the challenge. All experimental BALB/c mice were dead after infected with T. gondii tachyzoites. The mice immunized with pVAX1-TgADF were dead from day 6 to 9. Negative controls mice immunized with pVAX1and PBS died within 5 to 8 days.
all mice were counted. The numbers of brain cysts in mice immunized with pVAX1-TgADF reduced significantly when compared with that in the PBS control group (P < 0.05), and the rate of reduction could reach to 42.8% (Table 2). The average survival time of mice in pVAX1-TgADF group was longer than those in control groups, but not statistically significant (P > 0.05) (Fig. 4). The results demonstrated that immunization with pVAX1-TgADF could not protect mice effectively from T. gondii tachyzoites infection, only prolonged survival time and reduced brain cysts burden in BALB/c mice. 4. Discussion
To evaluate cellular immune responses in the pVAX1TgADF vaccinated mice, spleen lymphocytes of immunized and control mice were obtained 2 weeks after the last immunization and examined by flow cytometry. The numbers of CD4+ and CD8+ T lymphocytes in mice immunized with pVAX1-TgADF increased significantly when compared with PBS groups (P < 0.05) (Table 1). 3.5. Protective efficacy of DNA vaccination in BALB/c mice To test whether DNA vaccination induced effective protection against T. gondii infection, each immunized mouse was challenged intraperitoneally with 1 × 103 tachyzoites of T. gondii RH strain at two weeks after the last immunization. The survival times and the numbers of brain cysts in
In order to study the role of ADF against T. gondii infection, the recombinant plasmid pVAX1-TgADF was constructed and expressed in Hela cells. Compared to control groups, pVAX1-TgADF was able to elicit significant humoral and cellular immune responses, and reduce brain cysts load against T. gondii infection in BALB/c mice. However, this DNA vaccine can only slightly increase the survival time of immunized mice when challenged. In recent years, significant progress has been made in the identification of vaccine candidates which could induce a protective immune response against toxoplasmosis. Most of the works had focused on surface antigens of tachyzoites and excretory secretory antigens of T. gondii (Bhopale, 2003; Saavedra et al., 1996). ADF has been sug-
J. Li et al. / Veterinary Parasitology 179 (2011) 1–6
gested to plays an important role in remodeling the actin cytoskeleton which contributed much to the invasion of host cells by the apicomplexan parasites (Sibley, 2004). The involvement of actin cytoskeleton of T. gondii in invasion of mammalian cells was also reported (Dobrowolski and Sibley, 1997). Selective inhibition of ADF could in theory interfere with the polymerization process of actins in parasites and block their invasion into mammalian cells (Allen et al., 1997). ADF protein from T. gondii consisted of 118 amino acids; it was a single-copy gene and did not contain a nuclear localization sequence like the related vertebrate proteins. Recombinant T. gondii ADF purified from Escherichia coli was active in binding actin monomers and depolymerizing F-actin. Localization of T. gondii ADF was scattered throughout the cytoplasm and prominently localized beneath the plasma membrane in T. gondii (Allen et al., 1997). We are interested in testing whether T. gondii ADF gene could be used as a DNA vaccine candidate in a mouse model to induce immune responses against T. gondii infection. DNA vaccines against toxoplasmosis had been shown to be a powerful method for the induction of specific humoral immune responses (Angus et al., 2000; Couper et al., 2003; Dautu et al., 2007; Fachado et al., 2003; Fang et al., 2009; Leyva et al., 2001; Vercammen et al., 2000; Wang et al., 2009). Similar to other reports, specific IgG antibody responses against T. gondii were detected by ELISA in the pVAX1-TgADF immunized mice. Two weeks after the third immunization, the specific IgG titers reached to a very high level in the experimental mice. Studies have shown that cell-mediated immunity (CMI) was an important component of host anti-T. gondii infection (Denkers and Gazzinelli, 1998). Results from the present study also indicate the increases in the numbers of CD4+ and CD8+ T lymphocytes in DNA vaccinated mice. Infection with intracellular pathogens was thought to be controlled primarily by T lymphocyte-dependent cell-mediated immunity (Sher and Colley, 1989). T. gondii randomly infected a lot of host cells most of which were nonphagocytic cells that normally only expressed MHC I class molecules. As a result, T. gondii infections should be recognized primarily by CD8+ effectors which were believed to be the principal mediators of resistance against acute T. gondii infections (Suzuki and Remington, 1988). The present results supported this conclusion. IFN-␥ was thought to be the major cytokine involved in both resistance to new infections and control of chronic infections (Suzuki et al., 1988; Suzui et al., 1989). It has been suggested that CD4+ and CD8+ lymphocytes act additively or synergistically to prevent reactivation of chronic T. gondii infection probably through the production of IFN-␥ (Gazzinelli et al., 1992). CD4+ cells through IL-2 production might trigger IFN-␥ production by effector cells other than CD8+ lymphocytes resulting in partial immunity (Suzuki and Remington, 1988). CD 4+ lymphocytes as helper cells played a major role in the induction of both protection and activity of CD 8+ effector cells (Gazzinelli et al., 1991). The results in the present study also found that the numbers of CD 4+ cells were increased. For protective efficacy of DNA vaccines against T. gondii challenge, survival time, brain cysts load, brain cysts reduction rate, and protection rate should be considered. In
