Immunogenetic analysis reveals that epitope shifting occurs during B-cell affinity maturation in primary biliary cirrhosis1

doi:10.1006/jmbi.2000.4210 available online at http://www.idealibrary.com on

J. Mol. Biol. (2001) 306, 37±46

Immunogenetic Analysis Reveals that Epitope Shifting Occurs During B-cell Affinity Maturation in Primary Biliary Cirrhosis Kathleen N. Potter1*, Richard K. Thomson1, Angela Hamblin1 Susan D. Richards2, J. Gordon Lindsay2 and Freda K. Stevenson1 1

Molecular Immunology Group Southampton University Hospitals Trust, Tenovus Laboratory, Southampton SO16 6YD, UK 2 Institute of Biomedical & Life Sciences, Division of Biochemistry and Molecular Biology, University of Glasgow Glasgow, Scotland, G12 8QQ UK

Primary biliary cirrhosis (PBC) is a liver disease characterized by serum autoantibodies against the pyruvate dehydrogenase complex (PDC) located in the inner mitochondrial membrane. The predominant target in PDC has previously been localized to the inner lipoyl domain (ILD) of the E2 subunit. The etiology of PBC is unknown, although molecular mimicry with bacterial PDC has been proposed. Here, we have investigated the etiology of PBC and nature of the autoimmune response by analyzing the structure of a human monoclonal antibody with ILD speci®city. Mutants of the monoclonal antibody, which was originally isolated from a patient with PBC, were expressed as Fab by phage display, and tested for reactivity against recombinant domains of the E2 subunit. Fab in which the VH-encoded portions were reverted to germline lost reactivity against the ILD alone, but recognized a different epitope in a didomain construct encompassing the ILD, hinge region and E1/E3 binding domain. The complete VH and VL germline revertant was unreactive with the human ILD and didomain, the Escherichia coli didomain, and whole PDC. We hypothesize that the IgM on the surface of the naõÈve B-cell ®rst recognizes an as yet unidenti®ed antigen, and that accumulation of somatic mutations results in an intermolecular epitope shift directed towards an epitope involving the E1/E3 binding domain. Further mutations result in the speci®city being redirected to the ILD. These ®ndings also suggest that bacterial molecular mimicry is not involved in initiating disease. # 2001 Academic Press

*Corresponding author

Keywords: autoimmune disease; autoantibodies; germline revertant; V-genes; epitope spreading

Introduction Primary biliary cirrhosis (PBC) is a chronic autoimmune liver disease characterized by the destruction of the small intrahepatic bile ducts leading to cirrhosis and death from portal hypertension or liver failure (reviewed by Leung et al., 1996). The etiology of the disease is unknown, but is conAbbreviations used: PBC, primary bilary cirrhosis; PDC, pyruvate dehydrogenase complex; PDC-E2, E2 subunit of PDC; ILD, inner lipoyl domain; AMA, antimitochondrial antibodies; 2-OADC, 2-oxacid dehydrogenase complex; E3BP, E3 binding protein; BEC, biliary epithelial cells; mAb, monoclonal antibodies; GST, glutathione S-transferase. E-mail address of the corresponding author:[email protected] 0022-2836/01/010037±10 $35.00/0

sidered an autoimmune disease due to oligoclonal T-cell in®ltration surrounding the bile ducts (Jones, 1996), a polyclonal increase in serum IgM, and the characteristic presence of anti-mitochondrial antibodies (AMA) which are found in the sera of over 95 % of PBC patients (Gershwin & Mackay, 1991). Immunoblotting with patient sera demonstrated AMA binding to a range of mitochondrial antigens belonging to the 2-oxoacid dehydrogenase complexes (2-OADC) (Gershwin et al., 1987; Coppel et al., 1988; Fussey et al., 1988; Yeaman et al., 1988). These complexes are ubiquitous, being present in all species from bacteria to mammals. The major AMA target autoantigen is the E2 subunit of the pyruvate dehydrogenase complex (PDC-E2; Surh et al., 1990; Fussey et al., 1989). PDC-E2 is composed of four contiguous domains: an outer lipoyl # 2001 Academic Press

