Immune responses in the Japanese pufferfish (Takifugu rubripes) head kidney cells stimulated with particulate silica

Fish & Shellfish Immunology 49 (2016) 84e90

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Immune responses in the Japanese pufferfish (Takifugu rubripes) head kidney cells stimulated with particulate silica Takashi Morimoto a, Gouranga Biswas b, 1, Tomoya Kono a, Masahiro Sakai a, Jun-ichi Hikima a, * a b

Department of Biochemistry and Applied Biosciences, Faculty of Agriculture, University of Miyazaki, 1-1 Gakuenkibanadai-nishi, Miyazaki 889-2192, Japan Interdisciplinary Graduate School of Agriculture and Engineering, University of Miyazaki, 1-1 Gakuenkibanadai-nishi, Miyazaki 889-2192, Japan

a r t i c l e i n f o

a b s t r a c t

Article history: Received 7 August 2015 Received in revised form 12 December 2015 Accepted 12 December 2015 Available online 17 December 2015

Studies on immune response to crystal silica in mammals indicate immune stimulation effect of environmental parameters including silica or asbestos, but there is no information on this aspect in lower vertebrates. Therefore, we examined expression of cytokine genes related to innate immunity in the Japanese pufferfish, Fugu (Takifugu rubripes) head kidney (HK) cells stimulated with particulate silica at 10 and 50 mg mL
1. Expression of eleven cytokine genes was analyzed by the multiplex RT-PCR method (GenomeLab Genetic Analysis System, GeXPS; Beckman Coulter Inc.). Additionally, to confirm functionality of activated inflammatory immunity, we assessed phagocytic activity. Expression of NLR family genes as potential sensor molecules of inflammasome and inflammasome-associated genes (ASC and caspase-1) was also confirmed in HK cells by quantitative real-time PCR (qRT-PCR). As a result, an increased gene expression of pro-inflammatory cytokines (IL-6, IL-17A/F3, TNF-a, TNF-b and IFN-g) and other cytokines (IL-4/13A, IL-4/13B, Type I-IFN) was recorded in particulate silica stimulated HK cells. Moreover, phagocytic activity showed a tendency to significantly increase in stimulated monocyte of HK cells after 6 h. Expression of NLR-C9 and NLR-C12 genes significantly increased in silica-stimulated HK cells. The particulate silica also significantly induced expression of inflammosome-associated genes, which may relate to the induced NLR-Cs. © 2015 Elsevier Ltd. All rights reserved.

Keywords: Inflammatory cytokines Multiplex RT-PCR Particulate silica Japanese pufferfish ASC Caspase-1

1. Introduction Environmental danger factors (e.g., particulate silica, asbestos, and aluminum salt) and danger/damage-associated molecular patterns (DAMPs) including various endogenous danger signals stimulate innate immune system [1,2], and among these, particulate silica and aluminum salt have an effect to induce specific immunity through activation of the innate immunity. In mammals, experiments on immune response induced by the danger factors have been conducted to understand the relationship between

Abbreviations: NLR, nucleotide binding oligomerization domain (NOD)-like receptor; ASC, apoptosis-associated speck-like protein containing a caspase activation and recruitment domain; NF-kB, nuclear factor-kB; multiplex RT-PCR, multiplex reverse transcription-polymerase chain reaction; IL, interleukin; TNF, tumor necrosis factor; IFN, interferon; TGF, transforming growth factor. * Corresponding author. E-mail address: [email protected] (J.-i. Hikima). 1 Present address: Kakdwip Research Centre of ICAR-Central Institute of Brackishwater Aquaculture, Kakdwip, South 24 Parganas, West Bengal 743347, India. http://dx.doi.org/10.1016/j.fsi.2015.12.023 1050-4648/© 2015 Elsevier Ltd. All rights reserved.

danger signals and immune stimulation through environmental parameters including exogenous and endogenous elements such as silica, asbestos, hydroxyapatite, microbial toxins, cholesterol, ATP and other danger components. In addition, DAMPs of endogenous origin have a potential to induce an inflammatory reaction that is indispensable to an autoimmune response [3]. “Silica” or silicon dioxide (SiO2) exists in the form of a crystalline material (e.g., particulate silica) or the amorphous substance as a compound on the earth in soil, sand and rock. The particulate silica exerts a stress and causes damage as an environmental nano-particle, which induces release of cytokine or growth factor from macrophages and epithelial cells. In mammals, silica and alum stimulate macrophages to produce the caspase-1dependent cytokines, interleukin (IL)-1b and
18 by activating an inflammasome [4e7]. The inflammasome is comprised of three molecules, namely nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs; i.e. the sensor molecules including NLRP1, NLRP3, NLRP6, NLRP12 and NLRC4), apoptosis-associated speck-like protein containing a caspase activation and

