Immune response and protective efficacy of Eimeria tenella recombinant refractile body protein, EtSO7, in chickens

Veterinary Parasitology 258 (2018) 108–113

Contents lists available at ScienceDirect

Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar

Research paper

Immune response and protective efficacy of Eimeria tenella recombinant refractile body protein, EtSO7, in chickens

T

⁎

Shafiya Imtiaz Rafiqia, Rajat Garga, , Reena K.K.a, Hira Rama, Mithilesh Singhb, P.S. Banerjeea a b

Division of Parasitology, ICAR-Indian Veterinary Research Institute, Izatnagar, Uttar Pradesh, 243122, India Section of Immunology, ICAR-Indian Veterinary Research Institute, Izatnagar, Uttar Pradesh, 243122, India

A R T I C LE I N FO

A B S T R A C T

Keywords: Eimeria tenella Recombinant SO7 Immune response Protective efficacy

Refractile body protein, SO7, is a highly immunogenic protein which is essentially involved in the early development of Eimeria species infecting the domestic chicken. In the present study, the immune response and protective efficacy of recombinant Eimeria tenella SO7 (rEtSO7) protein was assessed in broiler chickens following homologous oocyst challenge. Broiler chicks were subcutaneously immunized with rEtSO7 antigen adjuvanted with Montanide ISA 71 VG on 7 and 21 days of age and protective efficacy of vaccination was evaluated in terms of body weight gain, lesion score and reduction in oocyst output. The peripheral blood lymphocyte proliferation, serum IgY response, and levels of interferon gamma (IFN-γ), interleukin 2 (IL-2), interleukin 4 (IL4), tumor growth factor beta (TGF-β) and nitric oxide (NO) were assessed. The results revealed significant reduction (p < 0.05) in the oocyst output and increased weight gain in immunized birds as compared to unimmunized birds. Significantly increased levels of serum IgY, IFN-γ and proliferation of lymphocytes were evident in rEtSO7 immunized chickens. The results demonstrated that the recombinant protein could effectively elicit the cellular and humoral immune responses in immunized chickens, and provided significant protection against caecal coccidiosis in chickens.

1. Introduction Eimeria tenella is highly pathogenic and one of the most prevalent species of Eimeria infecting chickens, causing significant losses to the broiler industry all over the world. The emergence of multi-drug resistant strains and growing concerns of drug residues warrants for the development of an effective vaccine against the disease (Chapman, 1997). Currently available vaccines are mostly based upon varied formulations of live virulent or attenuated parasites with the exception of CoxAbic (Abic laboratories, Israel), which is based on affinity purified gametocyte antigen of E. maxima. Despite several breakthroughs in the production of anticoccidial vaccines, a strategy is yet to be optimized for production of vaccine with long shelf life that addresses antigenic variations, evokes active immunity and remains relatively inexpensive to manufacture. The extracellular stages of Eimeria, sporozoites and merozoites, are immunologically vulnerable, motile and functionally important for the parasite. Vaccine trials have been conducted at laboratory levels in various parts of the world to identify and test various sporozoite/ merozoite antigens viz. apical membrane antigen-1, refractile body proteins, microneme proteins, surface antigens, heat shock proteins,

⁎

immune mapped protein-1, profilin etc. for their immunoprophylactic potential (Blake et al., 2017). One of the promising vaccine candidates is a highly immunogenic and conserved antigen, SO7, which is found within the refractile body of the sporozoites and contains epitopes common to all Eimeria species infecting the domestic fowl (Crane et al., 1991). SO7 has an important role in cell invasion by the sporozoites and may act as a stimulus for the release of microneme proteins, which further aid in penetration of sporozoites. The role of SO7 in intracellular establishment of the parasite has also been suggested (Fetterer et al., 2007). SO7 provided partial protection against coccidiosis when used in a recombinant protein or a cDNA vaccine format (Kopko et al., 2000; Yang et al., 2010). Previous studies have shown limited success of recombinant proteins derived from Eimeria sp. of chicken, might be due to limited antigenicty, inadequate stimulation of protective immunity and/or restricted expression during parasite life-cycle (Lillehoj et al., 2000). Immunostimulators, such as adjuvants, can enhance the immunogenicity of recombinant antigens in such cases. One such adjuvant, Montanide ISA 71 VG was shown to enhance infiltration of lymphocytes, especially CD8+, at the site of immunization and resulted in better protection in chickens immunized with E. acervulina derived

Corresponding author. E-mail address: [email protected] (R. Garg).

https://doi.org/10.1016/j.vetpar.2018.06.013 Received 20 September 2017; Received in revised form 11 June 2018; Accepted 12 June 2018 0304-4017/ © 2018 Elsevier B.V. All rights reserved.