38 domain, an inner lipoyl domain (ILD), the E1/E3 binding domain, and the catalytic/E2 binding domain. (Coppel et al., 1988; Thekkumkara et al., 1988). The three-dimensional structure of human PDC-E2 ILD, as resolved by nuclear magnetic resonance spectroscopy (Howard et al., 1998), indicates that the ILD has the fold of a ¯attened b-barrel comprising two antiparallel b sheets, each of which contains three major strands and one minor strand. Lipoic acid is a hapten-like cofactor covalently attached within the mitochondria to a speci®c lysine residue in both the outer and inner lipoyl domains, and is essential for normal enzyme function (Fujiwara et al., 1992; Grif®n & Chuang, 1990). In the three-dimensional structure, the lipoyl-lysine residue is in the exposed position of a b-turn, and does not signi®cantly alter the peptide conformation of this region (Dardel et al., 1993). Uniquely, mammalian PDC contains an additional lipoyl domain-bearing polypeptide, originally termed protein X, now renamed the E3 binding protein (E3BP). Three autoreactive determinants were detected on PDC-E2 using patient polyclonal sera against recombinant fragments of human PDC-E2 expressed in Escherichia coli: the two cross-reactive lipoyl domains, which are 64 % homologous, and an area surrounding the E1/E3 binding site (Surh et al., 1990). More recently the identi®cation of target epitopes has been characterized using human monoclonal antibodies (mAb) against puri®ed mitochondrial antigens, synthetic peptides (Matsui et al., 1993) and recombinant fragments of PDC-E2 (Leung et al., 1992). The mAb also recognized distinct epitopes within the inner and outer lipoylbinding domains of PDC-E2. AMA from patient sera characteristically inhibit the catalytic activity of PDC (Uibo et al., 1990), whereas rabbit antibodies induced following immunization with PDC-E2 (Rowley et al., 1992) and naturally occurring human IgG anti-PDC-E2 antibodies found in healthy persons do not (Chen et al., 1998). Therefore, there is the indication that disease-relevant autoepitopes are involved in inducing disease-associated autoantibodies (Surh et al., 1990; Rowley et al., 1992). Some of the main unanswered questions in PBC involve explaining how a protein complex like PDC, which is located in the inner mitochondrial membrane of every cell, becomes exposed to the immune system and induces an immune response, and why the tissue destruction is speci®c for the biliary epithelial cells (BEC). Van de water et al. (1993) proposed that only BEC have a molecule cross-reactive with PDC-E2 which is overexpressed and present on the cell surface. Presentation by MHC proteins would engage both CD4‡ and CD8‡ lymphocytes. Damage would be con®ned to the BEC as these are the only cells producing a cell surface form of the initiating antigen. In addition, anti-PDC-E2 IgA is detected in the bile of patients with PBC, but not healthy controls. It is postulated that this IgA could potentially react intracellularly

Epitope Spreading in Primary Biliary Cirrhosis

with proteins in the BEC cytoplasm, causing metabolic imbalance and cell death. We previously reported the production of ®ve patient-derived hybridomas (four IgG/l and one IgM/l) secreting hypermutated monoclonal antibodies (mAb) with PDC-E2 speci®city (Thomson et al., 1998). Reactivity with PDC-E2 by all ®ve was preferentially to the lipoylated form of the antigen, with 2/4 IgG mAb requiring lipoylation for recognition. While the IgG mAb also bound the E3BP (protein X) component of PDC, they did not bind other self-antigens in a selected panel of common antigens. The IgM mAb, however, did also bind other self-antigens. The combination of developments involving the expression of mAb as Fab on the surface of bacteriophage (Hoogenboom et al., 1991; Chapman et al., 1993) and the production of separate recombinant human PDC-E2 domains in E. coli (Grif®n & Chuang, 1990) makes it possible to de®ne not only the reactive antigen epitopes, but also to determine the relevant antibody structures involved in binding these epitopes. Here, we have combined the production of mutant PDC-E2 speci®c Fabs with the production of recombinant human PDC-E2 domains in E. coli to investigate which variable domain regions of the mAb PD2 (IgG2/l) are critical in determining PDC-E2 ILD speci®city. The DNA sequences encoding the variable domain of PD2 were also reverted to germline to determine the characteristics of the B-cell prior to undergoing somatic mutation. We present evidence that the target antigen in PBC is not the inducing antigen, and that change in epitope speci®city occurs during the af®nity maturation of the autoimmune response.