T. Morimoto et al. / Fish & Shellfish Immunology 49 (2016) 84e90

85

Table 1 Oligonucleotide sequences used for qRT-PCR analysis Gene

Accession number

Forward primer (50 / 30 )

Reverse primer (50 / 30 )

Product size (bp)

NLR-C1 NLR-C2 NLR-C3 NLR-C4 NLR-C5 NLR-C6 NLR-C7 NLR-C8 NLR-C9 NLR-C10 NLR-C11 NLR-C12 NLR-C13 NOD2 NLRC3 NLRX1 ASC Caspase-1 b-actin

ENSTRUG00000000100a ENSTRUG00000001210a ENSTRUG00000002199a ENSTRUG00000002379a ENSTRUG00000002476a ENSTRUG00000002649a ENSTRUG00000004765a ENSTRUG00000005898a ENSTRUG00000006039a ENSTRUG00000008094a ENSTRUG00000013076a ENSTRUG00000014811a ENSTRUG00000010250a NP_001035913.1b ENSTRUG00000015221a XM_003976996b NW_004071954b XM_003968404b U37499b

CACAGAAATACGCGGCTTCA AGTCAACGTGCTCCTGATGA CAGATTCCTCCCTCGTGTGT GGTATCGTCAGTTGAGGTGC GCAGCCAATCAGATTCCTCCATCA GATGGCCTGGATGAAAGCAG TTTTATCAGAGACCAGCTGTGGTTC GGAGAGCACTAATGAAATCTCTCA TAAGGTTCAGTGACGAAGATCTGAG ACAACACATCAGCAGAGGGA GAACCTGCGGCAGTACAAAA GTCCAGACCACAAAGGCGAA ACAGGATCTTGACTCATGTCCT CGACTAGGCCAGCTTGCCTTTA GACGTGTTTGTGCGCTTTCTAGCG CACATGTGCCACTCTGCATTGCC GTGCTCTGATCAACAGGGTG GACGTTTGAAGATGACCTCTTC CCAGAAAGACAGCTACGTTGG

TGGGATCAGACACATGACGT TGTCAACACACGATGGAGGA GGAGGCCTTGATGTGTGAGA ACACACGAGGGAGGAATCTG ATGATGTGGAGGCTCCTGGAGGCCTTGAG GGTGATCCAGATGAGAGCTG GCTGGTTGTAGCTCAGTTTTAGAAT GGATGGTTTCTGGGTGGTTCTCCA AAGCTCCTCTCTCTCGTCCGTGGAG TGAGGCCACGACTTCACAG GGGTTTGACGTCATTGCTGA GTCGGACTGATAGAAGACAA AGATCCCACCTGTCTGTCCCTC GCGAAGAAACACTGCATGGTCAC GTACGAAGAGACACAACTGCACCT GCATCAAAGAACTGTGGTGCTCC CAT GTT GGC AGA CCT CTG AT TGCAGGCCTGGATGATGATGAT GCAACTCTCAGCTCGTTGTAG

136 113 135 117 161 144 90 143 153 113 117 150 143 188 164 167 109 110 147

a b

Ensembl genome browser ID. GenBank database accession number.

recruitment domain (ASC) and pro-caspase-1, and it functions for recognition of some of the pathogen associated molecular patterns (PAMPs), and finally cleaves pro-IL-1b and
18 to mature them in the cytoplasmic area [8]. However, the NLR orthologs as the sensors for inflammasome is still unknown in vertebrates other than mammals. Since the diversity of NLR family in teleosts is very different from that of mammals [9,10], it is difficult to find the mammalian counterparts of the inflammasome sensors such as NLRP1, NLRP3, NLRP6, NLRP12 and NLRC4 in fish. To date, more than 100 cytokine molecules have been identified in human. These cytokines are known to play an important role in immune response of host innate defense mechanism [11]. Cytokines include ILs, tumor necrosis factors (TNFs), transforming growth factor (TGF), chemokines and interferons (IFNs) produced by different cells including macrophages, lymphocytes, granulocytes, dendritic cells (DCs) and epithelial cells, and have proinflammatory, anti-inflammatory and pathogen-killing properties [12]. Cytokines play an important role in the immune system by binding to specific receptors at the cell membrane, setting off a cascade that leads to induction, enhancement or inhibition of a number of cytokine-regulatory genes in the nucleus [13]. However, comprehensive gene expression patterns of cytokines after stimulation with the environmental factors such as silica nanoparticles are still not clear in lower vertebrates including teleosts, and it is important to understand the effects of environmental substances as danger components to the host innate immunity. In the present study, we focused on understanding expression of pro-inflammatory cytokines, NLR family and inflammasomeassociated genes in the Japanese pufferfish, Fugu (Takifugu rubripes) head kidney (HK) cells stimulated with particulate silica in vitro using the multiplex RT-PCR and quantitative real-time PCR (qRTPCR). Additionally, to confirm functionality of the inflammatory response induced by silica, we also assessed phagocytic activity in the particulate silica-stimulated HK cells. 2. Materials and methods 2.1. Experimental fish, HK cells stimulation by silica and RNA extraction Fugu (300 ± 5 g; n ¼ 3) were obtained from the local fish farm