Veterinary Parasitology 258 (2018) 108–113

S.I. Rafiqi et al.

2.4. Immunoblot analysis of rEtSO7 protein

profilin (Jang et al., 2010). Keeping this in mind, the present study was designed to investigate the immune response and protective efficacy of rEtSO7 administered with Montanide ISA 71 VG adjuvant against homologous challenge with an Indian isolate of E. tenella in chickens.

rEtSO7 protein was resolved on 12% SDS-PAGE and transferred onto nitrocellulose membrane (0.45 μm, Sigma-Aldrich, USA). Expression of the recombinant protein was confirmed by probing the blotted protein with 1:1000 dilution of Ni-NTA HRP conjugate (Qiagen, Germany), as per the protocol provided by the manufacturer. The specificity of rEtSO7 was confirmed by immunoblot using anti-E. tenella convalescent serum (Kundu et al., 2017) at 1:20 dilution.

2. Materials and methods 2.1. Experimental birds Day-old broiler chicks (Gallus gallus), CARIBRO Vishal strain, were procured from ICAR-Central Avian Research Institute, Izatnagar, India and maintained in the experimental animal shed of the Division of Parasitology. Birds were reared in clean steel wire cages with raised wire netting floor inside a well ventilated room, and were provided with coccidiostat-free feed and water ad libidum. Birds were screened periodically for Eimeria infection free status by microscopic examination of droppings and PCR (Kumar et al., 2014).

2.5. Expression and purification of recombinant thioredoxin (rTrx) Thioredoxin, a protein encoded in pET32a(+) vector backbone, is co-expressed in the recombinant protein when the recombinant vector is induced with IPTG. Hence it was expressed and purified for use in mock immunisation as described by Kundu et al. (2017). 2.6. Immunization and challenge

2.2. Parasite The chickens were separated into five groups of 15 chicks each viz. Gp. I (rEtSO7 immunized), Gp. II (oocyst immunized), Gp. III (mock immunized with rTrx), Gp. IV (unimmunized and challenged control) and Gp. V (unimmunized and unchallenged control). Primary immunization was done on day 7, using 50 μg of protein (rEtSO7or rTrx), adjuvanted with Montanide ISA 71 VG (Seppic, France) by the subcutaneous (s.c.) route (Gp. I) or oral gavage with 1000 sporulated oocysts of E. tenella (Gp. II). Booster immunization was administered on day 14 of primary immunization. Birds of groups I–IV were challenged by oral gavage of 10,000 sporulated E. tenella oocysts (Indian isolate-1) on day 7 post-booster immunization. Blood was collected intracardially from six birds of each group under aseptic conditions for harvesting of serum on day 7 (prior to primary immunization, 0 DPI), day 14 (7 day post primary immunization, 7DPI) and day 21 (prior to booster immunization, 14 DPI), and by brachial vein puncture on day 28 (prior to challenge, 7DPB) and day 35 (7 days post-challenge, 7DPC) of the experiment. Blood collected on 7DPB and 7DPC was also used for separation of peripheral blood lymphocytes for use in lymphocyte proliferation assay.