Results Determination of somatic mutations in mAb PD2 mAb PD2 is encoded by the V3-21 (95.2 % homology) and the Vl3l (96.2 % homology) gene segments (Thomson et al., 1998). Amino acid sequences of the mutated parental PD2 heavy and light chains compared with their corresponding germline sequences are shown in Figure 1. The mAb PD2 VH-encoded portion of the heavy chain contains seven replacement mutations (one in FR, one in CDR1, and ®ve in CDR2), and ®ve silent mutations. The VL-encoded portion of the light chain has six replacement mutations (one in FR1, one in FR2, two in FR3 and two in CDR3) and two silent mutations in CDRL3. The W at the VL-JL junction is regarded as the product of DNA junctional diversity and not hypermutation. In order to determine whether the two amino acid residue changes (N to D at position 89 and G to A at position 95a) in the l light-chain CDR3 were the result of hypermutation, or indications of a polymorphic germline gene segment, genomic DNA from the patient blood lymphocytes was used as template to

Epitope Spreading in Primary Biliary Cirrhosis

39

Figure 1. Amino acid sequences of mAb PD2 heavy and light chains. The heavy and light-chain sequences are compared with their germline donors. Dashes indicate identity; replacement mutations are in upper case and silent mutations at the DNA level are indicated in lower case. The CDR3 sequence from antibody 360 is shown as well as the light-chain germline sequence from antibody MG382.

amplify the germline Vl3l gene segment by PCR. The sequence of the PCR product extending from FR1 to the heptamer-nonamer region indicated that the D and A residues are not present in the germline sequence (data not shown), and hence residues D and A are the product of hypermutation and not a new germline gene. Mutated parental PD2 Fab retains the binding specificity of the parental mAb mAb PD2 has previously been reported as reactive for lipoylated recombinant human PDC-E2 ILD and the E3BP, while unreactive with recombinant human unlipoylated PDC-E2 ILD (Thomson et al., 1998). It was necessary to validate that the recombinant Fab had the same reactivity pattern as the parental mAb. The notation used for the Fab constructs indicate the heavy (H) chain on the left

and the light (L) chain on the right separated by a dash; the H chain is separated into VH-encoded regions (FR1-FR3) and D-encoded region (CDRH3) separated by a dot, and the L chain is separated into VL-encoded regions (FR1-FR3) and the VL-encoded CDRL3 separated by a dot. Hypermutated parental PD2.PD2-PD2.PD2 Fab bound the recombinant didomain and the recombinant PDC-E2 lipoylated ILD, but not the unlipoylated mutant form of the ILD (Table 1 and Figure 2). These data con®rm that the ILD is a target of the Fab speci®city, and that the lipoyl group is an integral part of the antigenic epitope in the ILD. These data demonstrate that the reactivity of the parental PD2 Fab is the same as that of the parental PD2 mAb. None of the Fab constructs bound either the recombinant E. coli didomain nor the empty vector E. coli extract (Table 1), indicating that there is no cross-reactivity with E. coli-derived PDC.