5
addition, the efficacy was also related to T. gondii strains and mice species. In previous studies, strains such as C57BL/6, C3H, and BALB/c have been used in T. gondii protective studies. BALB/c mice were used in the current study. 2 weeks after immunized with pVAX1-TgADF, results showed that pVAX1-TgADF could prolong the survival time in BALB/c mice challenged with lethal doses of the virulent RH tachyzoites of T. gondii when compared with control groups. The number of brain cysts was less than that in the control groups, and the reduction rate could reach to 42.8%. Till now, there was no effective vaccine that produced complete protection against intraperitoneal challenge with the RH strain of T. gondii (Angus et al., 2000; Cong et al., 2008; Leyva et al., 2001; Fachado et al., 2003). The results from this study were similar in terms of protection efficacy to results obtained from several other single gene DNA vaccines in BALB/c mice (Leyva et al., 2001; Fachado et al., 2003; Cong et al., 2008; Wang et al., 2009; Fang et al., 2010). In the current study, T. gondii strain RH tachyzoite were used for challenge experiments. Another avirulent Beverly type-2 strain of T. gondii was also being used in several studies (Couper et al., 2003; Dautu et al., 2007). Although significant efforts have been made, there is no available DNA vaccine against toxoplasmosis. Previous studies have reported that multi-antigenic vaccines were more effective than single-antigenic vaccine (Jongert et al., 2007; Zhang et al., 2007; Cong et al., 2008; Xue et al., 2008; Wang et al., 2009). We speculate that DNA vaccinations with suitable antigens might induce protective immunity against toxoplasmosis. Acknowledgment This work was supported by National Key Technology R & D Program of China (no. 2008BAD96B11-3). References Allen, M.L., Dobrowolski, J.M., Muller, H., Sibley, L.D., Mansour, T.E., 1997. Cloning and characterization of actin depolymerizing factor from Toxoplasma gondii. Mol. Biochem. Parasitol. 88, 43–52. Angus, C.W., Klivington-Evans, D., Dubey, J.P., Kovacs, J.A., 2000. Immunization with a DNA plasmid encoding the SAG1 (SAG1) protein of Toxoplasma gondii is immunogenic and protective in rodents. J. Infect. Dis. 181, 317–324. Beghetto, E., Nielsen, H.V., Del Porto, P., Buffolano, W., Guglietta, S., Felici, F., Petersen, E., Gargano, N., 2005. A combination of antigenic regions of Toxoplasma gondii microneme proteins induces protective immunity against oral infection with parasite cysts. J. Infect. Dis. 191, 637–645. Bhopale, G.M., 2003. Development of a vaccine for toxoplasmosis: current status. Microb. Infect. 5, 457–462. Black, M.W., Boothroyd, J.C., 2000. Lytic cycle of Toxoplasma gondii. Microbiol. Mol. Biol. Rev. 64, 607–623. Bout, D.T., Mevelec, M.N., Velge-Roussel, F., Dimier-Poisson, I., Lebrun, M., 2002. Prospects for a human Toxoplasma vaccine. Curr. Drug Targets Immune Endocr. Metabol. Disord. 2, 227–234. Cong, H., Gu, Q.M., Yin, H.E., Wang, J.W., Zhao, Q.L., Zhou, H.Y., Li, Y., Zhang, J.Q., 2008. Multi-epitope DNA vaccine linked to the A2/B subunit of cholera toxin protect mice against Toxoplasma gondii. Vaccine 26, 3913–3921. Couper, K.N., Nielsen, H.V., Petersen, E., Roberts, F., Roberts, C.W., Alexander, J., 2003. DNA vaccination with the immunodominant tachyzoite surface antigen (SAG-1) protects against adult acquired Toxoplasma gondii infection but does not prevent maternofoetal transmission. Vaccine 21, 2813–2820.
6
J. Li et al. / Veterinary Parasitology 179 (2011) 1–6
Dautu, G., Munyaka, B., Carmen, G., Zhang, G., Omata, Y., Xuenan, X., Igarashi, M., 2007. Toxoplasma gondii: DNA vaccination with genes encoding antigens MIC2, M2AP, AMA1 and BAG1 and evaluation of their immunogenic potential. Exp. Parasitol. 116, 273–282. Denkers, E.Y., Gazzinelli, R.T., 1998. Regulation and function of Tcell-mediated immunity during Toxoplasma gondii infection. Clin. Microbiol. Rev. 11, 569–588. Dobrowolski, J.M., Sibley, L.D., 1997. The role of the cytoskeleton in host cell invasion by Toxoplasma gondii. Behring Inst. Mitt. 99, 90–96. Dubey, J.P., 1990. Status of toxoplasmosis in sheep and goats in the United States. J. Am. Vet. Med. A 196, 259–262. Fachado, A., Rodriguez, A., Angel, S.O., Pinto, D.C., Vila, I., Acosta, A., Amendoeira, R.R., Lannes-Vieira, J., 2003. Protective effect of a naked DNA vaccine cocktail against lethal toxoplasmosis in mice. Vaccine 21, 1327–1335. Fang, R., Nie, H., Wang, Z.S., Tu, P., Zhou, D., Wang, L.X., He, L., Zhou, Y., Zhao, J., 2009. Protective immune response in BALB/c mice induced by a suicidal DNA vaccine of the MIC3 gene of Toxoplasma gondii. Vet. Parasitol. 164, 134–140. Fang, R., Feng, H., Nie, H., Wang, L., Tu, P., Song, Q., Zhou, Y., Zhao, J., 2010. Construction and immunogenicity of pseudotype baculovirus expressing Toxoplasma gondii SAG1 protein in BALB/c mice model. Vaccine 28, 1803–1807. Fowler, R.E., Margos, G., Mitchell, G.H., 2004. The cytoskeleton and motility in apicomplexan invasion. Adv. Parasitol. 56, 213–263. Gazzinelli, R., Hakim, F.T., Hieny, S., Shearer, G.M., Sher, A., 1991. Synergistic role of CD4+ and CD8+ T lymphocytes in IFN-␥ production and protective immunity induced by an attenuated Toxoplasma gondii vaccine. J. Immunol. 146, 286–292. Gazzinelli, R., Xu, Y.H., Hieny, S., Cheever, A., Sher, A., 1992. Simultaneous depletion of CD4+ and CD8+ T lymphocytes is required to reactivate chronic infection with Toxoplasma gondii. J. Immunol. 