The clonal line of E. tenella sporulated oocysts (Indian isolate-1), maintained in our laboratory (Kundu et al., 2015) was propagated by passaging in 3-week old chickens. Purity of oocyst suspension was assessed by species-specific nested-PCR (Kumar et al., 2014). 2.3. Cloning and expression of E. tenella SO7 protein Sporulated oocysts were purified by flotation technique and decontaminated by treating with 4% (v/v) hypochlorite solution (Merck India Ltd., India). For RNA isolation, 1 × 106 sporulated oocysts of E. tenella were pelleted and an equal quantity of autoclaved glass ballotini beads (0.25–0.5 mm in diameter, Sigma–Aldrich, USA) along with 50 μl of lysis buffer (provided with RNeasy mini kit) was added. The oocysts were ruptured by vortexing (10–15 bursts of 20–30 s with intermittent rest, cooling on ice) and total RNA was isolated using RNeasy mini kit (Qiagen, Germany). cDNA was synthesized from total RNA using oligo dT primers following the protocol described in AccuScript high fidelity first strand cDNA synthesis kit (Stratagene, USA). Primers for the expression of EtSO7 were designed using Gene Tool software with restriction endonuclease (RE) sites for BamHI and HindIII and further validated using Oligo Analyser software. Forward primer ( ACGGATCCAATCTCGCCCCAACTTTTTCCC) and reverse primer (ATA AGCTTCGGTGCAGGAGCTGCTGCTG) were synthesized (Eurofins, India) and the SO7 gene was amplified from the cDNA using a blend of Pfu DNA polymerase and Dream Taq polymerase, in the ratio 1:30 units. The SO7 amplicon was purified using a Minelute PCR purification kit (Qiagen, Germany). The eluted PCR product and pET-32a(+) expression vector were simultaneously double digested with fast digest BamHI and HindIII (Thermo Scientific), gel purified and ligated. The ligation was performed with 10X ligation buffer (2 μl), digested vector (70 ng/2 μl), digested PCR product (120 ng/6 μl), T4 DNA ligase (5 Weiss units/1 μl) and nuclease free water (9 μl), in 0.2 ml PCR tubes at 4 °C with overnight incubation. The ligated product was transformed into the competent BL21(DE3) E. coli cells (Invitrogen, USA) using a Transform Aid bacterial transformation kit (Thermo Scientific, USA). The recombinant EtSO7 clone was grown overnight and fresh culture was induced with 100 mM IPTG (Ambion, USA). The induced cells were incubated for 6 h and harvested by centrifugation. Polyhistidine tagged fusion protein (rEtSO7) was purified under denaturing conditions as per QIAexpressionist™ manual (Qiagen, Germany) and extensively dialyzed with decreasing concentrations of urea and finally PBS. The purity of the recombinant protein was checked by electrophoresis on 12% SDSPAGE gel after staining with Coomassie brilliant blue stain. The concentration of the recombinant protein was quantified by Bradford protein assay kit (Amresco, USA) and stored at −80 °C.

2.7. Evaluation of protective efficacy of rEtSO7 The efficacy of immunization was evaluated on the basis of survival rate, lesion score, body weight gain and oocyst output. The survival rate was estimated by the number of surviving chickens divided by the number of initial chickens in each group. Body weight gain of chickens in each group (n = 8) was determined by the body weight of chickens at the end of experiment (day 42) subtracting the body weight at the time of challenge (day 28). Caecal lesion scores were observed on sixth day post challenge (n = 5) and recorded according to the system described by Johnson and Reid (1970). Additionally, faecal droppings from each group were collected daily between 6th and 11th days postchallenge on a plastic sheet placed under the cage. All the faecal droppings were scraped from the plastic sheet, thoroughly homogenised and weighed. For determining the oocyst output, three random samples (technical replicates) were taken from homogenised faeces, and oocysts per gram of droppings (OPG) were estimated by McMaster counting technique. 2.8. Determination of serum IgY levels by ELISA The IgY levels in the serum were determined by indirect ELISA using 50 ng rEtSO7 antigen and 1:100 diluted test serum per well. Bound antibodies were detected with goat anti-chicken IgY-HRP conjugate (Bethyl, USA) using o-phenylenediamine (OPD) as substrate. Finally, the optical density was read at 492 nm using microplate reader (Bio Rad 680, USA). 109

Veterinary Parasitology 258 (2018) 108–113

S.I. Rafiqi et al.