(Matsumoto Fisheries Farm, Miyazaki, Japan) and the fish were first acclimatized in an aerated saltwater tank at 20  C and fed a commercial diet (Sango, Higashimaru Co., Ltd., Kagoshima, Japan) for a week under a natural photoperiod prior to their use in this study. This experiment was conducted according to the relevant national and international guidelines, ‘Act on Welfare and Management of Animals’ (Ministry of the Environment, Japan). Isolation of HK and cell preparation were performed as per the previous protocol [14]. Viable cells in RPMI 1640 medium (Invitrogen, Carlsbad, CA, USA) supplemented with 5% fetal bovine serum (FBS) and 1% streptomycin/penicillin (Invitrogen) were adjusted to 1  107 cells mL
1 after enumeration using trypan blue stain (Life Technologies, NY, USA) and seeded in wells of a 24-well plate (Nunc A/S, Roskilde, Denmark). The cells were treated with particulate silica (Junsei Chemical Co., LTD, Tokyo, Japan) at 10 or 50 mg mL
1 final concentrations and incubated for 1, 6, 12, 24 and 36 h at 25  C. A control (cells without stimulation) was maintained for each time point. Each treatment and control had three replicates. Incubated cells were harvested at the time points mentioned above, submerged in RNAlater solution (Ambion, Austin, TX, USA) for overnight and finally stored at
80  C prior to RNA extraction. Total RNA was extracted from the stimulated HK cells using ISOGEN (Nippon Gene, Tokyo, Japan) according to the manufacturer's instructions. RNA samples were treated with a recombinant DNase I (RNase-free) for removal of genomic DNA, as per the manufacture's protocol (Takara Bio Inc., Shiga, Japan). All RNA samples were checked quantitative and qualitatively in a NanoDrop spectrometer, ND-1000 (Thermo Scientific, Wilmington, DE, USA). 2.2. Multiplex RT-PCR and capillary electrophoresis In this study, a multiplex reverse transcription-polymerase chain reaction (RT-PCR) assay (GenomeLab Genetic Analysis System, GeXPS; Beckman Coulter, Inc., Brea, CA, USA) was used to analyze expression of 19 cytokine genes simultaneously from a single reaction tube. RNA samples of the stimulated HK cells (1, 6, 12 and 24 h) were used in the assay. Primer design (19 cytokine plex) and multiplex analysis were conducted using the multiplex assay panel described previously [15]. The multiplex RT-PCR was performed using 19 cytokine universal primers adjusted to amplify

86

T. Morimoto et al. / Fish & Shellfish Immunology 49 (2016) 84e90

Fig. 1. Expression (mean ± SD; n ¼ 3) of pro-inflammatory cytokine (IL-1b, IL-17A/F3, TNF-a, TNF-N and IFN-g) and other cytokine genes at different time points in the Fugu head kidney cells stimulated with particulate silica (50 mg mL
1). Bars with asterisks indicate significant differences in expression levels between stimulated and unstimulated control cells at a time point (*P < 0.05).

the target genes. The PCR-products from multiplex RT-PCR were prepared and run in the GeXP Genetic Analysis System for capillary electrophoresis and fragment size analysis as per the previously described protocol [16]. The data were normalized to the external synthetic reference control transcript, kanamycin resistance gene using GeXP profiler (eXpress Analysis) software, with the areaunder-the-curve set to 1. The relative expression level of only those cytokine genes which could be detected in this analysis was calculated by normalization to the reference gene, b-actin using GeXP Quant Tool.

2.3. Phagocytic activity After isolation of leukocytes and monocytes from Fugu HK cells according to the described protocol [10], stimulation was carried out with particulate silica (10 and 50 mg mL
1). The phagocytic activity of HK cells using flow cytometry was performed at 0, 6, 12 and 36 h post stimulation (hps) following the method described elsewhere [14]. Briefly, after removing the non-adherent cells by

washing with PBS, the viable cells (1  107 cells mL
1) were incubated with a suspension of yellow-green fluorescent latex beads (Molecular Probes, Invitrogen, Karlsruhe, Germany) of 1 mm diameter at a ratio of approximately 30 beads per cell. Samples were incubated at 25  C for 2 h and cells associated fluorescence was evaluated. The samples were analyzed in a Coulter Epics XL flow cytometer (Beckman Coulter, Inc.) with a single air-cooled laser adjusted to 675 nm (FL4) to detect the fluorescence of beads engulfed by phagocytic cells. In this experiment, the flow cytometer was calibrated/optimized such that the fluorescence of free or no beads was adjusted to 100 FL4-Log fluorescence units (negative gate setting). The resulting fluorescence histograms plotting cell number versus fluorescence intensity were analyzed. Phagocytic activity was accurately evaluated mathematically using the FlowJo software (Tree Star, Inc., San Carlos, CA, USA) to calculate the percentage of cells with fluorescent intensity equivalent to at least one bead.