149, 175–180. Guo, H., Liu, Z., Sun, S., Bao, H., Chen, Y., Liu, X., Xie, Q., 2005. Immune response in guinea pigs vaccinated with DNA vaccine of foot-and mouth disease virus O/China 99. Vaccine 23, 3236–3242. Hu, K., Johnson, J., Florens, L., Fraunholz, M., Suravajjala, S., DiLullo, C., Yates, J., Roos, D.S., Murray, J.M., 2006. Cytoskeletal components of an invasion machine the apical complex of Toxoplasma gondii. PLoS Pathogens 2, e13. Ismael, A.B., Sekkai, D., Collin, C., Bout, D., Mévélec, M.N., 2003. The MIC3 gene of Toxoplasma gondii is a novel potent vaccine candidate against toxoplasmosis. Infect. Immun. 71, 6222–6228. Jongert, E., de Craeye, S., Dewit, J., Huygen, K., 2007. GRA7 provides protective immunity in cocktail DNA vaccines against Toxoplasma gondii. Parasite. Immunol. 29, 445–453. Leyva, R., Hérion, P., Saavedra, R., 2001. Genetic immunization with plasmid DNA coding for the ROP2 protein of Toxoplasma gondii. Parasitol. Res. 87, 70–79. Liu, S., Shi, L., Cheng, Y.B., Fan, G.X., Ren, H.X., Yuan, Y.K., 2009. Evaluation of protective effect of multi-epitope DNA vaccine encoding six antigen segments of Toxoplasma gondii in mice. Parasitol. Res. 105, 267–274. Liu, Q., Gao, S.Y., Jiang, L., Shang, L.M., Men, J.T., Wang, Z., Zhai, Y.J., Xia, Z.P., Hu, R.L., Zhang, X.C., Zhu, X.Q., 2008. A recombinant Pseudorabies
virus expressing TgSAG1 protects against challenge with the virulent Toxoplasma gondii RH strain and pseudorabies in BALB/c mice. Microb. Infect. 8, 1–8. Maciver, S.K., Hussey, P.J., 2002. The ADF/cofilin family: actin-remodeling proteins. Genome Biol. 3, 3007. Mateus-Pinilla, N.E., Dubey, J.P., Choromanski, L., Weigel, R.M., 1999. A field trial of the effectiveness of a feline Toxoplasma gondii vaccine in reducing T. gondii exposure for swine. J. Parasitol. 85, 855–860. Morrissette, N.S., Sibley, L.D., 2002. Cytoskeleton of apicomplexan parasites. Microbiol. Mol. Biol. Rev. 66, 21–38. Saavedra, R., Becerril, M.A., Dubeaux, C.R., Lippens, M.D., Herion, V.P., Bollen, A., 1996. Epitopes recognized by human T lymphocytes in the RoP2 protein antigen of Toxoplasma gondii. Infect. Immun. 64, 3858–3862. Sher, A., Colley, D.G., 1989. Immunoparasitology. In: Paul, W.E. (Ed.), Fundamental Immunology, 1989, 2nd edition. Raven Press, New York, pp. 957–983. Sibley, L.D., 2004. Intracellular parasite invasion strategies. Science 304, 248–253. Suzui, Y., Conley, F.K., Remington, J.S., 1989. Importance of endogenous IFN-for prevention of toxoplasmic encephalitis in mice. J. Immunol. 143, 2045. Suzuki, Y., Remington, J.S., 1988. Dual regulation of resistance against Toxoplasma gondii infection by Lyt2+ , Lyt1+ and L3T4+ T cells in mice. J. Immunol. 140, 3943. Suzuki, Y., Orellana, M.A., Schreiber, R.D., Remington, J.S., 1988. Interferon␥: the major mediator of resistance against T. gondii. Science 240, 516. Vercammen, M., Scorza, T., Huygen, K., De Braekeleer, J., Diet, R., Jacobs, D., Saman, E., Verschueren, H., 2000. DNA vaccination with genes encoding Toxoplasma gondii antigens GRA1. GRA7, and ROP2 induces partially protective immunity against lethal challenge in mice. Infect. Immun. 68, 38–45. Wang, H., Liu, Q., Liu, K., Zhong, W., Gao, S., Jiang, L., An, N., 2007. Immune response induced by recombinant Mycobacterium bovis BCG expressing ROP2 gene of Toxoplasma gondii. Parasitol. Int. 56, 263–268. Wang, H., He, S., Yao, Y., Cong, H., Zhao, H., Li, T., Zhu, X.Q., 2009. Toxoplasma gondii: protective effect of an intranasal SAG1 and MIC4 DNA vaccine in mice. Exp. Parasitol. 122, 226–232. Xiao, S.B., Chen, H.C., Fang, L.R., Liu, C.S., Zhang, H., Jiang, Y.B., 2004. Comparison of immune responses and protective efficacy of suicidal DNA vaccine and conventional DNA vaccine encoding glycoprotein C of Pseudorabies virus in mice. Vaccine 22, 345–351. Xue, M., He, S., Cui, Y., Yao, Y., Wang, H., 2008. Evaluation of the immune response elicited by multi-antigenic DNA vaccine expressing SAG1 ROP2 and GRA2 against Toxoplasma gondii. Parasitol. Int. 57, 424–429. Zhang, J., He, S., Jiang, H., Yang, T., Cong, H., Zhou, H., Zhang, J., Gu, Q., Li, Y., Zhao, Q., 2007. Evaluation of the immune response induced by multiantigenic DNA vaccine encoding SAGl and ROP2 of Toxoplasma gondii and the adjuvant properties of murine interleukin-12 plasmid in BALB/c mice. Parasitol. Res. 101, 331–338.
Contents lists available at ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
Immune response and protective efficacy against homologous challenge in BALB/c mice vaccinated with DNA vaccine encoding Toxoplasma gondii actin depolymerizing factor gene Jianhua Li ∗,1 , Xiangsheng Huang 1 , Guocai Zhang, Pengtao Gong, Xichen Zhang ∗ , Ling Wu College of Animal Science and Veterinary Medicine, Jilin University, 5333 Xi’an Road, Changchun, Jilin 130062, China
a r t i c l e
i n f o
Article history: Received 26 July 2010 Received in revised form 4 January 2011 Accepted 3 March 2011 Keywords: Toxoplasma gondii DNA vaccine Actin depolymerizing factor BALB/c mice
a b s t r a c t A DNA vaccine (pVAX1-TgADF) encoding Toxoplasma gondii actin depolymerizing factor (ADF) gene was constructed and the immune response and protective efficacy of this vaccine against homologous challenge in BALB/c mice were evaluated. High titers of specific antibody and increases in the percentage of CD4+ and CD8+ T lymphocyte cells were observed from BALB/c mice vaccinated with pVAX1-TgADF (P < 0.05), when PBS group was used as control. The survival time of BALB/c mice in pVAX1-TgADF group was longer than those in control groups. The numbers of brain cysts in the experimental BALB/c mice immunized with pVAX1-TgADF reduced significantly compared with those in PBS group (P < 0.05), and the rate of reduction could reach to around 42.8%. These results suggested that the DNA vaccine pVAX1-TgADF could generate specific humoral and cellular immune responses, prolong survival times, and reduce brain cysts load against T. gondii infection in BALB/c mice. © 2011 Elsevier B.V. All rights reserved.
