- Email: [email protected]
Immune roles of amphibian (Xenopus laevis) tadpole granulocytes during Frog Virus 3 ranavirus infections
Developmental and Comparative Immunology 72 (2017) 112e118
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci
Immune roles of amphibian (Xenopus laevis) tadpole granulocytes during Frog Virus 3 ranavirus infections Daphne V. Koubourli, Emily S. Wendel, Amulya Yaparla, Jonathan R. Ghaul, Leon Grayfer* Department of Biological Sciences, George Washington University, Washington, DC, USA
a r t i c l e i n f o
a b s t r a c t
Article history: Received 6 February 2017 Received in revised form 21 February 2017 Accepted 21 February 2017 Available online 24 February 2017
Infections by Frog Virus 3 (FV3) and other ranaviruses (RVs) are contributing to the amphibian declines, while the mechanisms controlling anuran tadpole susceptibility and adult frog resistance to RVs, including the roles of polymorphonuclear granulocytes (PMNs) during anti-FV3 responses, remain largely unknown. Since amphibian kidneys represent an important FV3 target, the inability of amphibian (Xenopus laevis) tadpoles to mount effective kidney inflammatory responses to FV3 is thought to contribute to their susceptibility. Here we demonstrate that a recombinant X. laevis granulocyte colonystimulating factor (G-CSF) generates PMNs with hallmark granulocyte morphology. Tadpole pretreatment with G-CSF prior to FV3 infection reduces animal kidney FV3 loads and extends their survival. Moreover, G-CSF-derived PMNs are resistant to FV3 infection and express high levels of TNFa in response to this virus. Notably, FV3-infected tadpoles fail to recruit G-CSFR expressing granulocytes into their kidneys, suggesting that they lack an integral inflammatory effector population at this site. © 2017 Elsevier Ltd. All rights reserved.
Keywords: Ranavirus Granulocyte Amphibian Proinflammatory G-CSF CSF-3 Frog virus 3 FV3
1. Introduction Infections by Frog Virus 3 (FV3) and other members of the ranavirus genus (family Iridoviridae) are significantly contributing to the worldwide amphibian declines (Chinchar, 2002; Chinchar et al., 2009; Williams et al., 2005). Notably, anuran amphibian tadpoles are substantially more susceptible to, and are more adversely affected by ranavirus infections, as compared to adult frogs (Bayley et al., 2013; Grayfer et al., 2014a; Hoverman et al., 2010; Landsberg et al., 2013; Reeve et al., 2013). Despite this, the differences between the anuran tadpole and adult frog immune responses that culminate in their respective susceptibility and
Abbreviation: APBS, amphibian phosphate buffered saline; CMP, common myeloid progenitor; dpi, days post infection; FV3, Frog Virus 3; GAPDH, Glyceraldehyde 3 phosphate dehydrogenase; G-CSF, granulocyte colony-stimulating factor; G-CSFR, granulocyte colony-stimulating factor receptor; hpi, hours post infection; IL, 1b-interleukin-1 beta; IFN, interferon; IFNg, interferon gamma; ip, intraperitoneal; M-CSF, macrophage colony-stimulating factor; MDA5, Melanoma Differentiation-Associated protein 5; Mf, macrophage; PMN, polymorphonuclear granulocyte; poly (I:C), polyinosinic:polycytidylic acid; qRT-PCR, quantitative reverse transcriptase polymerase chain reaction; RV, ranavirus; TNFa, tumor necrosis factor-alpha; vDNA Pol, viral DNA polymerase. * Corresponding author. E-mail address: [email protected] (L. Grayfer). http://dx.doi.org/10.1016/j.dci.2017.02.016 0145-305X/© 2017 Elsevier Ltd. All rights reserved.
resistance to FV3 remain to be adequately determined. Anuran tadpole and adult frog kidneys are thought to be important FV3 replication sites (Morales et al., 2010). Thus, the inability of tadpoles to adequately upregulate their kidney gene expression of inflammatory cytokines such as tumor necrosis factor-alpha (TNFa) in responses to FV3 infection, has been proposed as an important determinant of their susceptibility to this pathogen (Andino et al., 2012). During certain viral infections, mammalian polymorphonuclear granulocytes (PMNs) play important roles in the clearance of virally infected cells and the production of inflammatory and antiviral cytokines (Fujisawa et al., 1987; Sweet and Smith, 1980; Tate et al., 2008, 2009; Tumpey et al., 1996). Since X. laevis possess both FV3susceptible and FV3-resistant macrophage (Mf) populations (Grayfer and Robert, 2014; 2015), it is notable that Mfs and PMNs arise from a common myeloid precursor (Buza-Vidas et al., 2007) and share many immunological facets (Shepherd, 1986). Moreover, although X. laevis PMNs are recruited to the sites of FV3 infection (Edholm et al., 2015), their immune roles during these infections remain unknown. The mammalian granulocyte colony-stimulating factor (G-CSF) is indispensible to granulocyte lineage commitment, proliferation, differentiation and functional maturations (Metcalf, 2008) to the
D.V. Koubourli et al. / Developmental and Comparative Immunology 72 (2017) 112e118
point where defects in G-CSF receptor (G-CSFR) signaling manifest in severe congenital neutropenia (Skokowa and Welte, 2013). Pertinently, we have recently identified the X. laevis G-CSF and have demonstrated the importance of this frog cytokine to amphibian granulopoiesis (Yaparla et al., 2016). Accordingly, in the present manuscript we addressed the possible antiviral roles of G-CSFderived tadpole PMNs, examining their morphology, FV3-elicited gene expression and the capacity of these innate immune effectors to protect animals during FV3 challenge.
2. Materials and methods 2.1. Animals Outbred tadpole and adult Xenopus laevis were purchased from the Xenopus 1 facility, housed and handled under strict laboratory and IACUC regulations (Approval number 15-024).
2.2. Cell culture media and conditions All cell cultures were established using Iscove's Modified Dulbecco's Medium supplemented with 10% fetal bovine serum, 0.25% X. laevis serum, insulin (Sigma), non-essential amino acids (Sigma), primatone (2.5%). This medium contained 10 mg/mL Gentamycin (Thermo Fisher Scientific) and 100 U/mL penicillin/100 mg/mL streptomycin (Gibco), was buffered with sodium bicarbonate, pH 7.7 and diluted to 1 in 5 parts with water to amphibian osmolarity. All leukocyte cultures were grown at 27 C with 0.5% CO2. Amphibian phosphate buffered saline (APBS) consisted of 100 mM sodium chloride, 8 mM sodium phosphate, 1.5 mM potassium phosphate; pH 7.7.
113
2.4. Production of the recombinant X. laevis G-CSF and M-CSF The production of recombinant X. laevis G-CSF and M-CSF has been previously described (Yaparla et al., 2016). Briefly, the G-CSF and M-CSF sequences representing the signal peptide-cleaved transcripts were PCR-amplified, ligated into the pMIB/V5 His A insect expression vectors (Invitrogen) and introduced into Sf9 insect cells (cellfectin II, Invitrogen). Presence of recombinant proteins in the transfected Sf9 supernatants was confirmed by western blot and the positive transfectants were selected using 10 mg/mL blasticidin. The protein expression cultures were then scaled up as 500 mL liquid cultures, grown for 5 days, pelleted and the supernatants collected. These were dialyzed overnight at 4 C against 150 mM sodium phosphate, concentrated against polyethylene glycol flakes (8 kDa) at 4 C, dialyzed overnight at 4 C against 150 mM sodium phosphate and passed through Ni-NTA agarose columns (Qiagen). Columns were washed with 2 10 vol of high stringency wash buffer (0.5% Tween 20; 50 mM Sodium Phosphate; 500 mM Sodium Chloride; 100 mM Imidazole) and 5 10 vol of low stringency wash buffer (as above, but with 40 mM Imidazole). Recombinant cytokines were eluted using 250 mM imidazole. The presence of recombinant cytokines in the fractions was confirmed by western blot against the V5 epitopes on the proteins (Suppl. Fig. 1A). Protein concentrations were determined by Bradford protein assays (BioRad). Halt protease inhibitor cocktail (containing AEBSF, aprotinin, bestatin, E-64, leupeptin and pepstatin A; Thermo Scientific) was added to the purified proteins, which were then stored at 20 C in aliquots until use. The vector control (denoted as ‘control’ throughout) was generated by transfecting Sf9 cells with the empty pMIB/V5 His A expression vector (Invitrogen) and the supernatants derived from the transfected cells processed in parallel to recombinant cytokine production (Suppl. Fig. 1A), including the addition of the protease inhibitor.
2.3. FV3 stocks, animal and cell infections FV3 production has been described previously (Morales et al., 2010). Briefly, baby hamster kidney (BHK-21) cells were inoculated with FV3 (multiplicity of infection; MOI: 0.1), grown at 5% CO2 and 30 C for 5 days or until the cells were completely lysed. The FV3-containing supernatants were pre-cleared by ultracentrifugation, collected over 30% sucrose and re-suspended in APBS. Viral titers were determined using plaque assay analysis over BHK21 cells. For all studies, tadpoles (N ¼ 5) and adult frogs (N ¼ 4) were virally infected by intraperitoneal (ip) injection with 104 and 5 106 PFU of FV3, respectively. Control animals were mock infected by ip injections with saline (not containing FV3). Animals were euthanized by tricaine mesylate overdose (tadpoles: 1%; adult frogs: 5%), kidney tissues excised, immediately flash-frozen in Trizol reagent (Invitrogen) over dry ice and stored at 20 C until RNA isolation. For all in vitro infection studies, 104 control leukocytes (N ¼ 4 tadpoles), G-CSF-elicited PMNS (N ¼ 5 tadpoles) or M-CSF-elicited Mfs (N ¼ 4 tadpoles), derived from tadpole peritonea were infected with an MOI of 0.5 for 2 or 24 h, incubated in the medium described above at 27 C with 0.5% CO2. Subsequently, the cells were trypsinized to remove attached but not internalized virus and washed with APBS. The cellular FV3 viral loads were determined by subjecting the washed cells to 3 rounds of sequential freeze-thaw lysis and intermittent repeated passages through 24-gage needles. The resulting homogenates were examined by plaque assays on BHK monolayers under an overlay of 1% methylcellulose, as previously described (Morales et al., 2010).