2.9. Lymphocyte proliferation assay Peripheral blood lymphocytes were isolated by density gradient centrifugation over lymphocyte separation medium (HiSep LSM 1084, Himedia). The cells were washed, adjusted to 5.0 × 106 cells/ml in RPMI medium containing 10% fetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin and incubated in a humidified incubator at 41 °C and 5% CO2 for 48 h with 5 μg/ml of rEtSO7 in 96-well plates. 10 μl freshly prepared 3-(4, 5-dimethyl thiazol-2-yl)-2, 5-diphenyl tetrazolium bromide (MTT) in PBS (5 mg/ml) was added to each well and incubated for 4 h. Subsequently, DMSO was added to each well to dissolve the formazan crystals @100 μl/well, and the absorbance was read at 570 nm. 2.10. Determination of serum cytokines and nitric oxide concentration Sera collected from six chickens of each group were pooled into three aliquots of two chickens. Biological triplicates (n = 3) were used for each group in the study for estimation of serum cytokine levels. Different cytokines, namely IFN-γ, IL-2, IL-4, TGFβ and nitric oxide (NO) were quantified by sandwich ELISA using commercially available kits (Biospes, China). For calculation of concentration, standard curve was plotted by using four paramater logistic (4-PL) curve-fit software. The OD450 values of each sample were interpolated in the 4 PL curve to obtain the absolute values. 2.11. Statistical analysis Fig. 1. Western blot analysis of recombinant EtSO7 with Ni-NTA HRP conjugate (Lane 1) and convalescent chicken serum (Lane 2).

The data obtained was subjected to statistical analysis by employing analysis of variance (ANOVA) using the SPSS statistical package (SPSS for Windows 20 software). Differences between and within groups were tested with one-way ANOVA Duncan’s multiple range test, and p < 0.05 was considered to be significant.

3.3. IgY response against rEtSO7 There was a sharp increase in anti-SO7 IgY titres post-booster immunization, almost 8 times higher on 7DPB (i.e. the day of challenge) as compared to pre-immunized (0 DPI) levels in rEtSO7 immunized birds. The IgY levels were highly significant (p < 0.05) and continued to rise significantly (p < 0.05) post challenge as well (Supplementary Fig. 1a). A significantly higher (p < 0.05) level of anti-SO7 IgY was also observed in oocyst immunized group on 7DPB.

3. Results 3.1. Cloning and expression of EtSO7 protein The PCR amplified SO7 gene (958bp) of the E. tenella Indian isolate1 was cloned into pET32a(+), sequenced and the gene sequence was submitted to GenBank (KX826909). Sequence similarity searches in BLASTn revealed that the Indian isolate-1 EtSO7 gene (KX826909) was 100% identical to the Houghton strain of E. tenella (XM013379449.1). The recombinant EtSO7 was expressed in E. coli BL21(DE3) as His6tagged fusion protein of approx. 46 kDa. On Western blotting, the polyhistidine tag of rEtSO7 fusion protein was identified by Ni-NTA HRP conjugate and the recombinant protein reacted strongly with antiE. tenella convalescent chicken serum (Fig. 1).

3.4. Lymphocyte proliferation assay The lymphocyte proliferation response in terms of stimulation index was significantly higher (p < 0.05) in the rEtSO7 immunized birds both pre-challenge (7DPB) as well as post-challenge (7DPC) when compared with the unimmunized challenged and unimmunized unchallenged controls (Supplementary Fig. 1b). 3.5. Serum cytokines and nitric oxide concentration

3.2. Protective efficacy of rEtSO7 IFN-γ levels were significantly (p < 0.05) higher in the rEtSO7 immunized group throughout the experiment as compared to other groups (Fig. 2a). On 7DPI, the serum IFN-γ concentration in rEtSO7 immunized birds was 120 ± 1.43 pg/ml, which further increased significantly (p < 0.05) to 160 ± 2.25 pg/ml on 7DPB (day of challenge) and 212.5 ± 3.09 pg/ml on 7DPC. In the oocyst immunized birds, significantly higher levels of IFN-γ were recorded on 7DPI as compared to pre-immunized birds and this higher concentration was maintained on 7DPB. Like rEtSO7 immunized birds, the concentration of IFN-γ again increased significantly (p < 0.05) post-challenge to reach 197.5 ± 3.57 pg/ml on 7DPC in oocyst immunized birds. The concentration of IL-2 in the serum of rEtSO7 immunized birds was significantly higher (p < 0.05) post-immunization as compared to unimmunized and mock immunized groups (Fig. 2b). A significant