1. Introduction Toxoplasma gondii, the etiological agent of toxoplasmosis, is an apicomplexan protozoan parasite infecting most warm-blooded animals and humans, especially in the immunocompromised individuals, such as AIDS patients. T. gondii is the cause for a variety of clinical syndromes. During pregnancy, the primary infection could lead to congenital toxoplasmosis and vertical transmission to the fetus (Black and Boothroyd, 2000). T. gondii infections in livestock cause major economic losses due to abortion and neonatal death, mainly in sheep and goats (Dubey, 1990). Treatment of toxoplasmosis was difficult due to toxicities of available drugs, and re-infection occurs rapidly.
∗ Corresponding authors. Fax: +86 431 87981351. E-mail addresses: [email protected] (J. Li), [email protected] (X. Zhang). 1 These authors contributed equally to this study. 0304-4017/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2011.03.003
Under the present scenario, development of an effective vaccine was an attractive alternative (Bhopale, 2003). There was no vaccine available against human infection with T. gondii, only a live attenuated one has been available for veterinary use for several years in some countries. However, this live attenuated vaccine was expensive and had the possibility to revert to a pathogenic strain (Mateus-Pinilla et al., 1999; Liu et al., 2008). In order to overcome these problems, DNA vaccine was proposed recently (Bout et al., 2002). Several studies have demonstrated that DNA vaccination with genes encoding T. gondii antigens showed certain protection and increased the survival time of animals and reduced the number of brain cysts in rodents (Vercammen et al., 2000; Leyva et al., 2001; Dautu et al., 2007; Jongert et al., 2007; Zhang et al., 2007; Xue et al., 2008; Fang et al., 2009; Liu et al., 2009; Wang et al., 2009). In recent years, significant progress has been made in the identification of vaccine candidates in T. gondii which could elicit a protective immune response. Most of the works have been focused on genes encoding surface
2
J. Li et al. / Veterinary Parasitology 179 (2011) 1–6
and excretory secretory antigens (Saavedra et al., 1996; Ismael et al., 2003; Beghetto et al., 2005). Among the targets that have been studied, actin and actin-binding proteins seem promising. Recent studies have suggested that actin cytoskeleton plays critical roles in the process of T. gondii invasion (Allen et al., 1997; Dobrowolski and Sibley, 1997; Morrissette and Sibley, 2002; Fowler et al., 2004; Hu et al., 2006). One of the actin-binding proteins, actin-depolymerization factor (ADF)/cofilins (AC) was an essential F- and G-actin binding protein that modulate microfilament turnover (Maciver and Hussey, 2002). A member of the ADF/cofilins family has been identified and characterized in T. gondii, but no detailed studies have been reported as whether it can be used as a DNA vaccine to induce immune response and provide protection against homologous challenge in mice. In the present study, pVAX1-TgADF DNA plasmid encoding T. gondii ADF gene was constructed. Specific humoral and cellular immune responses were elicited in BALB/c mice immunized pVAX1-TgADF. After challenged with T. gondii tachyzoites, the survival time of the experimental mice was prolonged and the number of brain cysts in theses mice was also reduced significantly compared with those in control groups. 2. Materials and methods 2.1. Anti-T. gondii tachyzoites polyclonal antibody T. gondii highly virulent RH strain tachyzoites were propagated by intraperitoneal passages through 8–12 weeks old male Kunming mice. All experimental procedures were conducted according to the guidelines of appropriate Local Ethics Commission for Experiments on Animals. Tachyzoites were harvested from the peritoneal fluid of Kunming mice after infected with 1 × 103 tachyzoites. The peritoneal fluid was separated by low speed centrifugation (100 × g for 10 min) at 4 ◦ C to remove the cellular debris. The parasites in the supernatant were precipitated by centrifugation at 600 × g for 10 min and then washed in 0.01 M PBS (pH 7.2). The tachyzoites were used for preparing toxoplasma lysate antigen (TLA) for immunization according to previously reported methods (Vercammen et al., 2000). For immunization, each BALB/C mouse was first injected with 100 g of TLA emulsified with an equal volume of Freund’s complete adjuvant. Each mouse was injected again at the second week with the same amount of antigen mixed with an equal volume of Freund’s incomplete adjuvant. Two weeks later, a boost injection with antigen only was given. One week later, polyclonal antibody was collected according to standard procedures as described previously (Xiao et al., 2004; Guo et al., 2005; Wang et al., 2007). Anti-T. gondii tachyzoites polyclonal antibody was used to indirect immunofluorescence assay (IFA). 2.2. pVAX1-TgADF plasmid construction Total RNA of T. gondii tachyzoites was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA). The first strand cDNA was synthesized by AMV reverse transcrip-