2.5. Tadpole injections with recombinant cytokines, cell isolation and cytology Tadpoles (stage NF 54) were injected once ip with 1 mg total of either M-CSF (N ¼ 4 tadpoles), G-CSF (N ¼ 5 tadpoles), or equal volumes of the control (N ¼ 4 tadpoles) in APBS (10 mL final volume) using finely pulled glass needles. After 1, 3 and 5 days following the injections, peritoneal leukocytes were lavaged with APBS using finely pulled glass needles. For expression experiments, M-CSFelicited Mfs (N ¼ 4 tadpoles), G-CSF-elicited PMNs (N ¼ 5 tadpoles), and control peritoneal leukocytes (N ¼ 4 tadpoles) were isolated from tadpoles after 1 day of injection with the respective stimuli. Peritoneal leukocytes were enumerated via a hemocytometer and using trypan blue (Sigma) exclusion. In separate experiments, control peritoneal leukocytes and GCSF-elicited PMNs were cyto-spun (Shandon Southern), Giemsastained and images derived using a Nikon Eclipse Ni-U microscope and Canon EOS Rebel T3i digital camera. All cytological analyses are representative of three independent experiments.
2.6. Tadpole survival study Tadpoles (N ¼ 12 tadpoles per treatment group) were injected ip with 1 mg/animal of G-CSF or equal volume of the control in APBS (10 mL final volume) using finely pulled glass needles. The following day, animals were infected by ip injections with 104 PFU of FV3 and survival monitored thereafter, twice daily.
114
D.V. Koubourli et al. / Developmental and Comparative Immunology 72 (2017) 112e118
Fig. 1. Intraperitoneal injection of X. laevis tadpoles with G-CSF results in accumulation of leukocytes bearing hallmark granulocyte morphology. Tadpoles were injected with G-CSF (1 mg/animal) or equal volumes of the control and lavaged with saline after 1, 3 and 5 days of injection. (A) cells were enumerated and (B) cytologically examined. Results in (A) are means þ SEM; (N ¼ 5). Significant differences between G-CSF- and control-injected tadpole leukocyte numbers derived at respective times after injection are denoted by the derived P values over bars indicating the treatment groups being compared, P < 0.05. Scale bars in (B) are 5 mm.
2.7. Isolation of RNA and DNA from tadpole cells and kidney tissues For all experiments, tadpole and adult cells or kidney tissues from FV3-infected animals were homogenized by passage through progressively higher gage needles in Trizol reagent (Invitrogen), flash frozen on dry ice and stored at 80 C until RNA and DNA isolation. RNA isolation was performed using Trizol (Invitrogen) and according to manufacturer's directions. DNA was isolated from the Trizol following RNA isolation. In brief, following phase separation and extraction of RNA, the remaining Trizol layer was mixed with back extraction buffer (4 M guanidine thiocyanate, 50 mM sodium citrate, 1 M Tris pH 8.0), centrifuged to isolate the DNA containing aqueous phase. The DNA was precipitated overnight with isopropanol, pelleted by centrifugation, washed with 70% ethanol and resuspended in TE (10 mM Tris pH 8.0, 1 mM EDTA) buffer. DNA was then purified by phenol: chloroform extraction and resuspended in molecular grade water.
TGGATGAAGGACTACAGCTAATG; reverse: GCCTGTCATCTGTGAGGTTTA) was performed using the delta^delta CT method, with expression examined relative to the GAPDH (FWD: ACCCCTTCATCGACTTGGAC; reverse: AGATGGAGGAGTGAGTGTCACCAT) endogenous control and normalized against the lowest observed expression. FV3 viral loads were determined by absolute qPCR and performed using 50 ng of total isolated DNA and compared against a serially diluted standard curve. In briefly, a pGEM-T plasmid bearing an FV3 vDNA Pol (ORF 60R) fragment was serially diluted into 101-108 vDNA Pol fragment-containing copies. These were used as the standard curve in subsequent absolute qPCR assays. The sequences of the primers used are: forward: CAAGAACGTGTGCTACTCCA; reverse: AGCCTCTCGTACTCTACCTTC. All experiments were performed using the CFX96 Real-Time System and iTaq Universal SYBR Green Supermix. The BioRad CFX Manager software (SDS) was employed for all expression analysis. All primers were validated prior to use.
2.8. Quantitative analysis of gene expression and FV3 copy number Quantitative analysis of X. laevis gene expression and FV3 viral copy number has been described (Grayfer et al., 2014b; Grayfer and Robert, 2013, 2014). Briefly, Total RNA and DNA were extracted from frog cells or kidney tissues using the Trizol reagent and following the manufacturer's directions (Invitrogen). All cDNA syntheses were performed using iScript cDNA synthesis kits in accordance to manufacturers' directions (Bio-Rad, Hercules, CA) and using 500 ng of total RNA. Quantitative (q) RT-PCR analysis was performed using 2.5 ml of the derived cDNA templates. Expression analysis of TNFa (forward: TGTCAGGCAGGAAAGAAGCA; reverse: CAGCAGAGCAAAGAGGATGGT), IL-1b (forward: CATTCCCATGGAGGGCTACA; reverse: TGACTGCCACTGAGCAGCAT) and G-CSFR (forward:
2.9. Statistical analysis Statistical analysis was performed using a one-way analysis of variance (ANOVA) and post hoc t-test, using Vassar Stat (http:// faculty.vassar.edu/lowry//anova1u.html) and Graph Pad (https:// www.graphpad.com/quickcalcs/ttest1.cfm) statistical programs, respectively. Probability level of P < 0.05 was considered significant. Statistical analysis of the tadpole survival data was performed using a Log-rank test (GraphPad Prism 6), comparing G-CSFinjected to control-injected tadpole survival curves. Probability level of P < 0.05 was considered significant.
D.V. Koubourli et al. / Developmental and Comparative Immunology 72 (2017) 112e118
3. Results 3.1. Recruitment and cytology of G-CSF-elicited tadpole PMNs To examine the roles of PMNs during FV3 responses in the highly FV3-susceptible X. laevis tadpoles, we produced the principal granulocyte growth and differentiation factor, granulocyte colonystimulating factor (G-CSF) in recombinant form (Suppl. Fig. 1A). Since the mammalian G-CSF is known to be chemotactic to granulocytes and their precursor cells (Bendall and Bradstock, 2014), we thus injected tadpoles intraperitoneally (ip) with the recombinant X. laevis G-CSF in order to recruit and differentiate tadpole granulocyte precursors within this site (Fig. 1). Tadpoles were alternatively injected with a control (supernatants from empty expression vector-transfected insect cells, processed in parallel to G-CSF isolation) and animals were ip lavaged at 1, 3 and 5 days post injection to enumerate and cytologically assess the resulting cells (Fig. 1). After 1 day of injection, G-CSF-administered tadpoles possessed 17 fold greater peritoneal leukocyte numbers than control animals (Fig. 1A). After 3 days of injection, G-CSF-treated tadpoles possessed 28 fold greater leukocyte numbers than respective controls, which were returned to 2 fold over control numbers (not significant) by 5 days after cytokine administration (Fig. 1A). In comparison to the leukocytes isolated from control-injected animals, G-CSF-elicited tadpole leukocytes were much larger and exhibited characteristic granulocyte morphology including multilobed nuclei and membrane ruffling (Fig. 1B, Suppl. Fig. 1BeD). Roughly 90e95% of the leukocytes isolated from G-CSF-administered tadpoles, exhibited this characteristic PMN morphology (Suppl. Fig. 1BeD).
115
monitored animal survival (Fig. 2). Interestingly, tadpoles injected with G-CSF prior to FV3 challenge survived substantially longer during the first 7 days of FV3 infection (Fig. 2). However, following the initial week of FV3 challenge, G-CSF-administered, FV3infected tadpole survival decreased to the levels observed in the control animals (Fig. 2). 3.3. G-CSF administration decreases tadpole kidney FV3 loads Since G-CSF administration extended FV3-infected tadpole survival (Fig. 2) while the anuran amphibian kidney appears to be a principal site of FV3 replication (Morales et al., 2010), we next
3.2. G-CSF administration extends FV3-infected tadpole survival To examine the bearing of expanding tadpole G-CSF PMNs on their survival following FV3 challenge, we injected tadpoles ip with G-CSF (1 mg/animal) or equal volumes of the control, the following day infected them ip with FV3 (104 PFU/animal) and then
Fig. 2. Intraperitoneal injection of X. laevis tadpoles with G-CSF extends their survival following FV3 infection. Tadpoles were injected with G-CSF (1 mg/animal) or equal volumes of the control and 24 h later infected with FV3 (104 PFU/animal). Animal survival was monitored twice daily. The G-CSF- and control-injected tadpole survival curves were significantly different, N ¼ 12 tadpoles/treatment group, P ¼ 0.0216.
Fig. 3. (A) G-CSF reduces FV3-infeted tadpole kidney viral loads and (B) G-CSF PMNs are less susceptible to viral entry but permit greater FV3 replication compared to MCSF Mfs. (A) Tadpoles were injected with G-CSF (1 mg/animal) or equal volumes of the control and 24 h later infected with FV3 (104 PFU/animal). Tadpole kidneys were excised at 1, 3 and 5 dpi, DNA isolated and the amount of FV3 genome copies per 50 ng total isolated DNA examined by absolute qPCR using an FV3 standard curve. (B) Tadpole peritoneal M-CSF-derived Mfs (N ¼ 4 tadpoles), G-CSF-elicited PMNs (N ¼ 5 tadpoles) and control leukocytes (N ¼ 4 tadpoles) were infected with FV3 (MOI: 0.5) for 2 and 24 h, cells harvested and examined by plaque assay analysis for infectious FV3 loads. Results are means þ SEM. In (A) significant differences from control treated animals at 1 dpi are denoted by respective overhead P values and significant differences between treatment groups are indicated by the corresponding P values above bars indicating the treatments being compared. In (B), significant differences from control leukocytes are denoted by the corresponding overhead P values and significant differences between treatment groups are indicated by the corresponding P values above bars indicating the treatments being compared P < 0.05.