T. Morimoto et al. / Fish & Shellfish Immunology 49 (2016) 84e90

87

2.5. Statistical analysis One-way analysis of variance (ANOVA) followed by Turkey's test was run to find out any difference in cytokine gene expressions and phagocytic activity [24]. Difference in expression levels of NLR family and inflammasome-associated genes between the control and particulate silica-stimulated samples at each sampling time was calculated by student's t-test. 3. Results 3.1. Expression of cytokine genes Although transcriptional responses of 19 cytokine genes were analyzed by multiplex RT-PCR, 11 genes, which could be detected were used for the calculation of expression values that are illustrated in Fig. 1. In the multiplex RT-PCR analysis, there were constitutively higher expressions (P < 0.01) of the pro-inflammatory, IL-17A/F3, TNF-a, TNF-N (TNF-Novel) and IFN-g genes in the HK cells treated with particulate silica (50 mg mL
1) (Fig. 1). Although, particulate silica (50 mg mL
1) stimulation caused an increased expression of the pro-inflammatory cytokine, IL-1b gene at 24 hps only, other pro-inflammatory cytokines (IL-17A/F3, TNF-a, TNF-N) had an increased transcript level from 1 to 24 hps. Moreover, IFN-g exhibited an increased expression from 6 to 24 hps with the highest peak was at 12 hps. Among other cytokine genes, IL-2, IL-4/13B and type I-IFN (IIFN-1) gene expressions were significantly increased (P < 0.01) in silica (50 mg mL
1) stimulated HK cells at a few time points (Fig. 1). IL-4/13A had an increased expression at 6 hps only and then expression was gradually decreased. On the other hand, an increased IL-4/13B expression was at an early phase of 1 hps and after that expression diminished. A constitutively higher expression of I-IFN-1 was noticed in the treated HK cells from 1 to 24 hps (Fig. 1). There were no specific and significant trends in IL-21 and TGF-b1 expressions observed in the stimulated HK cells. Fig. 2. Phagocytic activity (mean ± SD; n ¼ 3) in the Fugu head kidney leukocytes (A) and monocytes (B) stimulated with particulate silica (10 or 50 mg mL
1). Phagocytic activity indicates the percentage of cells that phagocytosed yellow-green fluorescent latex beads detected using flow cytometry. Bars with the p-value indicate significant differences in phagocytic activity levels between stimulated cells and unstimulated control cells at a time point.

2.4. Quantitative real-time PCR (qRT-PCR) Extracted total RNA was used for cDNA synthesize via reverse transcription from 0.5 mg mRNA using ReverTra Ace® qPCR RT Master Mix with gDNA Remover (TOYOBO Co., LTD., Osaka, Japan). The primers of NLR (NOD-like Receptor) family genes, NLR-C1, NLRC2, NLR-C3, NLR-C4, NLR-C5, NLR-C6, NLR-C7, NLR-C8, NLR-C9, NLR-C10, NLR-C11, NLR-C12, NLR-C13, NOD2, NLRC3 and NLRX1 with 98e105% amplification efficiencies used in qRT-PCR are enlisted in Table 1. Four genes of these Fugu NLR family genes, NOD2, NLRC3 and NLRX1 are mammalian orthologs [10]. In addition, expression of inflammasome-associated genes, ASC and caspase-1, which are related to the function of activated NLR families [17e21], was also evaluated by qRT-PCR, and their oligonucleotide sequences are provided in Table 1. The qRT-PCR reaction was conducted using THUNDERBIRD™ SYBR® qPCR Mix (Toyobo Co., Ltd.) for each sample run in duplicate as per the protocol described earlier [22]. The comparative threshold cycle (CT) method (2
△△CT method) [23] was used to analyze the relative expression level of 16 NLR family genes with b-actin as an internal control gene.