The average body weight gain in rEtSO7 immunized birds (696.21 ± 48.43 g) was significantly (p < 0.05) higher as compared to unimmunized-challenged (560.01 ± 63.36 g) and mock immunized (596.8 ± 14.56 g) birds. The relative weight gain on day 12 postchallenge in the rEtSO7 immunized birds was 86.77%, while it was 82.47% and 69.79% in oocyst immunized and unimmunized-challenged birds, respectively (Table 1). The decrease in oocyst output was 74.46% in rEtSO7 immunized group, while it was 93.74% in the oocyst immunized group as compared to unimmunized challenged birds. There was significant (p < 0.05) reduction in the lesion score of the immunized birds (1.6 ± 0.24) as compared to unimmunized challenged birds (2.6 ± 0.40). Immunization with rEtSO7 resulted in moderate protection following homologous oocyst challenge. 110

Veterinary Parasitology 258 (2018) 108–113

S.I. Rafiqi et al.

Table 1 Protective efficacy of rEtSO7 antigen in immunized chickens following homologous oocyst challenge. All values were estimated by ANOVA (Duncan’s post hoc) at p ≤ 0.05. Groups

Average body wt. gain (gm)

Relative body wt. gain (%)

Average lesion score

Oocyst output per bird (x 106)

Oocyst reduction (%)

Gp. I (EtSO7) Gp. II (OI) Gp. III (Trx-Adj) Gp. IV (UNC) Gp. V (UNUC)

696.21 ± 48.43a

86.77

1.6 ± 0.24a

7.1 ± 0.68

74.46

661.7 ± 56.58a

82.47

1.4 ± 0.24a

1.74 ± 0.23

93.74

74.38

2.6 ± 0.24

b

23.68 ± 1.04

14.82

560.01 ± 63.36c

69.79

2.6 ± 0.40b

27.8 ± 1.30

–

802.33 ± 11.51d

100

–

–

–

596.8 ± 14.56

b

immunized birds on 7DPI, after which it was maintained at almost constant level throughout the experiment (Fig. 2d). The concentration of TGF-β significantly increased on 7DPI and 7DPB (142 ± 4.74 pg/ ml) in oocyst immunized birds, after which there was a significant drop in its concentration. In unimmunized challenged birds, the concentration of TGF-β increased significantly only post-challenge. The NO concentration in rEtSO7 immunized (193.75 ± 4.37) and oocyst immunized groups (223.75 ± 4.96) increased significantly (p < 0.05) on 7DPI as compared to other groups, although a significant decrease in NO concentration was observed in rEtSO7 immunized group (173.75 ± 6.16 nmol/ml) on 7DPB, it was still significantly higher than the unimmunized challenged group (122.5 ± 2.7 nmol/ ml). On 7DPC, significant increase (p < 0.05) in the concentration of NO was observed in all the groups except unimmunized unchallenged controls, with the highest concentration in oocyst immunized group

decrease (p < 0.05) in the concentration of IL-2 was observed in rEtSO7 immunized group post-challenge. The IL-2 levels showed a significant increase in unimmunized challenged group on 7DPC. A significant increase in the levelof IL-4 was observed in the rEtSO7 and oocyst immunized groups on 7DPI as compared to mock immunized and unimmunized challenge controls (Fig. 2c). However, after this initial increase, the concentration of IL-4 significantly decreased to 139.5 ± 3.40 pg/ml on 7DPB and further to 133.5 ± 1.65 pg/ml on 7 DPC in rEtSO7 immunized birds. The oocyst immunized birds also showed a similar trend pre-challenge for IL-4, but there was an insignificant increase (176 ± 4.71 pg/ml) post-challenge. In contrast, there was a highly significant (p < 0.05) increase in IL-4 concentration postchallenge (from 110.5 ± 4.52 pg/ml on 7DPB to 157.2 ± 6.03 pg/ml on 7DPC) in unimmunized challenged controls. TGF-β levels showed a significant increase (p < 0.05) in rEtSO7