116
D.V. Koubourli et al. / Developmental and Comparative Immunology 72 (2017) 112e118
examined FV3 loads in G-CSF- or control-injected, FV3 infected tadpoles (Fig. 3A) by absolute qPCR. After 1-day post infection (dpi), G-CSF treated tadpoles possessed modestly, but not significantly greater FV3 DNA copies than those detected in the kidneys of control animals (Fig. 3A). After 3 dpi, control and G-CSF treated tadpoles exhibited similar FV3 genomic copies (Fig. 3A). Notably, whereas the control tadpole kidney FV3 loads increased further by 5 dpi, the G-CSF-injected tadpole kidney FV3 loads did not increase further from the levels seen at 3 dpi and were significantly lower (two-fold) than those detected in the control animals on that dpi (Fig. 3A). 3.4. Tadpole G-CSF-elicited PMNs are less susceptible to FV3 entry but are more amicable to viral replication than M-CSF-deride Mfs We previously reported that tadpole peritoneal macrophages (Mfs) elicited with the macrophage colony-stimulating factor (MCSF) Mf growth factor are very susceptible to FV3 (Grayfer and Robert, 2014). To compare the susceptibility/resistance of tadpole G-CSF PMNs to the M-CSF-derived Mfs, we injecting tadpoles ip with recombinant G-CSF, M-CSF or the control, the following day isolated G-CSF PMNs, M-CSF Mfs and control leukocytes (respectively) by peritoneal lavage and infected them in vitro with FV3 (MOI: 0.5). Infected cells were harvested at 2 and 24 h (h)pi and assessed by plaque assay analysis (Fig. 3B). Since the average FV3 replication cycle is approximately 9 h (Majji et al., 2009), plaque assay analysis of cells after 2 hpi would indicate the amount of infiltrating virus, whereas cells examined after 24 hpi would reveal the extent of FV3 replication. Notably, at 2 hpi M-CSF Mfs possessed approximately 15 fold greater FV3 loads than the control leukocytes or the G-CSF-derived PMNs (Fig. 3B), suggesting that the G-CSF PMNs are much less susceptible to viral entry than the M-CSF Mfs. In keeping with our previous observations (Grayfer and Robert, 2014), after 24 hpi the invading FV3 had not undergone significant replication within the M-CSF Mfs (Fig. 3B). By contrast, after 24 hpi the G-CSF-derived PMNs possessed significantly increased (4 fold) FV3 loads compared to 2 hpi (and 5 fold greater than control leukocytes; Fig. 3B), suggesting that these cells may be more supportive to FV3 replication than the M-CSF Mfs. 3.5. Tadpole G-CSF-derived PMNs express high levels of TNFa in response to FV3 The amphibian (X. laevis) tadpole inability to deal with FV3 infections has been explained in part by their inadequate inflammatory responses to these viral infections, including very modest and delayed expression of hallmark inflammatory cytokines such as interleukin-1 beta (IL-1b) and tumor necrosis factor-alpha (TNFa) (Andino et al., 2012). Since myeloid cells represent important sources of these soluble mediators (Dinarello, 2011; Spriggs et al., 1992), we next examined the expression of IL-1b and TNFa in MCSF Mfs and G-CSF PMNs that had been challenged in vitro with FV3 (MOI: 0.5; Fig. 4A&B). G-CSF PMNs, M-CSF Mfs and control leukocytes possessed similar IL-1b mRNA levels that were not significantly altered by FV3 challenge (Fig. 4A). While all three examined cell populations upregulated their TNFa transcript levels following FV3 stimulation, the virally challenged G-CSF PMNs exhibited 2.5e3 fold greater TNFa mRNA levels than detected in the FV3-stimulated M-CSF Mfs or control leukocytes, respectively (Fig. 4B). 3.6. FV3-infected tadpoles fail to recruit PMNs to their kidneys; a key site of viral replication Our results indicate that tadpole G-CSF PMNs represent an
important source of inflammatory cytokines (Fig. 4A&B) while FV3infected tadpole susceptibility is thought to arise (in part) from their inability to elicit appropriate inflammatory cytokine gene expression within their kidneys (Andino et al., 2012). Accordingly, we hypothesized that the tadpole inability to upregulate their kidney inflammatory cytokine expression reflects their lack of adequate granulocyte recruitment to this tissue during FV3 infections. To test this notion, we next compared the kidneys of FV3infected X. laevis tadpoles and adult frogs for possible granulocyte infiltration by examining the gene expression of a hallmark granulocyte marker, the G-CSF receptor (G-CSFR) within this tissue (Fig. 4C). After 3 dpi, the gene expression of the adult frog kidney GCSFR was increased over 5-fold compared to mock-infected controls (Fig. 4C), suggesting that adult frogs were recruiting granulocytes to this important site of infection and possibly explaining the previously observed increases in FV3-infected adult frog kidney TNFa and IL-1b expression (Andino et al., 2012). By stark contrast, after 3 dpi the FV3-challenged tadpole kidney G-CSFR levels were significantly reduced (5-fold reduction; Fig. 4C), suggesting a decrease in kidney granulocyte numbers. This supports our hypothesis that the inadequate tadpole kidney inflammatory responses to FV3 may be explained by the absence of important inflammatory cytokine-producing granulocyte population(s) within this tissue. 4. Discussion In consideration of the escalating amphibian declines (Chinchar, 2002; Chinchar et al., 2009; Williams et al., 2005), it is imperative that we gain insights into the successes and pitfalls of amphibian immune responses to emerging etiological pathogens such as FV3. As anuran tadpoles are substantially more susceptible to FV3 than the adult frogs (Bayley et al., 2013; Grayfer et al., 2014a; Hoverman et al., 2010; Landsberg et al., 2013; Reeve et al., 2013), defining the successes and pitfalls of tadpole anti-FV3 responses will lend to understanding the causes of their susceptibility to this pathogen. In this respect, it is notable that X. laevis tadpoles fail to adequately mount kidney inflammatory responses to FV3 (Andino et al., 2012) while our present findings indicate that this may, at least in part be due to inadequate PMN recruitment to this site. While PMNs are generally known for their antimicrobial and antifungal capacities (Gazendam et al., 2016; Havixbeck and Barreda, 2015), these cells have also been implicated as antiviral effectors (Fujisawa et al., 1987; Sweet and Smith, 1980; Tate et al., 2008, 2009; Tumpey et al., 1996) and their depletion compounds the severity of viral infections (Fujisawa et al., 1987; Tate et al., 2008; Tumpey et al., 1996). Notably, our findings suggest that the X. laevis tadpole G-CSF-derived granulocytes are important cellular effectors during FV3 responses. For example, the enrichment of tadpole PMNs with recombinant G-CSF extends tadpole survival and lowers animal kidney FV3 loads. Moreover, G-CSF-differentiated PMNs may represent important producers of inflammatory cytokines such as TNFa during FV3 infections, and thus are integral to anti-FV3 inflammatory responses. Since the inability of tadpoles to mount adequate kidney inflammatory responses to FV3 is thought to contribute to their susceptibility (Andino et al., 2012), it is thus compelling that although FV3 elicits robust upregulation of TNFa in tadpole G-CSF-derived PMNs, G-CSFR-expressing PMNs fail to infiltrate FV3-infected tadpole kidneys. By contrast, FV3challenged adult frogs markedly increase their kidney TNFa gene expression (Andino et al., 2012) while our results also indicate a significant G-CSFR expression and hence granulocyte infiltration of infected adult kidneys. Presumably, the inability of FV3-infected tadpoles to upregulate their kidney expression of inflammatory cytokines like TNFa may be at least in part attributed to the lack of
D.V. Koubourli et al. / Developmental and Comparative Immunology 72 (2017) 112e118
117
tadpole granulocyte infiltration of this site. By the same argument, we propose that the successful adult frog kidney inflammatory responses reflect adequate infiltration and activation of granulocytes within this tissue. Treatment of mammalian granulocytes with poly (I:C) readily initiates their expression of inflammatory and antiviral genes (Tamassia et al., 2008). These responses are thought to involve MDA5 activation and result in robust production of antiviral interferons (IFNs) and TNFa (Tamassia et al., 2008). While our expression analysis indicated that FV3-challenged G-CSF PMNs do not upregulate type I or type III IFN gene expression (data not shown), our results do support the notion that virally induced granulocyte TNFa may be important to anti-FV3 immunity. Future research, focusing on the specific antiviral roles of PMN-expressed inflammatory mediators such as TNFa will help to define the mechanisms by which these cells confer their anti-FV3 responses. FV3-infected adult frogs rapidly and robustly upregulated their kidney IFNg mRNA levels after 1 day of infection, while tadpoles exhibited significantly delayed and meager kidney IFNg responses to FV3 (Andino et al., 2012). Our results indicate that FV3challenged, G-CSF-derived PMNs do not upregulated their IFNg gene expression (data not shown), indicating that the adult frogs possess other infiltrating immune cells or resident cell populations responsible for this cytokine response. It should be noted that although G-CSF-derived PMNs were significantly less susceptible to FV3 entry than M-CSF Mfs, they were also more amiable to FV3 replication. While the majority of our data suggests that X. laevis granulocytes serve antiviral roles during FV3 infections, it is possible that they may, at some point in the infection become the means of FV3 dissemination. The G-CSFconferred extension of FV3-infected tadpole survival lasted for the first week of infection and was followed by a swift decline in tadpole survival to levels comparable to, or lower than control animals. Possibly, the extended tadpole survival reflects the protective antiviral properties of the PMNs expanded by G-CSF while the drastic decline in animal survival later on in the infection may be due to viral accumulation and dissemination within this expanded population of cells. Indeed, several studies have described that antiviral granulocyte effectors also possessed intracellular, presumably propagating viruses (Gerna, 2012; Levine et al., 2015; Orenstein, 2000). Possibly, the dual nature of granulocytes as both antiviral effectors and vectors for viral dissemination is shared across vertebrate species. Alternatively, the decline in G-CSF-injected, FV3-infected tadpole survival may be due to the loss of the protective effects conferred by the cytokine injection. Notably, after 5 days of ip G-CSF injection, we did not observe significant accumulation of peritoneal granulocytes, suggesting that the effects of this cytokine administration may be short-lived. The above notions will be elucidated by future studies, examining the roles of X. laevis PMNs in FV3 dissemination to different tissues and at distinct times during infection. Together, our past and present studies indicate that the success of the anuran anti-FV3 response hinges on the appropriate differentiation, accumulation and activation of specific innate immune cell subsets. Our past work has defined the roles of differentially
Fig. 4. Analysis of (A) IL-1b and (B) TNFa gene expression in FV3-challenged tadpole GCSF PMNs, and (C) G-CSFR gene expression in the kidneys of FV3-infected tadpoles and adult frogs. Tadpole peritoneal M-CSF Mfs (N ¼ 4 tadpoles), G-CSF PMNs (N ¼ 5 tadpoles), and control leukocyes (N ¼ 4 tadpoles) were challenged with FV3 (MOI: 0.5) for 2 and 24 h and the gene expression of (A) IL-1b and (B) TNFa examined by qRT-PCR.