40

Epitope Spreading in Primary Biliary Cirrhosis

Table 1. Reactivity of parental PD2 and Fab constructs with native and recombinant antigens

Heavy chain VH is responsible for ILD specificity When the seven VH gene segment-encoded replacement mutations were reverted to germline, the GL.PD2-PD2.PD2 Fab still bound the PDC-E2 didomain (Figure 2), although the absorbance levels were consistently slightly lower using multiple preparations under the same conditions compared with the binding of the parental PD2.PD2-PD2.PD2 Fab. These data suggest that GL.PD2-PD2.PD2 has a lower af®nity for its epitope than PD2.PD2-PD2.PD2 has for its epitope. GL.PD2-PD2.PD2 Fab, however, completely lost reactivity to the ILD (Figure 2). It would appear that the reactivity of the VH revertant with the PDC-E2 didomain was the result of binding to an epitope involving the E1/E3 binding domain and potentially the linker region as well. When the recombinant E1/E3 binding domain (Q (Gln) 248 to D (Asp) 306) was tested with the VH revertant, there was no reactivity by ELISA. This result suggests that the reactive epitope involved comprises more than the E1/E3 binding domain alone. However, the accumulation of VH mutations results in an acquisition of reactivity to a lipoylated epitope in the ILD. The heavy chain CDR3 is critical to ILD binding The role of the PD2 H chain CDR3 in determining antigen speci®city was tested by replacing the mutated parental CDRH3 with the mAb 360 sequence to generate PD2.360-PD2.PD2. The mAb 360 CDRH3 sequence is 17 amino acid residues long compared with the 22 residues of mAb PD2 (Table1), and there is no sequence homology

between the two D gene segment-encoded portions of the CDRH3 sequences. PD2.360-PD2.PD2 Fab did not react with the PDC-E2 didomain, the lipoylated ILD, or the non-lipoylated form of the ILD (Table 1). This indicates that the single replacement mutation in CDR1 and the ®ve replacement mutations in CDR2 are not suf®cient to mediate binding in the absence of a speci®cally selected CDR3 sequence. These data demonstrate that CDRH3 is critical for ILD binding. Light chain VL encoded FR1-FR3 mutations do not alter ILD binding Fab PD2.PD2-GL.PD2, in which only the VL-encoded FR1-FR3 was reverted to germline, bound the PDC-E2 ILD (Figure 2). This speci®city was the same as that of parental PD2.PD2PD2.PD2, albeit with a small decrease in binding. This indicates that the four replacement mutations located in FR1, FR2 and FR3 in the VL domain (Figure 1) may in¯uence the af®nity of binding, but did not signi®cantly in¯uence the speci®city of the antibody. Light chain CDR3 is critical to ILD binding The entire light chain was reverted to germline when, in addition to reverting the FR1-FR3 portion, the two mutations at positions 89 and 95a in the CDRL3 were also reverted to germline sequence. The binding of Fab PD2.PD2-GL.GLW to the ILD and the didomain was signi®cantly reduced (Figure 2). These data indicate that ef®cient lipoylated ILD binding is dependent on the structure of the light chain CDR3, even in the presence of a parental CDRH3.

Epitope Spreading in Primary Biliary Cirrhosis

41

Figure 2. Reactivity of mutant parental PD2 Fab and revertants against recombinant antigens PDC-E2 didomain, ILD and unlipoylated ILD, and whole bovine PDC. Fab FIF.17B (*) is the negative Fab control. Mutations in the Fab constructs are indicated by vertical bars. The heavy chain CDR3 ( & ), light chain CDR3 ( ), PD2.PD2-PD2.PD2 (^), GL.PD2.PD2.PD2( & ), PD2.PD2-GL.PD2 (), PD2.PD2-GL.GLW(~) are shown.