tase using oligo (dT) as primer. The complete TgADF open reading frame (ORF) was obtained by PCR amplification with cDNA as template, using primers: (forward primer): 5 - CGCGGATCCGCGCATCGCAGCCTGAACCAC -3 (reverse primer): 5 - CCCAAGCTTGGGCACGAGGGACACTAGCACA3 , in which the BamHI and HindIII restriction sites were introduced, respectively. PCR conditions: pre-denaturation 95 ◦ C for 5 min; denaturation 94 ◦ C for 50 s, annealing 56 ◦ C for 50 s, and extension 72 ◦ C for 1 min, followed by 30 cycles; final extension 72 ◦ C for 10 min. The amplified DNA fragment was cloned into the eukaryotic expression vector pVAX1 which has been double digested with BamHI and HindIII. The recombinant plasmids were identified by PCR, double restriction enzyme digestion and sequencing. The positive plasmid was designated pVAX1-TgADF. The DNA concentration was determined by measuring the optical density at 260 nm (OD260). The OD 260/280 ratios of the purified DNA were 1.60–1.80, indicating that preparations were free of any major protein or RNA contamination. 2.3. In vitro pVAX1-TgADF plasmid expression Recombinant plasmid pVAX1-TgADF (25–40 g/well) was transfected into Hela cells with lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions in 6-well tissue culture plates. Forty-eight hours after transfection, cells were fixed with 30% formaldehyde and processed for IFA. The cells were incubated with mouse anti- T. gondii tachyzoites polyclonal antibody (37 ◦ C for 2 h) in a humidified box. After washing with PBST for three times, the plates were incubated with fluorescein isothiocyanate (FITC) labeled goat antimouse IgG antibody (1:2000) at 37 ◦ C for 1 h. After washed with PBST for three times, fluorescence was observed under a fluorescence microscope. Hela cells transfected with pVAX1 served as the negative control. 2.4. DNA vaccine immunization 6–8 weeks old female BALB/c mice were randomly divided into three groups (fifteen mice each group). For experimental group, pVAX1-TgADF (100 g/each) was immunized by intramuscular. As negative controls, the empty vector pVAX1 (100 g/each) or PBS (100 l/each) were injected. All groups were vaccinated three times at weeks 0, 2 and 4, respectively. The serum of all groups were collected from venous plexus of mice tails before each immunization and stored at −20 ◦ C for ELISA. 2.5. T. gondii-specific antibodies response induced by DNA vaccine For evaluating specific antibodies by an indirect ELISA test, the microtiter plates were coated overnight at 4 ◦ C with crude T. gondii tachyzoites antigens (10 mg/ml), and blocked with 5% bovine serum albumin (BSA) in PBS at room temperature (RT) for 2 h. Then washed with PBST three times, sera diluted at 1:6400 in 1% BSA–PBS were incubated at 37 ◦ C for 1 h. After washed with PBST for three times, the plates were incubated with HRPlabeled goat anti-mouse IgG antibody (1:2 000) at 37 ◦ C
J. Li et al. / Veterinary Parasitology 179 (2011) 1–6
3
for 1 h, then washed again. Finally, substrate solution containing 15 l H2 O2 , 10 ml citrate-phosphate and 4 mg O-phenylenediamine (OPD) were added (100 l/well). The reaction was stopped by 2 M H2 SO4 and the optical density (OD) values were read at 490 nm. 2.6. Cellular immune response induced by DNA vaccine Two weeks after the last immunization, suspensions of splenocytes were obtained by gentle squeezing of whole spleens of mice in FACS buffer (phosphate-buffered saline with 5% fetal calf serum, and 0.1% sodium azide). Residual debris was removed by centrifugation. Cells suspension was stained with optimal concentrations of FITC conjugated anti-immunoglobulin (Ig) antibody (100 g/ml), PE conjugated anti-CD4 antibody (5 g/ml), PE conjugated anti-CD8 antibody (12.5 g/ml) (PharMingen, San Diego, CA). Cells were then incubated with propidium iodide (PI). Cells were incubated at 4 ◦ C for 20 min washed by PBS, and finally detected by flow cytometry (FACSan; Becton–Dickinson Immunocytometry Systems, Mountain View, CA).
Fig. 1. Construction of plasmid pVAX1-TgADF. TgADF-cDNA fragment was RT-PCR amplified and inserted into pVAX1 at the sites of BamHI and HindIII.
2.7. Protective efficacy of DNA vaccine against T. gondii
3. Results
Two weeks after the last immunization, eight mice were selected randomly from each group and challenged intraperitoneally with lethal dose 1 × 103 tachyzoites of T. gondii (RH strain). Then the survival times were recorded. The numbers of brain cysts were counted immediately after the mice were dead. Briefly, 1 g of mouse brain tissue was homogenized with a mortar and pestle in 1 ml of PBS. Then the numbers of brain cysts in this suspension was counted in a hemocytometer.
3.1. Identification of recombinant plasmid pVAX1-TgADF The complete TgADF ORF fragment was amplified by RT-PCR and inserted into pVAX1 eukaryotic expression vector and the resultant plasmid was named pVAX1-TgADF (Fig. 1). The insert of TgADF ORF was verified by DNA sequencing. 3.2. Recombinant protein expression in Hela cells revealed by IFA
2.8. Statistical analysis Statistical analysis was performed using SPSS 14.0 software for variance (ANOVA) and Duncan’s multiple ranges. P < 0.05 was considered statistically significant.
After immune-fluorescence staining, green fluorescence could be seen in Hela cells transfected with plasmid pVAX1-TgADF 48 h after transfection, but not in cells transfected with pVAX1 vector plasmid. The results indicate that
Fig. 2. pVAX1-TgADF expression in Hela cells detected through Indirect fluorescence staining. (A) Hela cells transfected with pVAX1-TgADF; (B) Hela cells transfected with pVAX1vector.
4
J. Li et al. / Veterinary Parasitology 179 (2011) 1–6 Table 2 Number of brain cysts immunized BALB/c mice after challenged with T. gondii tachyzoites. Groups
Number of brain cysts per gram (n = 6)
pVAX1-TgADF (A) pVAX1 (B) PBS (C)
1600.00 ± 126.48* 2406.68 ± 181.40 2793.32 ± 184.88
Note: The number of brain cysts was counted per gram brain issue after the mice dead. The rate of reduction in group A could reach to around 42.8% compared with group C. * Significantly different from the control groups (P < 0.05). 120%
Table 1 Percentages of CD4+ and CD8+ T cells in splenocytes from plasmid immunized BABL/c mice. +
+
Groups
CD4 (%: mean ± S.E., n = 6)
CD8 (%: mean ± S.E., n = 6)
pVAX1-TgADF (A) pVAX1 (B) PBS (C)
28.340 ± 2.922* 24.575 ± 1.138 20.125 ± 1.204
14.080 ± 1.730* 11.828 ± 0.797 10.925 ± 1.746
*
P < 0.05 as compared with group C.