(C) Tadpoles and adult frogs were inoculated with FV3 ip (104 and 5 106 PFU/animal, respectively) or mock-infected by saline injections. Animal kidneys were excised after 3 dpi and examined for G-CSFR gene expression by qRT-PCR. All results are means þ SEM. In (A&B), significant differences from control leukocytes are denoted by corresponding overhead P values and significant differences between treatment groups are indicated by the corresponding P values above bars indicating the treatments being compared P < 0.05. In (C), significant differences between treatment groups are indicated by the corresponding P values above bars indicating the treatments being compared P < 0.05.
118
D.V. Koubourli et al. / Developmental and Comparative Immunology 72 (2017) 112e118
polarized Mf populations in the ability of X. laevis to mount effective antiviral responses (Grayfer and Robert, 2014, 2015), while presently we demonstrate that the X. laevis G-CSF-differentiated granulocytes may likewise skew the balance between FV3 susceptibility and resistance. As we move forward, it will be invaluable to define the immune interactions between these respective myeloid populations and how the sequential recruitment of these cells to the sites of FV3 replication may impact viral infection outcomes. In spite of the dire need to gather new insights into the facets governing amphibian susceptibility and resistance to pathogens such as FV3, research into these processes have been hampered by lack of available reagents and resources with which to explore the antiviral immune responses of these intriguing organisms. As more advanced molecular techniques, technology, and reagents are becoming more readily available, the time is ripe to exploit all possible resources by which to get a clearer window into the antiviral roles of amphibian immune effectors such as granulocytes and the mechanisms by which they may be conferring animal susceptibility or resistance to emerging pathogens such as Frog Virus 3. Acknowledgements E.S.W. thanks the GWU Harlan Research Program. A.Y. thanks the GWU, Dept. Biological Sciences for GTA support and support from the GWU Harlan Research Program. L.G. thanks the GWU, Dept. Biological Sciences for research support at the early investigator stage. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.dci.2017.02.016. References Andino, F.D.J., Chen, G., Li, Z., Grayfer, L., Robert, J., 2012. Susceptibility of Xenopus laevis tadpoles to infection by the ranavirus Frog-Virus 3 correlates with a reduced and delayed innate immune response in comparison with adult frogs. Virol 432, 435e443. Bayley, A.E., Hill, B.J., Feist, S.W., 2013. Susceptibility of the European common frog Rana temporaria to a panel of ranavirus isolates from fish and amphibian hosts. Dis. Aquat. Organ 103, 171e183. Bendall, L.J., Bradstock, K.F., 2014. G-CSF: from granulopoietic stimulant to bone marrow stem cell mobilizing agent. Cytokine Growth Factor Rev. 25, 355e367. Buza-Vidas, N., Luc, S., Jacobsen, S.E., 2007. Delineation of the earliest lineage commitment steps of haematopoietic stem cells: new developments, controversies and major challenges. Curr. Opin. Hematol. 14, 315e321. Chinchar, V.G., 2002. Ranaviruses (family Iridoviridae): emerging cold-blooded killers. Arch. Virol. 147, 447e470. Chinchar, V.G., Hyatt, A., Miyazaki, T., Williams, T., 2009. Family Iridoviridae: poor viral relations no longer. Curr. Top. Microbiol. Immunol. 328, 123e170. Dinarello, C.A., 2011. A clinical perspective of IL-1beta as the gatekeeper of inflammation. Eur. J. Immunol. 41, 1203e1217. Edholm, E.S., Grayfer, L., De Jesus Andino, F., Robert, J., 2015. Nonclassical MHCrestricted invariant Valpha6 T cells are critical for efficient early innate antiviral immunity in the Amphibian Xenopus laevis. J. Immunol. 195, 576e586. Fujisawa, H., Tsuru, S., Taniguchi, M., Zinnaka, Y., Nomoto, K., 1987. Protective mechanisms against pulmonary infection with influenza virus. I. Relative contribution of polymorphonuclear leukocytes and of alveolar macrophages to protection during the early phase of intranasal infection. J. Gen. Virol. 68 (Pt 2),
425e432. Gazendam, R.P., van Hamme, J.L., Tool, A.T., Hoogenboezem, M., van den Berg, J.M., Prins, J.M., Vitkov, L., van de Veerdonk, F.L., van den Berg, T.K., Roos, D., Kuijpers, T.W., 2016. Human neutrophils use different mechanisms to kill Aspergillus fumigatus conidia and hyphae: evidence from phagocyte defects. J. Immunol. 196, 1272e1283. Gerna, G., 2012. Endothelial cells and CMV dissemination. Future Microbiol. 7, 441e444. Grayfer, L., Robert, J., 2013. Colony-stimulating factor-1-responsive macrophage precursors reside in the amphibian (Xenopus laevis) bone marrow rather than the hematopoietic subcapsular liver. J. Innate Immun. 5, 531e542. Grayfer, L., De Jesus Andino, F., Robert, J., 2014a. The amphibian (Xenopus laevis) type I interferon response to Frog Virus 3: new insight into ranavirus pathogenicity. J. Virol. 4, 1075e1092. Grayfer, L., Edholm, E.S., Robert, J., 2014b. Mechanisms of amphibian macrophage development: characterization of the Xenopus laevis colony-stimulating factor1 receptor. Int. J. Dev. Biol. 58, 757e766. Grayfer, L., Robert, J., 2014. Divergent antiviral roles of amphibian (Xenopus laevis) macrophages elicited by colony-stimulating factor-1 and interleukin-34. J. Leukoc. Biol. 96, 1143e1153. Grayfer, L., Robert, J., 2015. Distinct functional roles of amphibian (Xenopus laevis) colony-stimulating factor-1- and interleukin-34-derived macrophages. J. Leukoc. Biol. 98, 641e649. Havixbeck, J.J., Barreda, D.R., 2015. Neutrophil development, migration, and function in teleost fish. Biol. (Basel) 4, 715e734. Hoverman, J.T., Gray, M.J., Miller, D.L., 2010. Anuran susceptibilities to ranaviruses: role of species identity, exposure route, and a novel virus isolate. Dis. Aquat. Organ 89, 97e107. Landsberg, J.H., Kiryu, Y., Tabuchi, M., Waltzek, T.B., Enge, K.M., Reintjes-Tolen, S., Preston, A., Pessier, A.P., 2013. Co-infection by alveolate parasites and frog virus 3-like ranavirus during an amphibian larval mortality event in Florida, USA. Dis. Aquat. Organ 105, 89e99. Levine, A.P., Duchen, M.R., de Villiers, S., Rich, P.R., Segal, A.W., 2015. Alkalinity of neutrophil phagocytic vacuoles is modulated by HVCN1 and has consequences for myeloperoxidase activity. PLoS One 10, e0125906. Majji, S., Thodima, V., Sample, R., Whitley, D., Deng, Y., Mao, J., Chinchar, V.G., 2009. Transcriptome analysis of Frog virus 3, the type species of the genus Ranavirus, family Iridoviridae. Virol 391, 293e303. Metcalf, D., 2008. Hematopoietic cytokines. Blood 111, 485e491. Morales, H.D., Abramowitz, L., Gertz, J., Sowa, J., Vogel, A., Robert, J., 2010. Innate immune responses and permissiveness to ranavirus infection of peritoneal leukocytes in the frog Xenopus laevis. J. Virol. 84, 4912e4922. Orenstein, J.M., 2000. In vivo cytolysis and fusion of human immunodeficiency virus type 1-infected lymphocytes in lymphoid tissue. J. Infect. Dis. 182, 338e342. Reeve, B.C., Crespi, E.J., Whipps, C.M., Brunner, J.L., 2013. Natural stressors and ranavirus susceptibility in larval wood frogs (Rana sylvatica). Ecohealth 10, 190e200. Shepherd, V.L., 1986. The role of the respiratory burst of phagocytes in host defense. Semin. Respir. Infect. 1, 99e106. Skokowa, J., Welte, K., 2013. Defective G-CSFR signaling pathways in congenital neutropenia. Hematol. Oncol. Clin. North Am. 27, 75e88 (viii). Spriggs, D.R., Deutsch, S., Kufe, D.W., 1992. Genomic structure, induction, and production of TNF-alpha. Immunol. Ser. 56, 3e34. Sweet, C., Smith, H., 1980. Pathogenicity of influenza virus. Microbiol. Rev. 44, 303e330. Tamassia, N., Le Moigne, V., Rossato, M., Donini, M., McCartney, S., Calzetti, F., Colonna, M., Bazzoni, F., Cassatella, M.A., 2008. Activation of an immunoregulatory and antiviral gene expression program in poly(I: C)-transfected human neutrophils. J. Immunol. 181, 6563e6573. Tate, M.D., Brooks, A.G., Reading, P.C., 2008. The role of neutrophils in the upper and lower respiratory tract during influenza virus infection of mice. Respir. Res. 9, 57. Tate, M.D., Deng, Y.M., Jones, J.E., Anderson, G.P., Brooks, A.G., Reading, P.C., 2009. Neutrophils ameliorate lung injury and the development of severe disease during influenza infection. J. Immunol. 183, 7441e7450. Tumpey, T.M., Chen, S.H., Oakes, J.E., Lausch, R.N., 1996. Neutrophil-mediated suppression of virus replication after herpes simplex virus type 1 infection of the murine cornea. J. Virol. 70, 898e904. Williams, T., Barbosa-Solomieu, V., Chinchar, V.G., 2005. A decade of advances in iridovirus research. Adv. Virus Res. 65, 173e248. Yaparla, A., Wendel, E.S., Grayfer, L., 2016. The unique myelopoiesis strategy of the amphibian Xenopus laevis. Dev. Comp. Immunol. 63, 136e143.