Fig. 2. Serum cytokine response in chickens following immunization and Eimeria tenella challenge. (a) IFN-γ, (b) IL-2, (c) IL-4, (d) TGFβ. (SO7- rEtSO7+ Montanide ISA 71 VG adjuvant immunized, OI- Oocyst immunized, Trx- Thioredoxin + Montanide ISA 71 VG adjuvant mock immunized, UNC- Unimmunized challenged, UNUC- Unimmunized unchallenged). 111

Veterinary Parasitology 258 (2018) 108–113

S.I. Rafiqi et al.

in chickens of rEtSO7 immunized group increased post-primary immunization. Thus, IL-4 can be expected to increase antibody production and improve the immune response. TGF-β is known to stimulate the repair of damaged mucosal epithelial integrity following injury (Robinson et al., 2000). The results of our study are in concordance, as the concentration of TGF-β was significantly higher in rEtSO7 immunized birds from 7DPI to 7DPB. Following infection, TGF-β increased significantly in unimmunized challenged birds, which might be due to more release of TGFβ for the repair of highly damaged intestinal mucosa. The findings of the present study indicate that the rEtSO7 protein induced diverse and robust cell mediated and humoral immune response involving multiple cytokines and resulted in considerable protection in the immunized chickens following experimental homologous Eimeria tenella infection. However, further studies are warranted with respect to use of different adjuvants, antigen-dose regimen and route of vaccination. It will be interesting to study the immunoprotective efficacy of rEtSO7 in chickens against heterologous challenge. Cocktail immunization with other putative vaccine candidates of E. tenella, targeting different life cycle stages of the parasite will further strengthen the endeavor of recombinant vaccine against poultry coccidiosis.

(296.25 ± 5.04 nmol/ml). 4. Discussion The refractile body protein, SO7, has been shown to provide protection not only against homologous infection but also against heterologous infection, suggesting that the SO7 gene may be a good candidate for use in recombinant vaccine development against coccidiosis (Crane et al., 1991). The rEtSO7 protein when given along with Montanide ISA 71 VG could significantly reduce the oocyst output and lesion scores in the immunized birds as compared to unimmunized challenged birds following homologous sporulated oocyst challenge in this study. In case of vaccinated birds, lesions may appear not only because of challenge, but also due to pathophysiological changes and development of protective immunity (Byrnes et al., 1993). Our study also revealed a significant weight gain in recombinant protein immunized group as compared to oocyst immunized, unimmunized and mock immunized groups. Since coccidiosis results in significant weight loss in infected birds, it is an important criterion for evaluating vaccine efficacy. Increase in live weight gain following immunization with different eimerian antigens has been reported by several workers (Jang et al., 2010; Zhu et al., 2012; Song et al., 2013). Birds produce parasite-specific antibodies in circulation and across mucosal surfaces in response to coccidial infection. Although, the role of humoral immune responses in coccidiosis is debatable in terms of conferring protective immunity, it has been suggested that antibodies prevent translocation of sporozoites and merozoites across mucousal membranes, and might be important in neutralizing Eimeria while it is in the extracellular stages of life cycle (Lillehoj and Lillehoj, 2000). In our study, robust IgY response was evident on 7DPB which kept on increasing post-challenge as well. Several investigators have also analyzed the serum antibody response in immunized chickens and showed a high IgY response following immunization and challenge with eimerian oocysts (Hoan et al., 2014; Kundu et al., 2017). However, this increase in IgY response may not be functional with reference to control of Eimeria sp. The role of T-cells in conferring protection against coccidiosis is well established. Direct evidence for the presence of Eimeria-specific T-cells was demonstrated by an in vitro antigen-driven lymphoproliferation assay (Lillehoj, 1986). In the present study, the proliferation of lymphocytes in response to rEtSO7 antigen on the day of challenge as well as one week post-challenge was significantly higher (p < 0.05) in comparison to the unimmunized challenged/ unchallenged groups. The present findings suggest that rEtSO7 protein enhanced the T-cell response in birds, which is crucial for conferring protective immunity against coccidiosis. Cytokines are important secondary messengers that play a key role in regulating immune responses. Th1 related cytokines like IFNγ, along with the Th2 cytokines like IL-4 and IL-10 are expressed by IELs during coccidiosis (Cornelissen et al., 2009). Serum IFN-γ levels in rEtSO7 immunized birds were significantly increased on 7DPI and were highest on 7DPC. Similar to INF-γ levels, IL-2 levels also increased significantly from 7DPI to 7DPB. IL-2 is important cytokine for B-cell and NK cell activation and has got adjuvant properties as well (Min et al., 2001). Therefore, the immunoregulatory role of IL-2 is well evident. Increased IFN-γ and IL-2 transcript levels of chickens immunized with different subunit vaccines have resulted in higher oocyst reduction (Zhu et al., 2012; Hoan et al., 2014). IFN-γ also mediates the nitric oxide production and contributes to intracellular parasite killing (Ovington et al., 1995). However, high levels of NO are detrimental for host since it causes tissue damage as well (Allen, 1997). A significantly higher concentration of NO in serum was observed in mock immunized and unimmunized challenged groups post-challenge, which might be responsible for greater damage to intestinal mucosa in these groups. Another cytokine, IL-4, is essential for B-cell differentiation and proliferation, and accordingly, production of antibodies. Serum IL-4 levels