recombinant ADF protein has been expressed successfully in Hela cells (Fig. 2). 3.3. Humoral immune response induced by DNA vaccination Vaccination with plasmid pVAX1-TgADF induced a strong IgG antibody response. Two weeks after the third immunization, the specific IgG titers reached to a very high level in the experimental mice (Fig. 3). Compared with the control groups immunized with pVAX1 or PBS, the differences of antibody responses were significant (P < 0.05). 3.4. Cellular immune response induced by DNA vaccination
100%
% Survival rate
Fig. 3. Humoral immune responses by pVAX1-TgADF DNA vaccination. BALB/c mice were immunized with pVAX1-TgADF, pVAX1 vector, and PBS under the same conditions. Serum samples diluted at 1:6400 from 6 randomly chosen mice in each group were checked for specific anti- T. gondii tachyzoites antibodies in an ELISA. Each bar represents the mean OD readings (±S.E., n = 6).
pVAX1-TgADF pVAX1
80%
PBS
60% 40% 20% 0%
0
-20%
2
4
6
8
10
Days post-infection
Fig. 4. Survival time of the immunized BALB/c mice after T. gondii tachyzoites challenge. Each group of mice (n = 6) was immunized with 100 g of DNA at 0, 2, and 4 weeks. 2 weeks after the last immunization, mice were challenged intraperitoneally with 103 T. gondii tachyzoites of RH strain. Survival times were monitored daily for 9 days after the challenge. All experimental BALB/c mice were dead after infected with T. gondii tachyzoites. The mice immunized with pVAX1-TgADF were dead from day 6 to 9. Negative controls mice immunized with pVAX1and PBS died within 5 to 8 days.
all mice were counted. The numbers of brain cysts in mice immunized with pVAX1-TgADF reduced significantly when compared with that in the PBS control group (P < 0.05), and the rate of reduction could reach to 42.8% (Table 2). The average survival time of mice in pVAX1-TgADF group was longer than those in control groups, but not statistically significant (P > 0.05) (Fig. 4). The results demonstrated that immunization with pVAX1-TgADF could not protect mice effectively from T. gondii tachyzoites infection, only prolonged survival time and reduced brain cysts burden in BALB/c mice. 4. Discussion
To evaluate cellular immune responses in the pVAX1TgADF vaccinated mice, spleen lymphocytes of immunized and control mice were obtained 2 weeks after the last immunization and examined by flow cytometry. The numbers of CD4+ and CD8+ T lymphocytes in mice immunized with pVAX1-TgADF increased significantly when compared with PBS groups (P < 0.05) (Table 1). 3.5. Protective efficacy of DNA vaccination in BALB/c mice To test whether DNA vaccination induced effective protection against T. gondii infection, each immunized mouse was challenged intraperitoneally with 1 × 103 tachyzoites of T. gondii RH strain at two weeks after the last immunization. The survival times and the numbers of brain cysts in
In order to study the role of ADF against T. gondii infection, the recombinant plasmid pVAX1-TgADF was constructed and expressed in Hela cells. Compared to control groups, pVAX1-TgADF was able to elicit significant humoral and cellular immune responses, and reduce brain cysts load against T. gondii infection in BALB/c mice. However, this DNA vaccine can only slightly increase the survival time of immunized mice when challenged. In recent years, significant progress has been made in the identification of vaccine candidates which could induce a protective immune response against toxoplasmosis. Most of the works had focused on surface antigens of tachyzoites and excretory secretory antigens of T. gondii (Bhopale, 2003; Saavedra et al., 1996). ADF has been sug-
J. Li et al. / Veterinary Parasitology 179 (2011) 1–6
gested to plays an important role in remodeling the actin cytoskeleton which contributed much to the invasion of host cells by the apicomplexan parasites (Sibley, 2004). The involvement of actin cytoskeleton of T. gondii in invasion of mammalian cells was also reported (Dobrowolski and Sibley, 1997). Selective inhibition of ADF could in theory interfere with the polymerization process of actins in parasites and block their invasion into mammalian cells (Allen et al., 1997). ADF protein from T. gondii consisted of 118 amino acids; it was a single-copy gene and did not contain a nuclear localization sequence like the related vertebrate proteins. Recombinant T. gondii ADF purified from Escherichia coli was active in binding actin monomers and depolymerizing F-actin. Localization of T. gondii ADF was scattered throughout the cytoplasm and prominently localized beneath the plasma membrane in T. gondii (Allen et al., 1997). We are interested in testing whether T. gondii ADF gene could be used as a DNA vaccine candidate in a mouse model to induce immune responses against T. gondii infection. DNA vaccines against toxoplasmosis had been shown to be a powerful method for the induction of specific humoral immune responses (Angus et al., 2000; Couper et al., 2003; Dautu et al., 2007; Fachado et al., 2003; Fang et al., 2009; Leyva et al., 2001; Vercammen et al., 2000; Wang et al., 2009). Similar to other reports, specific IgG antibody responses against T. gondii were detected by ELISA in the pVAX1-TgADF immunized mice. Two weeks after the third immunization, the specific IgG titers reached to a very high level in the experimental mice. Studies have shown that cell-mediated immunity (CMI) was an important component of host anti-T. gondii infection (Denkers and Gazzinelli, 1998). Results from the present study also indicate the increases in the numbers of CD4+ and CD8+ T lymphocytes in DNA vaccinated mice. Infection with intracellular pathogens