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci
Immune roles of amphibian (Xenopus laevis) tadpole granulocytes during Frog Virus 3 ranavirus infections Daphne V. Koubourli, Emily S. Wendel, Amulya Yaparla, Jonathan R. Ghaul, Leon Grayfer* Department of Biological Sciences, George Washington University, Washington, DC, USA
a r t i c l e i n f o
a b s t r a c t
Article history: Received 6 February 2017 Received in revised form 21 February 2017 Accepted 21 February 2017 Available online 24 February 2017
Infections by Frog Virus 3 (FV3) and other ranaviruses (RVs) are contributing to the amphibian declines, while the mechanisms controlling anuran tadpole susceptibility and adult frog resistance to RVs, including the roles of polymorphonuclear granulocytes (PMNs) during anti-FV3 responses, remain largely unknown. Since amphibian kidneys represent an important FV3 target, the inability of amphibian (Xenopus laevis) tadpoles to mount effective kidney inflammatory responses to FV3 is thought to contribute to their susceptibility. Here we demonstrate that a recombinant X. laevis granulocyte colonystimulating factor (G-CSF) generates PMNs with hallmark granulocyte morphology. Tadpole pretreatment with G-CSF prior to FV3 infection reduces animal kidney FV3 loads and extends their survival. Moreover, G-CSF-derived PMNs are resistant to FV3 infection and express high levels of TNFa in response to this virus. Notably, FV3-infected tadpoles fail to recruit G-CSFR expressing granulocytes into their kidneys, suggesting that they lack an integral inflammatory effector population at this site. © 2017 Elsevier Ltd. All rights reserved.
Keywords: Ranavirus Granulocyte Amphibian Proinflammatory G-CSF CSF-3 Frog virus 3 FV3
1. Introduction Infections by Frog Virus 3 (FV3) and other members of the ranavirus genus (family Iridoviridae) are significantly contributing to the worldwide amphibian declines (Chinchar, 2002; Chinchar et al., 2009; Williams et al., 2005). Notably, anuran amphibian tadpoles are substantially more susceptible to, and are more adversely affected by ranavirus infections, as compared to adult frogs (Bayley et al., 2013; Grayfer et al., 2014a; Hoverman et al., 2010; Landsberg et al., 2013; Reeve et al., 2013). Despite this, the differences between the anuran tadpole and adult frog immune responses that culminate in their respective susceptibility and
Abbreviation: APBS, amphibian phosphate buffered saline; CMP, common myeloid progenitor; dpi, days post infection; FV3, Frog Virus 3; GAPDH, Glyceraldehyde 3 phosphate dehydrogenase; G-CSF, granulocyte colony-stimulating factor; G-CSFR, granulocyte colony-stimulating factor receptor; hpi, hours post infection; IL, 1b-interleukin-1 beta; IFN, interferon; IFNg, interferon gamma; ip, intraperitoneal; M-CSF, macrophage colony-stimulating factor; MDA5, Melanoma Differentiation-Associated protein 5; Mf, macrophage; PMN, polymorphonuclear granulocyte; poly (I:C), polyinosinic:polycytidylic acid; qRT-PCR, quantitative reverse transcriptase polymerase chain reaction; RV, ranavirus; TNFa, tumor necrosis factor-alpha; vDNA Pol, viral DNA polymerase. * Corresponding author. E-mail address: [email protected] (L. Grayfer). http://dx.doi.org/10.1016/j.dci.2017.02.016 0145-305X/© 2017 Elsevier Ltd. All rights reserved.
resistance to FV3 remain to be adequately determined. Anuran tadpole and adult frog kidneys are thought to be important FV3 replication sites (Morales et al., 2010). Thus, the inability of tadpoles to adequately upregulate their kidney gene expression of inflammatory cytokines such as tumor necrosis factor-alpha (TNFa) in responses to FV3 infection, has been proposed as an important determinant of their susceptibility to this pathogen (Andino et al., 2012). During certain viral infections, mammalian polymorphonuclear granulocytes (PMNs) play important roles in the clearance of virally infected cells and the production of inflammatory and antiviral cytokines (Fujisawa et al., 1987; Sweet and Smith, 1980; Tate et al., 2008, 2009; Tumpey et al., 1996). Since X. laevis possess both FV3susceptible and FV3-resistant macrophage (Mf) populations (Grayfer and Robert, 2014; 2015), it is notable that Mfs and PMNs arise from a common myeloid precursor (Buza-Vidas et al., 2007) and share many immunological facets (Shepherd, 1986). Moreover, although X. laevis PMNs are recruited to the sites of FV3 infection (Edholm et al., 2015), their immune roles during these infections remain unknown. The mammalian granulocyte colony-stimulating factor (G-CSF) is indispensible to granulocyte lineage commitment, proliferation, differentiation and functional maturations (Metcalf, 2008) to the
D.V. Koubourli et al. / Developmental and Comparative Immunology 72 (2017) 112e118
point where defects in G-CSF receptor (G-CSFR) signaling manifest in severe congenital neutropenia (Skokowa and Welte, 2013). Pertinently, we have recently identified the X. laevis G-CSF and have demonstrated the importance of this frog cytokine to amphibian granulopoiesis (Yaparla et al., 2016). Accordingly, in the present manuscript we addressed the possible antiviral roles of G-CSFderived tadpole PMNs, examining their morphology, FV3-elicited gene expression and the capacity of these innate immune effectors to protect animals during FV3 challenge.
2. Materials and methods 2.1. Animals Outbred tadpole and adult Xenopus laevis were purchased from the Xenopus 1 facility, housed and handled under strict laboratory and IACUC regulations (Approval number 15-024).
2.2. Cell culture media and conditions All cell cultures were established using Iscove's Modified Dulbecco's Medium supplemented with 10% fetal bovine serum, 0.25% X. laevis serum, insulin (Sigma), non-essential amino acids (Sigma), primatone (2.5%). This medium contained 10 mg/mL Gentamycin (Thermo Fisher Scientific) and 100 U/mL penicillin/100 mg/mL streptomycin (Gibco), was buffered with sodium bicarbonate, pH 7.7 and diluted to 1 in 5 parts with water to amphibian osmolarity. All leukocyte cultures were grown at 27 C with 0.5% CO2. Amphibian phosphate buffered saline (APBS) consisted of 100 mM sodium chloride, 8 mM sodium phosphate, 1.5 mM potassium phosphate; pH 7.7.
113
2.4. Production of the recombinant X. laevis G-CSF and M-CSF The production of recombinant X. laevis G-CSF and M-CSF has been previously described (Yaparla et al., 2016). Briefly, the G-CSF and M-CSF sequences representing the signal peptide-cleaved transcripts were PCR-amplified, ligated into the pMIB/V5 His A insect expression vectors (Invitrogen) and introduced into Sf9 insect cells (cellfectin II, Invitrogen). Presence of recombinant proteins in the transfected Sf9 supernatants was confirmed by western blot and the positive transfectants were selected using 10 mg/mL blasticidin. The protein expression cultures were then scaled up as 500 mL liquid cultures, grown for 5 days, pelleted and the supernatants collected. These were dialyzed overnight at 4 C against 150 mM sodium phosphate, concentrated against polyethylene glycol flakes (8 kDa) at 4 C, dialyzed overnight at 4 C against 150 mM sodium phosphate and passed through Ni-NTA agarose columns (Qiagen). Columns were washed with 2 10 vol of high stringency wash buffer (0.5% Tween 20; 50 mM Sodium Phosphate; 500 mM Sodium Chloride; 100 mM Imidazole) and 5 10 vol of low stringency wash buffer (as above, but with 40 mM Imidazole). Recombinant cytokines were eluted using 250 mM imidazole. The presence of recombinant cytokines in the fractions was confirmed by western blot against the V5 epitopes on the proteins (Suppl. Fig. 1A). Protein concentrations were determined by Bradford protein assays (BioRad). Halt protease inhibitor cocktail (containing AEBSF, aprotinin, bestatin, E-64, leupeptin and pepstatin A; Thermo Scientific) was added to the purified proteins, which were then stored at 20 C in aliquots until use. The vector control (denoted as ‘control’ throughout) was generated by transfecting Sf9 cells with the empty pMIB/V5 His A expression vector (Invitrogen) and the supernatants derived from the transfected cells processed in parallel to recombinant cytokine production (Suppl. Fig. 1A), including the addition of the protease inhibitor.
2.3. FV3 stocks, animal and cell infections FV3 production has been described previously (Morales et al., 2010). Briefly, baby hamster kidney (BHK-21) cells were inoculated with FV3 (multiplicity of infection; MOI: 0.1), grown at 5% CO2 and 30 C for 5 days or until the cells were completely lysed. The FV3-containing supernatants were pre-cleared by ultracentrifugation, collected over 30% sucrose and re-suspended in APBS. Viral titers were determined using plaque assay analysis over BHK21 cells. For all studies, tadpoles (N ¼ 5) and adult frogs (N ¼ 4) were virally infected by intraperitoneal (ip) injection with 104 and 5 106 PFU of FV3, respectively. Control animals were mock infected by ip injections with saline (not containing FV3). Animals were euthanized by tricaine mesylate overdose (tadpoles: 1%; adult frogs: 5%), kidney tissues excised, immediately flash-frozen in Trizol reagent (Invitrogen) over dry ice and stored at 20 C until RNA isolation. For all in vitro infection studies, 104 control leukocytes (N ¼ 4 tadpoles), G-CSF-elicited PMNS (N ¼ 5 tadpoles) or M-CSF-elicited Mfs (N ¼ 4 tadpoles), derived from tadpole peritonea were infected with an MOI of 0.5 for 2 or 24 h, incubated in the medium described above at 27 C with 0.5% CO2. Subsequently, the cells were trypsinized to remove attached but not internalized virus and washed with APBS. The cellular FV3 viral loads were determined by subjecting the washed cells to 3 rounds of sequential freeze-thaw lysis and intermittent repeated passages through 24-gage needles. The resulting homogenates were examined by plaque assays on BHK monolayers under an overlay of 1% methylcellulose, as previously described (Morales et al., 2010).