3.2. Phagocytic activity Flow cytometry analysis revealed that phagocytic activity was not significantly elevated by the stimulation with particulate silica (10 and 50 mg mL
1) in the HK leukocytes, however, higher values were obtained with stimulation at 50 mg mL
1 during 6e36 hps (Fig. 2A). On the contrary, phagocytic activity was weakly increased in particulate silica (10 mg mL
1)-stimulated monocytes derived from HK cells at 6 hps only (Fig. 2B). Moreover, insignificantly higher level of phagocytic activity was noticed in monocytes at low level of silica stimulation (10 mg mL
1) during 6e36 hps. The monocyte population was around 16% in HK cells. 3.3. Expression of NLR family genes To understand induction of pro-inflammatory cytokine genes by particulate silica stimulation, expression of sensor genes that are involved in inflammasome in mammals [25,26] was clarified by qRT-PCR in HK cells of Fugu. The results of qPCR showed that NLR-C9 and NLR-C12 genes were significantly induced (P < 0.05) in HK cells stimulated by particulate silica at 36 hps (Fig. 3). NLR-C9 gene had an increased expression (P < 0.05) in particulate silica (10 mg mL
1) treatment only at 36 hps, while NLR-C12 gene was strongly elevated at 6 and 36 hps (Fig. 3). In contrast, NLR-C5, NLR-C6, NLR-C7, NLR-C8, NLRC10, NLR-C11, NLR-C13, NLRC3 and NOD2 genes tended to increase their expression at a low level in stimulated HK cells (Fig. 3).

88

T. Morimoto et al. / Fish & Shellfish Immunology 49 (2016) 84e90

Fig. 3. Expression (mean ± SD; n ¼ 3) of NLR family genes (NLR-C1, NLR-C2, NLR-C3, NLR-C4, NLR-C5, NLR-C6, NLR-C7, NLR-C8, NLR-C9, NLR-C10, NLR-C11, NLR-C12, NLR-C13, NOD2, NLRC3 and NLRX1) at different time points in the Fugu head kidney cells stimulated with particulate silica (10 mg mL
1). Bars with asterisks indicate significant differences in expression levels between stimulated cells and unstimulated control cells at a time point (*P < 0.05).

3.4. Expression of inflammasome-associated genes Currently, it is known that some particulates and DAMPs instigate and regulate the endoplasmic reticulum stress such as autophagy, which is mediated by the function of some NLR families [27]. Therefore, it is important to understand the immune responses mediated by NLR families in the particulates-stimulated cells. However, the immune response to stimulation with silica particulate in fish is still unknown. The results of qRT-PCR showed that ASC and caspase-1 genes were significantly induced (P < 0.05) in Fugu HK cells stimulated with particulate silica (10 and 50 mg mL
1) at 6 hps (Fig. 4A and B).

4. Discussion In this study, pro-inflammatory cytokine genes such as IL-1b, IL6, IL-17A/F3, IFN-g, TNF-a, and TNF-N were induced in the silicastimulated HK cells. In mammals, protein level of the proinflammatory cytokine, IL-1b increased in the lung and RAW264.7 macrophages stimulated with particulate silica [4]. The stimulation with silica particles also induces the differentiation of Th2 cells which express IL-4, IL-6 and IL-13 in mammals [5,28]. These

cytokine genes (i.e., IL-6 and IL-4/13) were also up-regulated in Fugu HK cells stimulated with silica (Fig. 1). However, inflammatory response in fish seems to be little different from that in mammals. For example, fish have several orthologs of IL-1b functioning in ways similar to those in mammals. Pro-inflammatory stimulations and microbial infections up-regulate IL-1b transcription in fish leukocytes, and recombinant IL-1b causes an acute-phase inflammatory response [29,30]. Although, caspase-1 dependent IL-1b processing occurs in fish [31,32] corresponding to that in mammalian species, an association of caspase-1 to inflammasome could not be confirmed [33]. Therefore, towards obtaining some insights into the inflammatory response in the Fugu, we conducted this stimulation experiment using particulate silica, which indirectly induces inflammasome and caspase-1 activation for the processing and release of IL-1b by causing an outflow of intracellular Kþ. In this study, the up-regulated cytokine genes and elevated cellular immune parameter in HK cells of Fugu in response to particulate silica stimulation indicated induction of inflammatory response. The mouse bone marrow macrophages exhibited immune responses involving pro-inflammatory cytokines with their biological activity by the stimulation of particulate silica, aluminum salt,

T. Morimoto et al. / Fish & Shellfish Immunology 49 (2016) 84e90

Fig. 4. Expression (mean ± SD; n ¼ 3) of inflammasome-associated genes A) ASC, B) caspase-1 in Fugu head kidney cells stimulated with particulate silica (10 and 50 mg mL
1). Bars with different asterisks indicate significant differences in expression levels between stimulated cells and unstimulated control cells at a time point (*0.01 < P < 0.05; **P < 0.01).