was thought to be controlled primarily by T lymphocyte-dependent cell-mediated immunity (Sher and Colley, 1989). T. gondii randomly infected a lot of host cells most of which were nonphagocytic cells that normally only expressed MHC I class molecules. As a result, T. gondii infections should be recognized primarily by CD8+ effectors which were believed to be the principal mediators of resistance against acute T. gondii infections (Suzuki and Remington, 1988). The present results supported this conclusion. IFN-␥ was thought to be the major cytokine involved in both resistance to new infections and control of chronic infections (Suzuki et al., 1988; Suzui et al., 1989). It has been suggested that CD4+ and CD8+ lymphocytes act additively or synergistically to prevent reactivation of chronic T. gondii infection probably through the production of IFN-␥ (Gazzinelli et al., 1992). CD4+ cells through IL-2 production might trigger IFN-␥ production by effector cells other than CD8+ lymphocytes resulting in partial immunity (Suzuki and Remington, 1988). CD 4+ lymphocytes as helper cells played a major role in the induction of both protection and activity of CD 8+ effector cells (Gazzinelli et al., 1991). The results in the present study also found that the numbers of CD 4+ cells were increased. For protective efficacy of DNA vaccines against T. gondii challenge, survival time, brain cysts load, brain cysts reduction rate, and protection rate should be considered. In
5
addition, the efficacy was also related to T. gondii strains and mice species. In previous studies, strains such as C57BL/6, C3H, and BALB/c have been used in T. gondii protective studies. BALB/c mice were used in the current study. 2 weeks after immunized with pVAX1-TgADF, results showed that pVAX1-TgADF could prolong the survival time in BALB/c mice challenged with lethal doses of the virulent RH tachyzoites of T. gondii when compared with control groups. The number of brain cysts was less than that in the control groups, and the reduction rate could reach to 42.8%. Till now, there was no effective vaccine that produced complete protection against intraperitoneal challenge with the RH strain of T. gondii (Angus et al., 2000; Cong et al., 2008; Leyva et al., 2001; Fachado et al., 2003). The results from this study were similar in terms of protection efficacy to results obtained from several other single gene DNA vaccines in BALB/c mice (Leyva et al., 2001; Fachado et al., 2003; Cong et al., 2008; Wang et al., 2009; Fang et al., 2010). In the current study, T. gondii strain RH tachyzoite were used for challenge experiments. Another avirulent Beverly type-2 strain of T. gondii was also being used in several studies (Couper et al., 2003; Dautu et al., 2007). Although significant efforts have been made, there is no available DNA vaccine against toxoplasmosis. Previous studies have reported that multi-antigenic vaccines were more effective than single-antigenic vaccine (Jongert et al., 2007; Zhang et al., 2007; Cong et al., 2008; Xue et al., 2008; Wang et al., 2009). We speculate that DNA vaccinations with suitable antigens might induce protective immunity against toxoplasmosis. Acknowledgment This work was supported by National Key Technology R & D Program of China (no. 2008BAD96B11-3). References Allen, M.L., Dobrowolski, J.M., Muller, H., Sibley, L.D., Mansour, T.E., 1997. Cloning and characterization of actin depolymerizing factor from Toxoplasma gondii. Mol. Biochem. Parasitol. 88, 43–52. Angus, C.W., Klivington-Evans, D., Dubey, J.P., Kovacs, J.A., 2000. Immunization with a DNA plasmid encoding the SAG1 (SAG1) protein of Toxoplasma gondii is immunogenic and protective in rodents. J. Infect. Dis. 181, 317–324. Beghetto, E., Nielsen, H.V., Del Porto, P., Buffolano, W., Guglietta, S., Felici, F., Petersen, E., Gargano, N., 2005. A combination of antigenic regions of Toxoplasma gondii microneme proteins induces protective immunity against oral infection with parasite cysts. J. Infect. Dis. 191, 637–645. Bhopale, G.M., 2003. Development of a vaccine for toxoplasmosis: current status. Microb. Infect. 5, 457–462. Black, M.W., Boothroyd, J.C., 2000. Lytic cycle of Toxoplasma gondii. Microbiol. Mol. Biol. Rev. 64, 607–623. Bout, D.T., Mevelec, M.N., Velge-Roussel, F., Dimier-Poisson, I., Lebrun, M., 2002. Prospects for a human Toxoplasma vaccine. Curr. Drug Targets Immune Endocr. Metabol. Disord. 2, 227–234. Cong, H., Gu, Q.M., Yin, H.E., Wang, J.W., Zhao, Q.L., Zhou, H.Y., Li, Y., Zhang, J.Q., 2008. Multi-epitope DNA vaccine linked to the A2/B subunit of cholera toxin protect mice against Toxoplasma gondii. Vaccine 26, 3913–3921. Couper, K.N., Nielsen, H.V., Petersen, E., Roberts, F., Roberts, C.W., Alexander, J., 2003. DNA vaccination with the immunodominant tachyzoite surface antigen (SAG-1) protects against adult acquired Toxoplasma gondii infection but does not prevent maternofoetal transmission. Vaccine 21, 2813–2820.
6
J. Li et al. / Veterinary Parasitology 179 (2011) 1–6