2.5. Tadpole injections with recombinant cytokines, cell isolation and cytology Tadpoles (stage NF 54) were injected once ip with 1 mg total of either M-CSF (N ¼ 4 tadpoles), G-CSF (N ¼ 5 tadpoles), or equal volumes of the control (N ¼ 4 tadpoles) in APBS (10 mL final volume) using finely pulled glass needles. After 1, 3 and 5 days following the injections, peritoneal leukocytes were lavaged with APBS using finely pulled glass needles. For expression experiments, M-CSFelicited Mfs (N ¼ 4 tadpoles), G-CSF-elicited PMNs (N ¼ 5 tadpoles), and control peritoneal leukocytes (N ¼ 4 tadpoles) were isolated from tadpoles after 1 day of injection with the respective stimuli. Peritoneal leukocytes were enumerated via a hemocytometer and using trypan blue (Sigma) exclusion. In separate experiments, control peritoneal leukocytes and GCSF-elicited PMNs were cyto-spun (Shandon Southern), Giemsastained and images derived using a Nikon Eclipse Ni-U microscope and Canon EOS Rebel T3i digital camera. All cytological analyses are representative of three independent experiments.
2.6. Tadpole survival study Tadpoles (N ¼ 12 tadpoles per treatment group) were injected ip with 1 mg/animal of G-CSF or equal volume of the control in APBS (10 mL final volume) using finely pulled glass needles. The following day, animals were infected by ip injections with 104 PFU of FV3 and survival monitored thereafter, twice daily.
114
D.V. Koubourli et al. / Developmental and Comparative Immunology 72 (2017) 112e118
Fig. 1. Intraperitoneal injection of X. laevis tadpoles with G-CSF results in accumulation of leukocytes bearing hallmark granulocyte morphology. Tadpoles were injected with G-CSF (1 mg/animal) or equal volumes of the control and lavaged with saline after 1, 3 and 5 days of injection. (A) cells were enumerated and (B) cytologically examined. Results in (A) are means þ SEM; (N ¼ 5). Significant differences between G-CSF- and control-injected tadpole leukocyte numbers derived at respective times after injection are denoted by the derived P values over bars indicating the treatment groups being compared, P < 0.05. Scale bars in (B) are 5 mm.
2.7. Isolation of RNA and DNA from tadpole cells and kidney tissues For all experiments, tadpole and adult cells or kidney tissues from FV3-infected animals were homogenized by passage through progressively higher gage needles in Trizol reagent (Invitrogen), flash frozen on dry ice and stored at 80 C until RNA and DNA isolation. RNA isolation was performed using Trizol (Invitrogen) and according to manufacturer's directions. DNA was isolated from the Trizol following RNA isolation. In brief, following phase separation and extraction of RNA, the remaining Trizol layer was mixed with back extraction buffer (4 M guanidine thiocyanate, 50 mM sodium citrate, 1 M Tris pH 8.0), centrifuged to isolate the DNA containing aqueous phase. The DNA was precipitated overnight with isopropanol, pelleted by centrifugation, washed with 70% ethanol and resuspended in TE (10 mM Tris pH 8.0, 1 mM EDTA) buffer. DNA was then purified by phenol: chloroform extraction and resuspended in molecular grade water.
TGGATGAAGGACTACAGCTAATG; reverse: GCCTGTCATCTGTGAGGTTTA) was performed using the delta^delta CT method, with expression examined relative to the GAPDH (FWD: ACCCCTTCATCGACTTGGAC; reverse: AGATGGAGGAGTGAGTGTCACCAT) endogenous control and normalized against the lowest observed expression. FV3 viral loads were determined by absolute qPCR and performed using 50 ng of total isolated DNA and compared against a serially diluted standard curve. In briefly, a pGEM-T plasmid bearing an FV3 vDNA Pol (ORF 60R) fragment was serially diluted into 101-108 vDNA Pol fragment-containing copies. These were used as the standard curve in subsequent absolute qPCR assays. The sequences of the primers used are: forward: CAAGAACGTGTGCTACTCCA; reverse: AGCCTCTCGTACTCTACCTTC. All experiments were performed using the CFX96 Real-Time System and iTaq Universal SYBR Green Supermix. The BioRad CFX Manager software (SDS) was employed for all expression analysis. All primers were validated prior to use.
2.8. Quantitative analysis of gene expression and FV3 copy number Quantitative analysis of X. laevis gene expression and FV3 viral copy number has been described (Grayfer et al., 2014b; Grayfer and Robert, 2013, 2014). Briefly, Total RNA and DNA were extracted from frog cells or kidney tissues using the Trizol reagent and following the manufacturer's directions (Invitrogen). All cDNA syntheses were performed using iScript cDNA synthesis kits in accordance to manufacturers' directions (Bio-Rad, Hercules, CA) and using 500 ng of total RNA. Quantitative (q) RT-PCR analysis was performed using 2.5 ml of the derived cDNA templates. Expression analysis of TNFa (forward: TGTCAGGCAGGAAAGAAGCA; reverse: CAGCAGAGCAAAGAGGATGGT), IL-1b (forward: CATTCCCATGGAGGGCTACA; reverse: TGACTGCCACTGAGCAGCAT) and G-CSFR (forward:
2.9. Statistical analysis Statistical analysis was performed using a one-way analysis of variance (ANOVA) and post hoc t-test, using Vassar Stat (http:// faculty.vassar.edu/lowry//anova1u.html) and Graph Pad (https:// www.graphpad.com/quickcalcs/ttest1.cfm) statistical programs, respectively. Probability level of P < 0.05 was considered significant. Statistical analysis of the tadpole survival data was performed using a Log-rank test (GraphPad Prism 6), comparing G-CSFinjected to control-injected tadpole survival curves. Probability level of P < 0.05 was considered significant.
D.V. Koubourli et al. / Developmental and Comparative Immunology 72 (2017) 112e118
3. Results 3.1. Recruitment and cytology of G-CSF-elicited tadpole PMNs To examine the roles of PMNs during FV3 responses in the highly FV3-susceptible X. laevis tadpoles, we produced the principal granulocyte growth and differentiation factor, granulocyte colonystimulating factor (G-CSF) in recombinant form (Suppl. Fig. 1A). Since the mammalian G-CSF is known to be chemotactic to granulocytes and their precursor cells (Bendall and Bradstock, 2014), we thus injected tadpoles intraperitoneally (ip) with the recombinant X. laevis G-CSF in order to recruit and differentiate tadpole granulocyte precursors within this site (Fig. 1). Tadpoles were alternatively injected with a control (supernatants from empty expression vector-transfected insect cells, processed in parallel to G-CSF isolation) and animals were ip lavaged at 1, 3 and 5 days post injection to enumerate and cytologically assess the resulting cells (Fig. 1). After 1 day of injection, G-CSF-administered tadpoles possessed 17 fold greater peritoneal leukocyte numbers than control animals (Fig. 1A). After 3 days of injection, G-CSF-treated tadpoles possessed 28 fold greater leukocyte numbers than respective controls, which were returned to 2 fold over control numbers (not significant) by 5 days after cytokine administration (Fig. 1A). In comparison to the leukocytes isolated from control-injected animals, G-CSF-elicited tadpole leukocytes were much larger and exhibited characteristic granulocyte morphology including multilobed nuclei and membrane ruffling (Fig. 1B, Suppl. Fig. 1BeD). Roughly 90e95% of the leukocytes isolated from G-CSF-administered tadpoles, exhibited this characteristic PMN morphology (Suppl. Fig. 1BeD).
115
monitored animal survival (Fig. 2). Interestingly, tadpoles injected with G-CSF prior to FV3 challenge survived substantially longer during the first 7 days of FV3 infection (Fig. 2). However, following the initial week of FV3 challenge, G-CSF-administered, FV3infected tadpole survival decreased to the levels observed in the control animals (Fig. 2). 3.3. G-CSF administration decreases tadpole kidney FV3 loads Since G-CSF administration extended FV3-infected tadpole survival (Fig. 2) while the anuran amphibian kidney appears to be a principal site of FV3 replication (Morales et al., 2010), we next
3.2. G-CSF administration extends FV3-infected tadpole survival To examine the bearing of expanding tadpole G-CSF PMNs on their survival following FV3 challenge, we injected tadpoles ip with G-CSF (1 mg/animal) or equal volumes of the control, the following day infected them ip with FV3 (104 PFU/animal) and then
Fig. 2. Intraperitoneal injection of X. laevis tadpoles with G-CSF extends their survival following FV3 infection. Tadpoles were injected with G-CSF (1 mg/animal) or equal volumes of the control and 24 h later infected with FV3 (104 PFU/animal). Animal survival was monitored twice daily. The G-CSF- and control-injected tadpole survival curves were significantly different, N ¼ 12 tadpoles/treatment group, P ¼ 0.0216.
Fig. 3. (A) G-CSF reduces FV3-infeted tadpole kidney viral loads and (B) G-CSF PMNs are less susceptible to viral entry but permit greater FV3 replication compared to MCSF Mfs. (A) Tadpoles were injected with G-CSF (1 mg/animal) or equal volumes of the control and 24 h later infected with FV3 (104 PFU/animal). Tadpole kidneys were excised at 1, 3 and 5 dpi, DNA isolated and the amount of FV3 genome copies per 50 ng total isolated DNA examined by absolute qPCR using an FV3 standard curve. (B) Tadpole peritoneal M-CSF-derived Mfs (N ¼ 4 tadpoles), G-CSF-elicited PMNs (N ¼ 5 tadpoles) and control leukocytes (N ¼ 4 tadpoles) were infected with FV3 (MOI: 0.5) for 2 and 24 h, cells harvested and examined by plaque assay analysis for infectious FV3 loads. Results are means þ SEM. In (A) significant differences from control treated animals at 1 dpi are denoted by respective overhead P values and significant differences between treatment groups are indicated by the corresponding P values above bars indicating the treatments being compared. In (B), significant differences from control leukocytes are denoted by the corresponding overhead P values and significant differences between treatment groups are indicated by the corresponding P values above bars indicating the treatments being compared P < 0.05.