asbestos and particulate matter of environmental parameters [34]. In the present study, Fugu HK cells (containing renal hematopoietic cells) stimulated with particulate silica also showed a decent induction of innate immune responses. This is the first report on inflammatory cytokine-mediated immune response in Fugu to the particulate silica that is known as an inflammasome-inducing agent. Here, we have examined the pro-inflammatory effects of an inflammasome activating particulate in absence of priming stimulation in in vitro culture of the Fugu HK cells. In the process of inflammatory response after stimulation by different agents, HK as a vital immune competent organ expresses pro-inflammatory cytokines, IL-1b, IL-6, TNF-a and TNF-N. In this study, IL-1b, TNF-a and TNF-N genes were up-regulated in the HK cells treated with particulate silica. Here, a significantly elevated expression of IL-1b was observed in the HK cells at 24 hps. Particulate silica activates inflammasome that finally processes IL-1b maturation through involvement of caspase-1 and ASC [34]. Therefore, this higher transcription indicates a likely occurrence of NF-kB activation resulted from the stimulation with particulate silica. The result of particulate silica causing activation of helper T lymphocytes such as Th1 cells that participate in cell-mediated immunity and Th2 cells that have role in humoral immunity indicates elicitation of immune

89

response, although mammalian evidence has shown induction of only type 2 immune response (Th2-associated mechanism) stimulated by silica and alum [5]. Within an ischemic tissue there will be high levels of DAMPs that may serve to mediate local inflammatory responses. The inflammatory actions of DAMPs are most often reported as the ability to stimulate formation of the NLRP3inflammasome, thus activating caspase-1 and inducing the release of IL-1b [35]. However, in vitro silica particles are only reported to achieve this after the cell, typically a macrophage, has been primed with a PAMP [25,36]. As an indicator of inflammatory response, a cellular immune parameter was measured in Fugu HK cells stimulated with particulate silica. Phagocytosis initiates an early activation of the inflammatory response before antibody production, and is mediated by phagocytic cells such as neutrophils, monocytes and macrophages in fish [37]. Release of IL-1b is dependent on both phagocytosis and assembly of the NLRP3 inflammasome in chitosanstimulated murine macrophages [38]. Therefore, the elevated IL1b transcription in the stimulated cells may be a consequence of the increased phagocytosis. In addition, it facilitates phagocytosis by activating polymorphonuclear leukocytes and macrophages [38]. Some of the NLR genes discovered in mammals are partially conserved in other vertebrates including fish. Among NLRs, NLRP1, NLRP3, NLRC4, NLRP6 and NLRP12 are known to be inflammasome candidate proteins in mammals with NLRP3 (also called NALP3) is the most common and best-studied member [39]. NLRP in fish is an enigmatic. Although, fish possesses a pyrin domain (PYD) containing NLRs known as NLRCs, their function as inflammasome proteins has not yet been confirmed. Therefore, we could not find any such gene identified from Fugu. From this study, the results of qRT-PCR showed that NLR-C6, NLR-C9, NLR-C12 and NLR-C13 genes were significantly induced in HK cells stimulated with particulate silica at 36 hps. In addition, NLR-C12 was also significantly increased at 6 hps. In a previous study, Fugu NLR-C12 gene was dramatically induced by LPS and nigericin (which is a mammalian inflammasome inducer) in the HK cells [10]. In mammals, NLRP3 inflammasome is strongly activated by a cytosolic LPS. Moreover, the crystals of particulate silica and aluminum salt are able to induce production and secretion of matured IL-1b by activating NLRP3 inflammasome involving ASC and caspase-1 in monocytes and macrophages [25]. In silica-stimulated Fugu HK cells, inflammasome-associated ASC and caspase-1 genes were upregulated, suggesting probable activation of NF-kB pathway. Therefore, NLR-C12 may be considered as a candidate of sensor molecules that are components of an inflammasome in the inflammatory reaction triggered by particulate silica. Acknowledgments This research was supported by a Grant-in-Aid for Scientific Research (C) (No. 23580257) from the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan. GB thankfully acknowledges the receipt of a scholarship from the MEXT (Monbukagakusho), Japan during this study. References [1] D. Tang, R. Kang, C.B. Coyne, H.J. Zeh, M.T. Lotze, PAMPs and DAMPs: signal 0s that spur autophagy and immunity, Immunol. Rev. 249 (2012) 158e175. [2] B.T. Mossman, A. Churg, Mechanisms in the pathogenesis of asbestosis and silicosis, Am. J. Respir. Crit. Care Med. 157 (1998) 1666e1680. [3] C.D. Savage, G. Lopez-Castejon, A. Denes, D. Brough, NLRP3-inflammasome activating DAMPs stimulate an inflammatory response in glia in the absence of priming which contributes to brain inflammation after injury, Front. Immunol. 3 (2012) 288e299. [4] W.J. Sandberg, M. Låg, J.A. Holme, B. Friede, M. Gualtieri, M. Kruszewski, P.E. Schwarze, T. Skuland, M. Refsnes, Comparison of non-crystalline silica

90

[5]

[6] [7]

[8] [9]

[10]

[11]

[12] [13]

[14]

[15]

[16]

[17]

[18]

[19] [20] [21]

[22]