Dautu, G., Munyaka, B., Carmen, G., Zhang, G., Omata, Y., Xuenan, X., Igarashi, M., 2007. Toxoplasma gondii: DNA vaccination with genes encoding antigens MIC2, M2AP, AMA1 and BAG1 and evaluation of their immunogenic potential. Exp. Parasitol. 116, 273–282. Denkers, E.Y., Gazzinelli, R.T., 1998. Regulation and function of Tcell-mediated immunity during Toxoplasma gondii infection. Clin. Microbiol. Rev. 11, 569–588. Dobrowolski, J.M., Sibley, L.D., 1997. The role of the cytoskeleton in host cell invasion by Toxoplasma gondii. Behring Inst. Mitt. 99, 90–96. Dubey, J.P., 1990. Status of toxoplasmosis in sheep and goats in the United States. J. Am. Vet. Med. A 196, 259–262. Fachado, A., Rodriguez, A., Angel, S.O., Pinto, D.C., Vila, I., Acosta, A., Amendoeira, R.R., Lannes-Vieira, J., 2003. Protective effect of a naked DNA vaccine cocktail against lethal toxoplasmosis in mice. Vaccine 21, 1327–1335. Fang, R., Nie, H., Wang, Z.S., Tu, P., Zhou, D., Wang, L.X., He, L., Zhou, Y., Zhao, J., 2009. Protective immune response in BALB/c mice induced by a suicidal DNA vaccine of the MIC3 gene of Toxoplasma gondii. Vet. Parasitol. 164, 134–140. Fang, R., Feng, H., Nie, H., Wang, L., Tu, P., Song, Q., Zhou, Y., Zhao, J., 2010. Construction and immunogenicity of pseudotype baculovirus expressing Toxoplasma gondii SAG1 protein in BALB/c mice model. Vaccine 28, 1803–1807. Fowler, R.E., Margos, G., Mitchell, G.H., 2004. The cytoskeleton and motility in apicomplexan invasion. Adv. Parasitol. 56, 213–263. Gazzinelli, R., Hakim, F.T., Hieny, S., Shearer, G.M., Sher, A., 1991. Synergistic role of CD4+ and CD8+ T lymphocytes in IFN-␥ production and protective immunity induced by an attenuated Toxoplasma gondii vaccine. J. Immunol. 146, 286–292. Gazzinelli, R., Xu, Y.H., Hieny, S., Cheever, A., Sher, A., 1992. Simultaneous depletion of CD4+ and CD8+ T lymphocytes is required to reactivate chronic infection with Toxoplasma gondii. J. Immunol. 149, 175–180. Guo, H., Liu, Z., Sun, S., Bao, H., Chen, Y., Liu, X., Xie, Q., 2005. Immune response in guinea pigs vaccinated with DNA vaccine of foot-and mouth disease virus O/China 99. Vaccine 23, 3236–3242. Hu, K., Johnson, J., Florens, L., Fraunholz, M., Suravajjala, S., DiLullo, C., Yates, J., Roos, D.S., Murray, J.M., 2006. Cytoskeletal components of an invasion machine the apical complex of Toxoplasma gondii. PLoS Pathogens 2, e13. Ismael, A.B., Sekkai, D., Collin, C., Bout, D., Mévélec, M.N., 2003. The MIC3 gene of Toxoplasma gondii is a novel potent vaccine candidate against toxoplasmosis. Infect. Immun. 71, 6222–6228. Jongert, E., de Craeye, S., Dewit, J., Huygen, K., 2007. GRA7 provides protective immunity in cocktail DNA vaccines against Toxoplasma gondii. Parasite. Immunol. 29, 445–453. Leyva, R., Hérion, P., Saavedra, R., 2001. Genetic immunization with plasmid DNA coding for the ROP2 protein of Toxoplasma gondii. Parasitol. Res. 87, 70–79. Liu, S., Shi, L., Cheng, Y.B., Fan, G.X., Ren, H.X., Yuan, Y.K., 2009. Evaluation of protective effect of multi-epitope DNA vaccine encoding six antigen segments of Toxoplasma gondii in mice. Parasitol. Res. 105, 267–274. Liu, Q., Gao, S.Y., Jiang, L., Shang, L.M., Men, J.T., Wang, Z., Zhai, Y.J., Xia, Z.P., Hu, R.L., Zhang, X.C., Zhu, X.Q., 2008. A recombinant Pseudorabies
virus expressing TgSAG1 protects against challenge with the virulent Toxoplasma gondii RH strain and pseudorabies in BALB/c mice. Microb. Infect. 8, 1–8. Maciver, S.K., Hussey, P.J., 2002. The ADF/cofilin family: actin-remodeling proteins. Genome Biol. 3, 3007. Mateus-Pinilla, N.E., Dubey, J.P., Choromanski, L., Weigel, R.M., 1999. A field trial of the effectiveness of a feline Toxoplasma gondii vaccine in reducing T. gondii exposure for swine. J. Parasitol. 85, 855–860. Morrissette, N.S., Sibley, L.D., 2002. Cytoskeleton of apicomplexan parasites. Microbiol. Mol. Biol. Rev. 66, 21–38. Saavedra, R., Becerril, M.A., Dubeaux, C.R., Lippens, M.D., Herion, V.P., Bollen, A., 1996. Epitopes recognized by human T lymphocytes in the RoP2 protein antigen of Toxoplasma gondii. Infect. Immun. 64, 3858–3862. Sher, A., Colley, D.G., 1989. Immunoparasitology. In: Paul, W.E. (Ed.), Fundamental Immunology, 1989, 2nd edition. Raven Press, New York, pp. 957–983. Sibley, L.D., 2004. Intracellular parasite invasion strategies. Science 304, 248–253. Suzui, Y., Conley, F.K., Remington, J.S., 1989. Importance of endogenous IFN-for prevention of toxoplasmic encephalitis in mice. J. Immunol. 143, 2045. Suzuki, Y., Remington, J.S., 1988. Dual regulation of resistance against Toxoplasma gondii infection by Lyt2+ , Lyt1+ and L3T4+ T cells in mice. J. Immunol. 140, 3943. Suzuki, Y., Orellana, M.A., Schreiber, R.D., Remington, J.S., 1988. Interferon␥: the major mediator of resistance against T. gondii. Science 240, 516. Vercammen, M., Scorza, T., Huygen, K., De Braekeleer, J., Diet, R., Jacobs, D., Saman, E., Verschueren, H., 2000. DNA vaccination with genes encoding Toxoplasma gondii antigens GRA1. GRA7, and ROP2 induces partially protective immunity against lethal challenge in mice. Infect. Immun. 68, 38–45. Wang, H., Liu, Q., Liu, K., Zhong, W., Gao, S., Jiang, L., An, N., 2007. Immune response induced by recombinant Mycobacterium bovis BCG expressing ROP2 gene of Toxoplasma gondii. Parasitol. Int. 56, 263–268. Wang, H., He, S., Yao, Y., Cong, H., Zhao, H., Li, T., Zhu, X.Q., 2009. Toxoplasma gondii: protective effect of an intranasal SAG1 and MIC4 DNA vaccine in mice. Exp. Parasitol. 122, 226–232. Xiao, S.B., Chen, H.C., Fang, L.R., Liu, C.S., Zhang, H., Jiang, Y.B., 2004. Comparison of immune responses and protective efficacy of suicidal DNA vaccine and conventional DNA vaccine encoding glycoprotein C of Pseudorabies virus in mice. Vaccine 22, 345–351. Xue, M., He, S., Cui, Y., Yao, Y., Wang, H., 2008. Evaluation of the immune response elicited by multi-antigenic DNA vaccine expressing SAG1 ROP2 and GRA2 against Toxoplasma gondii. Parasitol. Int. 57, 424–429. Zhang, J., He, S., Jiang, H., Yang, T., Cong, H., Zhou, H., Zhang, J., Gu, Q., Li, Y., Zhao, Q., 2007. Evaluation of the immune response induced by multiantigenic DNA vaccine encoding SAGl and ROP2 of Toxoplasma gondii and the adjuvant properties of murine interleukin-12 plasmid in BALB/c mice. Parasitol. Res. 101, 331–338.