116
D.V. Koubourli et al. / Developmental and Comparative Immunology 72 (2017) 112e118
examined FV3 loads in G-CSF- or control-injected, FV3 infected tadpoles (Fig. 3A) by absolute qPCR. After 1-day post infection (dpi), G-CSF treated tadpoles possessed modestly, but not significantly greater FV3 DNA copies than those detected in the kidneys of control animals (Fig. 3A). After 3 dpi, control and G-CSF treated tadpoles exhibited similar FV3 genomic copies (Fig. 3A). Notably, whereas the control tadpole kidney FV3 loads increased further by 5 dpi, the G-CSF-injected tadpole kidney FV3 loads did not increase further from the levels seen at 3 dpi and were significantly lower (two-fold) than those detected in the control animals on that dpi (Fig. 3A). 3.4. Tadpole G-CSF-elicited PMNs are less susceptible to FV3 entry but are more amicable to viral replication than M-CSF-deride Mfs We previously reported that tadpole peritoneal macrophages (Mfs) elicited with the macrophage colony-stimulating factor (MCSF) Mf growth factor are very susceptible to FV3 (Grayfer and Robert, 2014). To compare the susceptibility/resistance of tadpole G-CSF PMNs to the M-CSF-derived Mfs, we injecting tadpoles ip with recombinant G-CSF, M-CSF or the control, the following day isolated G-CSF PMNs, M-CSF Mfs and control leukocytes (respectively) by peritoneal lavage and infected them in vitro with FV3 (MOI: 0.5). Infected cells were harvested at 2 and 24 h (h)pi and assessed by plaque assay analysis (Fig. 3B). Since the average FV3 replication cycle is approximately 9 h (Majji et al., 2009), plaque assay analysis of cells after 2 hpi would indicate the amount of infiltrating virus, whereas cells examined after 24 hpi would reveal the extent of FV3 replication. Notably, at 2 hpi M-CSF Mfs possessed approximately 15 fold greater FV3 loads than the control leukocytes or the G-CSF-derived PMNs (Fig. 3B), suggesting that the G-CSF PMNs are much less susceptible to viral entry than the M-CSF Mfs. In keeping with our previous observations (Grayfer and Robert, 2014), after 24 hpi the invading FV3 had not undergone significant replication within the M-CSF Mfs (Fig. 3B). By contrast, after 24 hpi the G-CSF-derived PMNs possessed significantly increased (4 fold) FV3 loads compared to 2 hpi (and 5 fold greater than control leukocytes; Fig. 3B), suggesting that these cells may be more supportive to FV3 replication than the M-CSF Mfs. 3.5. Tadpole G-CSF-derived PMNs express high levels of TNFa in response to FV3 The amphibian (X. laevis) tadpole inability to deal with FV3 infections has been explained in part by their inadequate inflammatory responses to these viral infections, including very modest and delayed expression of hallmark inflammatory cytokines such as interleukin-1 beta (IL-1b) and tumor necrosis factor-alpha (TNFa) (Andino et al., 2012). Since myeloid cells represent important sources of these soluble mediators (Dinarello, 2011; Spriggs et al., 1992), we next examined the expression of IL-1b and TNFa in MCSF Mfs and G-CSF PMNs that had been challenged in vitro with FV3 (MOI: 0.5; Fig. 4A&B). G-CSF PMNs, M-CSF Mfs and control leukocytes possessed similar IL-1b mRNA levels that were not significantly altered by FV3 challenge (Fig. 4A). While all three examined cell populations upregulated their TNFa transcript levels following FV3 stimulation, the virally challenged G-CSF PMNs exhibited 2.5e3 fold greater TNFa mRNA levels than detected in the FV3-stimulated M-CSF Mfs or control leukocytes, respectively (Fig. 4B). 3.6. FV3-infected tadpoles fail to recruit PMNs to their kidneys; a key site of viral replication Our results indicate that tadpole G-CSF PMNs represent an
important source of inflammatory cytokines (Fig. 4A&B) while FV3infected tadpole susceptibility is thought to arise (in part) from their inability to elicit appropriate inflammatory cytokine gene expression within their kidneys (Andino et al., 2012). Accordingly, we hypothesized that the tadpole inability to upregulate their kidney inflammatory cytokine expression reflects their lack of adequate granulocyte recruitment to this tissue during FV3 infections. To test this notion, we next compared the kidneys of FV3infected X. laevis tadpoles and adult frogs for possible granulocyte infiltration by examining the gene expression of a hallmark granulocyte marker, the G-CSF receptor (G-CSFR) within this tissue (Fig. 4C). After 3 dpi, the gene expression of the adult frog kidney GCSFR was increased over 5-fold compared to mock-infected controls (Fig. 4C), suggesting that adult frogs were recruiting granulocytes to this important site of infection and possibly explaining the previously observed increases in FV3-infected adult frog kidney TNFa and IL-1b expression (Andino et al., 2012). By stark contrast, after 3 dpi the FV3-challenged tadpole kidney G-CSFR levels were significantly reduced (5-fold reduction; Fig. 4C), suggesting a decrease in kidney granulocyte numbers. This supports our hypothesis that the inadequate tadpole kidney inflammatory responses to FV3 may be explained by the absence of important inflammatory cytokine-producing granulocyte population(s) within this tissue. 4. Discussion In consideration of the escalating amphibian declines (Chinchar, 2002; Chinchar et al., 2009; Williams et al., 2005), it is imperative that we gain insights into the successes and pitfalls of amphibian immune responses to emerging etiological pathogens such as FV3. As anuran tadpoles are substantially more susceptible to FV3 than the adult frogs (Bayley et al., 2013; Grayfer et al., 2014a; Hoverman et al., 2010; Landsberg et al., 2013; Reeve et al., 2013), defining the successes and pitfalls of tadpole anti-FV3 responses will lend to understanding the causes of their susceptibility to this pathogen. In this respect, it is notable that X. laevis tadpoles fail to adequately mount kidney inflammatory responses to FV3 (Andino et al., 2012) while our present findings indicate that this may, at least in part be due to inadequate PMN recruitment to this site. While PMNs are generally known for their antimicrobial and antifungal capacities (Gazendam et al., 2016; Havixbeck and Barreda, 2015), these cells have also been implicated as antiviral effectors (Fujisawa et al., 1987; Sweet and Smith, 1980; Tate et al., 2008, 2009; Tumpey et al., 1996) and their depletion compounds the severity of viral infections (Fujisawa et al., 1987; Tate et al., 2008; Tumpey et al., 1996). Notably, our findings suggest that the X. laevis tadpole G-CSF-derived granulocytes are important cellular effectors during FV3 responses. For example, the enrichment of tadpole PMNs with recombinant G-CSF extends tadpole survival and lowers animal kidney FV3 loads. Moreover, G-CSF-differentiated PMNs may represent important producers of inflammatory cytokines such as TNFa during FV3 infections, and thus are integral to anti-FV3 inflammatory responses. Since the inability of tadpoles to mount adequate kidney inflammatory responses to FV3 is thought to contribute to their susceptibility (Andino et al., 2012), it is thus compelling that although FV3 elicits robust upregulation of TNFa in tadpole G-CSF-derived PMNs, G-CSFR-expressing PMNs fail to infiltrate FV3-infected tadpole kidneys. By contrast, FV3challenged adult frogs markedly increase their kidney TNFa gene expression (Andino et al., 2012) while our results also indicate a significant G-CSFR expression and hence granulocyte infiltration of infected adult kidneys. Presumably, the inability of FV3-infected tadpoles to upregulate their kidney expression of inflammatory cytokines like TNFa may be at least in part attributed to the lack of
D.V. Koubourli et al. / Developmental and Comparative Immunology 72 (2017) 112e118
117
tadpole granulocyte infiltration of this site. By the same argument, we propose that the successful adult frog kidney inflammatory responses reflect adequate infiltration and activation of granulocytes within this tissue. Treatment of mammalian granulocytes with poly (I:C) readily initiates their expression of inflammatory and antiviral genes (Tamassia et al., 2008). These responses are thought to involve MDA5 activation and result in robust production of antiviral interferons (IFNs) and TNFa (Tamassia et al., 2008). While our expression analysis indicated that FV3-challenged G-CSF PMNs do not upregulate type I or type III IFN gene expression (data not shown), our results do support the notion that virally induced granulocyte TNFa may be important to anti-FV3 immunity. Future research, focusing on the specific antiviral roles of PMN-expressed inflammatory mediators such as TNFa will help to define the mechanisms by which these cells confer their anti-FV3 responses. FV3-infected adult frogs rapidly and robustly upregulated their kidney IFNg mRNA levels after 1 day of infection, while tadpoles exhibited significantly delayed and meager kidney IFNg responses to FV3 (Andino et al., 2012). Our results indicate that FV3challenged, G-CSF-derived PMNs do not upregulated their IFNg gene expression (data not shown), indicating that the adult frogs possess other infiltrating immune cells or resident cell populations responsible for this cytokine response. It should be noted that although G-CSF-derived PMNs were significantly less susceptible to FV3 entry than M-CSF Mfs, they were also more amiable to FV3 replication. While the majority of our data suggests that X. laevis granulocytes serve antiviral roles during FV3 infections, it is possible that they may, at some point in the infection become the means of FV3 dissemination. The G-CSFconferred extension of FV3-infected tadpole survival lasted for the first week of infection and was followed by a swift decline in tadpole survival to levels comparable to, or lower than control animals. Possibly, the extended tadpole survival reflects the protective antiviral properties of the PMNs expanded by G-CSF while the drastic decline in animal survival later on in the infection may be due to viral accumulation and dissemination within this expanded population of cells. Indeed, several studies have described that antiviral granulocyte effectors also possessed intracellular, presumably propagating viruses (Gerna, 2012; Levine et al., 2015; Orenstein, 2000). Possibly, the dual nature of granulocytes as both antiviral effectors and vectors for viral dissemination is shared across vertebrate species. Alternatively, the decline in G-CSF-injected, FV3-infected tadpole survival may be due to the loss of the protective effects conferred by the cytokine injection. Notably, after 5 days of ip G-CSF injection, we did not observe significant accumulation of peritoneal granulocytes, suggesting that the effects of this cytokine administration may be short-lived. The above notions will be elucidated by future studies, examining the roles of X. laevis PMNs in FV3 dissemination to different tissues and at distinct times during infection. Together, our past and present studies indicate that the success of the anuran anti-FV3 response hinges on the appropriate differentiation, accumulation and activation of specific innate immune cell subsets. Our past work has defined the roles of differentially
Fig. 4. Analysis of (A) IL-1b and (B) TNFa gene expression in FV3-challenged tadpole GCSF PMNs, and (C) G-CSFR gene expression in the kidneys of FV3-infected tadpoles and adult frogs. Tadpole peritoneal M-CSF Mfs (N ¼ 4 tadpoles), G-CSF PMNs (N ¼ 5 tadpoles), and control leukocyes (N ¼ 4 tadpoles) were challenged with FV3 (MOI: 0.5) for 2 and 24 h and the gene expression of (A) IL-1b and (B) TNFa examined by qRT-PCR.