Ethics statement All animal studies were carried out in the Experimental Animal Shed of the Division of Parasitology, ICAR-Indian Veterinary Research Institute, Izatnagar, India. Prior approval for experimental trials and procedures to be used on chickens was obtained from the Institutional Animal Ethics Committee, IVRI (registered with the Committee for the Purpose of Control and Supervision of Experiments on Animals, Ministry of Environment, Forest and Climate Change, Government of India), vide F.1–53/2012-13/JD(R) dated 22.05.2015. Permission for use of recombinant proteins in the experiment was obtained from the Institutional Biosafety Committee, IVRI, reference F.12-8/IBSC/JD(R)/ 15–16 dated 25.02.2015, as per the norms of Department of Biotechnology, Government of India. Conflict of interests The authors declare that there is no conflict of interest regarding the publication of this paper. Acknowledgements The authors express sincere thanks to the Director, ICAR-Indian Veterinary Research Institute, Izatnagar, Bareilly, India for providing necessary facilities to conduct the study. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.vetpar.2018.06.013. References Allen, P.C., 1997. Nitric oxide production during Eimeria tenella infections in chickens. Poult. Sci. 76, 810–813. Blake, D.P., Pastor-Fernandez, I., Nolan, M.J., Tomley, F.M., 2017. Recombinant anticoccidial vaccines-a cup half full. Inf. Gen. Evol. 55 365-365. Byrnes, S., Eaton, R., Kogut, M., 1993. In vitro interleukin-1 and tumor necrosis factor alpha production by macrophages from chickens infected with either Eimeria maxima or Eimeria tenella. Int. J. Parasitol. 23, 639–645. Chapman, H., 1997. Biochemical, genetic and applied aspects of drug resistance in Eimeria parasites of the fowl. Avian Pathol. 26, 221–244. Cornelissen, J.B., Swinkels, W.J., Boersma, W.A., Rebel, J.M., 2009. Host response to simultaneous infections with Eimeria acervulina, E. maxima and E. tenella: a cumulation of single responses. Vet. Parasitol. 162, 58–66. Crane, M.S.J., Goggin, B., Pellegrino, R.M., Ravino, O.J., Lange, C., Karkhanis, Y.D., Kirk, K.E., Chakraborty, P.R., 1991. Cross-protection against four species of chicken

112

Veterinary Parasitology 258 (2018) 108–113

S.I. Rafiqi et al.