T. Morimoto et al. / Fish & Shellfish Immunology 49 (2016) 84e90 nanoparticles in IL-1b release from macrophages, Part Fibre Toxicol. 9 (2012) 32. E. Kuroda, J.K. Ishi, S. Uematsu, K. Ohata, C. Coban, S. Akira, K. Aritake, Y. Urade, Y. Morimoto, Silica crystals and aluminum salts regulate the production of prostaglandin in macrophages via NALP3 inflammasome-independent mechanisms, Immunity 34 (2011) 514e526. trilli, Asbestos triggers inflammation by activating the Nalp3 C. Dostert, V. Pe inflammasome, Med. Sci. Paris. 24 (2008) 916e918. S.C. Eisenbarth, O.R. Colegio, W. O'Connor, F.S. Sutterwala, R.A. Flavell, Crucial role for the Nalp3 inflammasome in the immunostimulatory properties of aluminium adjuvants, Nature 453 (2008) 1122e1126. K. Schroder, J. Tschopp, The inflammasomes, Cell 140 (2010) 821e832. K.J. Laing, M.K. Purcell, J.R. Winton, J.D. Hansen, A genomic view of the NODlike receptor family in teleost fish: identification of a novel NLR subfamily in zebrafish, BMC Evol. Biol. 8 (2008) 42. G. Biswas, S. Bilen, T. Kono, M. Sakai, J. Hikima, Inflammatory immune response by lipopolysaccharide-responsive nucleotide binding oligomerization domain (NOD)-like receptors in the Japanese pufferfish (Takifugu rubripes), Dev. Comp. Immunol. 55 (2016) 21e31. T. Wang, W. Huang, M.M. Costa, C.J. Secombes, The gamma-chain cytokine/ receptor system in fish: more ligands and receptors, Fish. Shellfish Immunol. 31 (2011) 673e687. R. Savan, M. Sakai, Genomics of fish cytokines, Comp. Biochem. Physiol. Part D. 1 (2006) 89e101. I.E. Mulder, A. Wadsworth, C.J. Secombes, Cytokine expression in the intestine of rainbow trout (Oncorhynchus mykiss) during infection with Aeromonas salmonicida, Fish. Shellfish Immunol. 23 (2007) 747e759. G. Biswas, H. Korenaga, R. Nagamine, H. Takayama, S. Kawahara, S. Takeda, Y. Kikuchi, B. Dashnyam, T. Yoshida, T. Kono, M. Sakai, Cytokine responses in the Japanese pufferfish (Takifugu rubripes) head kidney cells induced with heat-killed probiotics isolated from the Mongolian dairy product, Fish. Shellfish Immunol. 34 (2013) 1170e1177. T. Kono, H. Takayama, R. Nagamine, H. Korenaga, M. Sakai, Establishment of a multiplex RT-PCR assay for the rapid detection of fish cytokines, Vet. Immunol. Immunopathol. 151 (2013) 90e101. G. Biswas, H. Korenaga, R. Nagamine, S. Kawahara, S. Takeda, Y. Kikuchi, B. Dashnyam, T. Yoshida, T. Kono, M. Sakai, Cytokine mediated immune responses in the Japanese pufferfish (Takifugu rubripes) administered with Lactobacillus paracasei spp. paracasei (06TCa22) isolated from the Mongolian dairy product, Int. Immunopharmacol. 17 (2013) 358e365. M.S. Jabir, L. Hopkins, N.D. Ritchie, I. Ullah, H.K. Bayes, D. Li, P. Tourlomousis, A. Lupton, D. Puleston, A.K. Simon, C. Bryant, T.J. Evans, Mitochondrial damage contributes to Pseudomonas aeruginosa activation of the inflammasome and is downregulated by autophagy, Autophagy 11 (2015) 166e182. M.H. Cho, K. Cho, H.J. Kang, E.Y. Jeon, H.S. Kim, H.J. Kwon, H.M. Kim, D.H. Kim, S.Y. Yoon, Autophagy in microglia degrades extracellular b-amyloid fibrils and regulates the NLRP3 inflammasome, Autophagy 10 (2014) 1761e1775. L.A. Carneiro, L.H. Travassos, The Interplay between NLRs and Autophagy in Immunity and Inflammation, Front. Immunol. 4 (2013) 361. Y. Lei, H. Wen, J.P. Ting, The NLR protein, NLRX1, and its partner, TUFM, reduce type I interferon, and enhance autophagy, Autophagy 9 (2013) 432e433. R.G. Correa, S. Milutinovic, J.C. Reed, Roles of NOD1 (NLRC1) and NOD2 (NLRC2) in innate immunity and inflammatory diseases, Biosci. Rep. 32 (2012) 597e608. S. Kinoshita, G. Biswas, T. Kono, J. Hikima, M. Sakai, Presence of two tumor necrosis factor (tnf)-a homologs on different chromosomes of zebrafish (Danio rerio) and medaka (Oryzias latipes), Mar. Genomics 13 (2014) 1e9.