(C) Tadpoles and adult frogs were inoculated with FV3 ip (104 and 5 106 PFU/animal, respectively) or mock-infected by saline injections. Animal kidneys were excised after 3 dpi and examined for G-CSFR gene expression by qRT-PCR. All results are means þ SEM. In (A&B), significant differences from control leukocytes are denoted by corresponding overhead P values and significant differences between treatment groups are indicated by the corresponding P values above bars indicating the treatments being compared P < 0.05. In (C), significant differences between treatment groups are indicated by the corresponding P values above bars indicating the treatments being compared P < 0.05.
118
D.V. Koubourli et al. / Developmental and Comparative Immunology 72 (2017) 112e118
polarized Mf populations in the ability of X. laevis to mount effective antiviral responses (Grayfer and Robert, 2014, 2015), while presently we demonstrate that the X. laevis G-CSF-differentiated granulocytes may likewise skew the balance between FV3 susceptibility and resistance. As we move forward, it will be invaluable to define the immune interactions between these respective myeloid populations and how the sequential recruitment of these cells to the sites of FV3 replication may impact viral infection outcomes. In spite of the dire need to gather new insights into the facets governing amphibian susceptibility and resistance to pathogens such as FV3, research into these processes have been hampered by lack of available reagents and resources with which to explore the antiviral immune responses of these intriguing organisms. As more advanced molecular techniques, technology, and reagents are becoming more readily available, the time is ripe to exploit all possible resources by which to get a clearer window into the antiviral roles of amphibian immune effectors such as granulocytes and the mechanisms by which they may be conferring animal susceptibility or resistance to emerging pathogens such as Frog Virus 3. Acknowledgements E.S.W. thanks the GWU Harlan Research Program. A.Y. thanks the GWU, Dept. Biological Sciences for GTA support and support from the GWU Harlan Research Program. L.G. thanks the GWU, Dept. Biological Sciences for research support at the early investigator stage. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.dci.2017.02.016. References Andino, F.D.J., Chen, G., Li, Z., Grayfer, L., Robert, J., 2012. Susceptibility of Xenopus laevis tadpoles to infection by the ranavirus Frog-Virus 3 correlates with a reduced and delayed innate immune response in comparison with adult frogs. Virol 432, 435e443. Bayley, A.E., Hill, B.J., Feist, S.W., 2013. Susceptibility of the European common frog Rana temporaria to a panel of ranavirus isolates from fish and amphibian hosts. Dis. Aquat. Organ 103, 171e183. Bendall, L.J., Bradstock, K.F., 2014. G-CSF: from granulopoietic stimulant to bone marrow stem cell mobilizing agent. Cytokine Growth Factor Rev. 25, 355e367. Buza-Vidas, N., Luc, S., Jacobsen, S.E., 2007. Delineation of the earliest lineage commitment steps of haematopoietic stem cells: new developments, controversies and major challenges. Curr. Opin. Hematol. 14, 315e321. Chinchar, V.G., 2002. Ranaviruses (family Iridoviridae): emerging cold-blooded killers. Arch. Virol. 147, 447e470. Chinchar, V.G., Hyatt, A., Miyazaki, T., Williams, T., 2009. Family Iridoviridae: poor viral relations no longer. Curr. Top. Microbiol. Immunol. 328, 123e170. Dinarello, C.A., 2011. A clinical perspective of IL-1beta as the gatekeeper of inflammation. Eur. J. Immunol. 41, 1203e1217. Edholm, E.S., Grayfer, L., De Jesus Andino, F., Robert, J., 2015. Nonclassical MHCrestricted invariant Valpha6 T cells are critical for efficient early innate antiviral immunity in the Amphibian Xenopus laevis. J. Immunol. 195, 576e586. Fujisawa, H., Tsuru, S., Taniguchi, M., Zinnaka, Y., Nomoto, K., 1987. Protective mechanisms against pulmonary infection with influenza virus. I. Relative contribution of polymorphonuclear leukocytes and of alveolar macrophages to protection during the early phase of intranasal infection. J. Gen. Virol. 68 (Pt 2),
425e432. Gazendam, R.P., van Hamme, J.L., Tool, A.T., Hoogenboezem, M., van den Berg, J.M., Prins, J.M., Vitkov, L., van de Veerdonk, F.L., van den Berg, T.K., Roos, D., Kuijpers, T.W., 2016. Human neutrophils use different mechanisms to kill Aspergillus fumigatus conidia and hyphae: evidence from phagocyte defects. J. Immunol. 196, 1272e1283. Gerna, G., 2012. Endothelial cells and CMV dissemination. Future Microbiol. 7, 441e444. Grayfer, L., Robert, J., 2013. Colony-stimulating factor-1-responsive macrophage precursors reside in the amphibian (Xenopus laevis) bone marrow rather than the hematopoietic subcapsular liver. J. Innate Immun. 5, 531e542. Grayfer, L., De Jesus Andino, F., Robert, J., 2014a. The amphibian (Xenopus laevis) type I interferon response to Frog Virus 3: new insight into ranavirus pathogenicity. J. Virol. 4, 1075e1092. Grayfer, L., Edholm, E.S., Robert, J., 2014b. Mechanisms of amphibian macrophage development: characterization of the Xenopus laevis colony-stimulating factor1 receptor. Int. J. Dev. Biol. 58, 757e766. Grayfer, L., Robert, J., 2014. Divergent antiviral roles of amphibian (Xenopus laevis) macrophages elicited by colony-stimulating factor-1 and interleukin-34. J. Leukoc. Biol. 96, 1143e1153. Grayfer, L., Robert, J., 2015. Distinct functional roles of amphibian (Xenopus laevis) colony-stimulating factor-1- and interleukin-34-derived macrophages. J. Leukoc. Biol. 98, 641e649. Havixbeck, J.J., Barreda, D.R., 2015. Neutrophil development, migration, and function in teleost fish. Biol. (Basel) 4, 715e734. Hoverman, J.T., Gray, M.J., Miller, D.L., 2010. Anuran susceptibilities to ranaviruses: role of species identity, exposure route, and a novel virus isolate. Dis. Aquat. Organ 89, 97e107. Landsberg, J.H., Kiryu, Y., Tabuchi, M., Waltzek, T.B., Enge, K.M., Reintjes-Tolen, S., Preston, A., Pessier, A.P., 2013. Co-infection by alveolate parasites and frog virus 3-like ranavirus during an amphibian larval mortality event in Florida, USA. Dis. Aquat. Organ 105, 89e99. Levine, A.P., Duchen, M.R., de Villiers, S., Rich, P.R., Segal, A.W., 2015. Alkalinity of neutrophil phagocytic vacuoles is modulated by HVCN1 and has consequences for myeloperoxidase activity. PLoS One 10, e0125906. Majji, S., Thodima, V., Sample, R., Whitley, D., Deng, Y., Mao, J., Chinchar, V.G., 2009. Transcriptome analysis of Frog virus 3, the type species of the genus Ranavirus, family Iridoviridae. Virol 391, 293e303. Metcalf, D., 2008. Hematopoietic cytokines. Blood 111, 485e491. Morales, H.D., Abramowitz, L., Gertz, J., Sowa, J., Vogel, A., Robert, J., 2010. Innate immune responses and permissiveness to ranavirus infection of peritoneal leukocytes in the frog Xenopus laevis. J. Virol. 84, 4912e4922. Orenstein, J.M., 2000. In vivo cytolysis and fusion of human immunodeficiency virus type 1-infected lymphocytes in lymphoid tissue. J. Infect. Dis. 182, 338e342. Reeve, B.C., Crespi, E.J., Whipps, C.M., Brunner, J.L., 2013. Natural stressors and ranavirus susceptibility in larval wood frogs (Rana sylvatica). Ecohealth 10, 190e200. Shepherd, V.L., 1986. The role of the respiratory burst of phagocytes in host defense. Semin. Respir. Infect. 1, 99e106. Skokowa, J., Welte, K., 2013. Defective G-CSFR signaling pathways in congenital neutropenia. Hematol. Oncol. Clin. North Am. 27, 75e88 (viii). Spriggs, D.R., Deutsch, S., Kufe, D.W., 1992. Genomic structure, induction, and production of TNF-alpha. Immunol. Ser. 56, 3e34. Sweet, C., Smith, H., 1980. Pathogenicity of influenza virus. Microbiol. Rev. 44, 303e330. Tamassia, N., Le Moigne, V., Rossato, M., Donini, M., McCartney, S., Calzetti, F., Colonna, M., Bazzoni, F., Cassatella, M.A., 2008. Activation of an immunoregulatory and antiviral gene expression program in poly(I: C)-transfected human neutrophils. J. Immunol. 181, 6563e6573. Tate, M.D., Brooks, A.G., Reading, P.C., 2008. The role of neutrophils in the upper and lower respiratory tract during influenza virus infection of mice. Respir. Res. 9, 57. Tate, M.D., Deng, Y.M., Jones, J.E., Anderson, G.P., Brooks, A.G., Reading, P.C., 2009. Neutrophils ameliorate lung injury and the development of severe disease during influenza infection. J. Immunol. 183, 7441e7450. Tumpey, T.M., Chen, S.H., Oakes, J.E., Lausch, R.N., 1996. Neutrophil-mediated suppression of virus replication after herpes simplex virus type 1 infection of the murine cornea. J. Virol. 70, 898e904. Williams, T., Barbosa-Solomieu, V., Chinchar, V.G., 2005. A decade of advances in iridovirus research. Adv. Virus Res. 65, 173e248. Yaparla, A., Wendel, E.S., Grayfer, L., 2016. The unique myelopoiesis strategy of the amphibian Xenopus laevis. Dev. Comp. Immunol. 63, 136e143.