assessment of T cell proliferation response to stage specific parasite antigens. Vet. Immunol. Immunopathol. 13, 321–330. Lillehoj, H.S., Lillehoj, E.P., 2000. Avian coccidiosis. A review of acquired intestinal immunity and vaccination strategies. Avian Dis. 44, 408–425. Lillehoj, H.S., Choi, K.D., Jenkins, M.C., Vakharia, V.N., Song, K.D., Han, J.Y., Lillehoj, E.P., 2000. A recombinant Eimeria protein inducing interferon-γ production: comparison of different gene expression systems and immunization strategies for vaccination against coccidiosis. Avian Dis. 44, 379–389. Min, W., Lillehoj, H.S., Burnside, J., Weining, K.C., Staeheli, P., Zhu, J.J., 2001. Adjuvant effects of IL-1β, IL-2, IL-8, IL-15, IFN-α, IFN-γ TGF-β4 and lymphotactin on DNA vaccination against Eimeria acervulina. Vaccine 20, 267–274. Ovington, K.S., Alleva, L.M., Kerr, E.A., 1995. Cytokines and immunological control of Eimeria spp. Int. J. Parasitol. 25, 1331–1351. Robinson, P., Okhuysen, P.C., Chappell, C.L., Lewis, D.E., Shahab, I., Lahoti, S., White Jr, A.C., 2000. Transforming growth factor β1 is expressed in the jejunum after experimental Cryptosporidium parvum infection in humans. Infect. Immun. 68, 5405–5407. Song, H., Qiu, B., Yan, R., Xu, L., Song, X., Li, X., 2013. The protective efficacy of chimeric SO7/IL-2 DNA vaccine against coccidiosis in chickens. Res. Vet. Sci. 94, 562–567. Yang, G., Wang, C., Hao, F., Zhao, D., Zhang, Y., Li, Y., 2010. Studies on construction of a recombinant Eimeria tenella SO7 gene expressing Escherichia coli and its protective efficacy against homologous infection. Parasitol. Int. 59, 517–523. Zhu, H., Yan, R., Wang, S., Song, X., Xu, L., Li, X., 2012. Identification and molecular characterization of a novel antigen of Eimeria acervulina. Mol. Biochem. Parasitol. 186, 21–28.

coccidia with a single recombinant antigen. Infect. Immun. 59, 1271–1277. Fetterer, R.H., Jenkins, M.C., Miska, K.B., Barfield, R.C., 2007. Characterization of the antigen SO7 during development of Eimeria tenella. J. Parasitol. 93, 1107–1113. Hoan, T.D., Thao, D.T., Gadahi, J.A., Song, X., Xu, L., Yan, R., Li, X., 2014. Analysis of humoral immune response and cytokines in chickens vaccinated with Eimeria brunetti apical membrane antigen-1 (EbAMA-1). DNA Vaccine 144, 52–67. Jang, S.I., Lillehoj, H.S., Lee, S.H., Lee, K.W., Park, M.S., Bauchan, G.R., Lillehoj, E.P., Bertrand, F., Dupuis, L., Deville, S., 2010. Immunoenhancing effects of MontanideTM ISA oil-based adjuvants on recombinant coccidian antigen vaccination against Eimeria acervulina infection. Vet. Parasitol. 172, 221–228. Johnson, J., Reid, W.M., 1970. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp. Parasitol. 28, 30–36. Kopko, S.H., Martin, D.S., Barta, J.R., 2000. Responses of chickens to a recombinant refractile body antigen of Eimeria tenella administered using various immunizing strategies. Poult. Sci. 79, 336–342. Kumar, S., Garg, R., Moftah, A., Clarke, E., MacDonald, S.E., Chaudhary, A.S., Sparagano, O., Banerjee, P.S., Kundu, K., Tomley, F.M., Blake, D.P., 2014. An optimized protocol for molecular identification of Eimeria from chickens. Vet. Parasitol. 199, 24–31. Kundu, K., Bannerjee, P.S., Garg, R., Kumar, S., Mandal, M., Tomley, F., Blake, D., 2015. Cloning and sequencing of beta-tubulin and internal transcribed spacer-2 (ITS-2) of Eimeria tenella isolate from India. J. Parasit. Dis. 39, 539–544. Kundu, K., Garg, R., Kumar, S., Mandal, M., Tomley, F.M., Blake, D.P., Banerjee, P.S., 2017. Humoral and cytokine response elicited during immunisation with recombinant immune mapped protein-1 (EtIMP-1) and oocysts of Eimeria tenella. Vet. Parasitol. 244, 44–53. Lillehoj, H.S., 1986. Immune response during coccidiosis in SC and FP chickens. I. In vitro

113