[23] T.D. Shmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative CT method, Nat. Protoc. 3 (2008) 1101e1108. [24] B. Soner, G. Biswas, S. Otsuyama, T. Kono, M. Sakai, J. Hikima, Inflammatory responses in the Japanese pufferfish (Takifugu rubripes) head kidney cells stimulated with an inflammasome-inducing agent, nigericin, Dev. Comp. Immunol. 46 (2014) 222e230. [25] V. Hornung, F. Bauernfeind, A. Halle, E.O. Samstad, H. Kono, K.L. Rock, K.A. Fitzgerald, E. Latz, Silica crystals and aluminum salts activate the NALP3 inflammasome through phagosomal destabilization, Nat. Immunol. 9 (2008) 847e856. [26] F. Bauernfeind, G. Horvath, A. Stutz, E.S. Alnemri, K. MacDonald, D. Speert, T. Fernandes-Alnemri, J. Wu, B.G. Monks, K.A. Fitzgerald, V. Hornung, E. Latz, NF-kB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression, J. Immunol. 183 (2009) 787e791. [27] A.D. Garg, S. Martin, J. Golab, P. Agostinis, Danger signalling during cancer cell death: origins, plasticity and regulation, Cell Death Differ. 21 (2014) 26e38. [28] W. Tang, F. Liu, Y. Chen, L. Song, W. Dai, C. Li, Reduction of IL-17A might suppress the Th1 response and Promote the Th2 response by boosting function of treg cells during silica-induced inflammatory response in vitro, Madiators Inflamm. 2014 (2014) 570894. [29] A.I. Koussounadis, D.W. Ritchie, G.J. Kemp, C.J. Secombes, Analysis of fish IL-1b and derived peptide sequences indicates conserved structures with speciesspecific IL-1 receptor binding: implications for pharmacological design, Curr. Pharmacol. 10 (2004) 3857e3871. [30] S.A. Martin, J. Zou, D.F. Houlihan, C.J. Secombes, Directional responses following recombinant cytokine stimulation of rainbow trout (Oncorhynchus mykiss) RTS-11 macrophage cells as revealed by transcriptome profiling, BMC Genomics 8 (2007) 150. [31] M.I.R. Reis, A. do Vale, P.J.B. Pereira, J.E. Azavedo, N.M.S. dos Santos, Caspase-1 and IL-1b processing in teleost fish, PLOS One 7 (2012) e50450. [32] L.N. Vojtech, N. Scharping, J.C. Woodson, J.D. Hansen, Roles of inflammatory caspases during processing of zebrafish IL-1b in Francisella noatunensis infection, Infect. Immun. 80 (2012) 2878e2885.  pez-Castego  n, A. Lo pez-Mun  oz, M.P. Sepulcre, M. Arizcum, [33] D. Angosto, G. Lo J. Meseguer, V. Mulero, Evolution of inflammasome and caspase-1 trigger fish macrophage cell death but are dispensable for processing of IL-1b, Innate Immun. 18 (2012) 815e824. [34] N. Riteau, L. Baron, B. Villeret, N. Guillou, F. Savigny, B. Ryffel, F. Rassendren, M. Le Bert, A. Gombault, I. Couillin, ATP release and purinergic signaling: a common pathway for particle-mediated inflammasome activation, Cell Death Dis. 3 (2012) e403. [35] H.W. Stout-Delgado, S.E. Vaughan, A.C. Shirali, R.J. Jaramillo, K.S. Harrod, Impaired NLRP3 inflammasome function in elderly mice during Influenza infection is rescued by treatment with nigericin, J. Immunol. 188 (2012) 2815e2824. [36] S.L. Cassel, F.S. Sutterwala, Sterile inflammatory responses mediated by the NLRP3 inflammasome, Eur. J. Immunol. 40 (2010) 607e611. s, J.L. Muzquiz, [37] J.L. Balc azar, I. de Blas, I. Ruiz-Zarzuela, D. Vendrell, O. Girone Enhancement of the immune response and protection induced by probiotic lactic acid bacteria against furunculosis in rainbow trout (Oncorhynchus mykiss), FEMS Immunol. Med. Microbiol. 51 (2007) 185e193. [38] C.L. Bueter, C.K. Lee, V.A.K. Rathinam, G.J. Healy, C.H. Taron, C.A. Specht, S.M. Levitz, Chitosan but not chitin activates the inflammasome by a mechanism dependent upon phagocytosis, J. Biol. Chem. 286 (2011) 35447e35455. [39] V.A.K. Rathinam, S.K. Vanaja, K.A. Fitzgerald, Regulation of inflammasome signaling, Nat. Immunol. 13 (2012) 333e342.