Complete germline revertant Fab of mAb PD2 does not bind the ILD The GL.PD2-GL.GLW Fab effectively is the germline revertant of mAb PD2, and represents the immunoglobulin on the surface of naõÈve B-cells that would have interacted with the initiating antigen. In these constructs, the heavy chain retained the parental CDRH3, even though it is unknown whether there are somatic mutations in this subregion as it was impossible to determine D gene segment usage. The germline revertant did not bind the human PDC-E2 didomain or ILD, E. coli PDCE2 didomain or whole bovine PDC (Table 1). These data demonstrate that the germline revertant GL.PD2-GL.GLW does not interact with any conformational determinant in the whole PDC complex, and does not cross-react with any epitope in the E. coli PDC-E2 didomain.

Discussion Central to the understanding of PBC as an autoimmune disease is the nature of the antigen involved in breaking tolerance to the PDC-E2 selfantigen. Tolerance per se is not complete, as low levels of IgG antibodies with PDC-E2 speci®city are present in all healthy human sera (Chen et al., 1998). These antibodies preferentially react with

the immunodominant ILD of PDC-E2, although there is evidence for differences in ®ne epitope recognition compared with antibodies isolated from patients with PBC. In addition, natural PDC-E2speci®c IgG fail to inhibit the catalytic activity of PDC, a characteristic of PBC sera. In patients with PBC, high levels of anti-PDC-E2 autoantibodies are induced. It is not known if these antibodies are pathogenic, although it has been postulated that IgA anti-PDC-E2 antibodies may function intracellularly in biliary duct epithelial cells of patients with PBC (Van de Water et al., 1993). In order to elucidate the etiology of PBC and further investigate the role of AMA in primary biliary cirrhosis, we undertook a structure/function study in which the structural contribution of amino acid residues in mAb PD2 to PDC-E2 ILD speci®city was investigated. We hypothesized that by knowing the details of the interaction between PDC-E2 antigen using both the mutated and germline-encoded forms of the autoantibody, we would be able to deduce the events that occurred during the immune response that led to the selection of the mutated parental PD2 antibody, and provide evidence as to whether PDC-E2 is the immunogen which induced the AMA response. We initially determined that PD2 expressed as Fab on the surface of fd phage had the same reactivity as the parental mAb. Previous data indicated

42 that the IgG2/l mAb PD2 speci®cally bound lipoylated, but not unlipoylated, PDC-E2 inner lipoyl domain (Thomson et al., 1998). mAb PD2 has been shown to bind only to the E2 and E3BP (protein X) components of PDC, giving negative results when tested for binding to rabbit IgG, thyroglobulin, tetanus toxoid, double-stranded DNA and collagen (Thomson et al., 1998). The details of the cross-reactivity with E3BP are currently under investigation. mAb PD2 binds human PDC-E2 with a dissociation constant of 1.73  10ÿ10, and inhibits the catalytic function of PDC in vitro (Thomson et al., 1998). Both speci®city for PDC and the inhibition of PDC catalytic function are characteristics of ``pathogenic'' antibodies found in patient sera (Uibo et al., 1990; Rowley et al., 1992). mAb PD2 also gave the characteristic ``M2`` mitochondrial immuno¯uorescence pattern in rat renal tubule cells and Hep2 cells (Thomson et al., 1998). The reactivities of PD2 expressed as Fab shown in Figure 2 demonstrate that the PD2 Fab has speci®city for the lipoylated inner lipoyl domain, and does not bind the non-lipoylated form of the ILD. This con®rmed that the PD2 Fab was equivalent to the parental mAb PD2, and hence, mutant Fabs would yield reactivity data comparable to using whole antibodies. Intermediately mutated Fabs were generated to provide information on amino acid residues critical for PDC-E2 ILD antigen binding. Removal of somatic mutations from the PD2 VH gene segment resulted in mutant GL.PD2-PD2.PD2 binding the didomain but not the ILD (Figure 2). Thus, removal of the VH-encoded mutations results in a shift of speci®city from the ILD alone to include a segment of the E2 polypeptide containing the adjacent linker region and E1/E3 binding domain. It is evident that in vivo the VH-encoded mutations are responsible for directing the antibody speci®city to the ILD. It is interesting to note that ®ve out of the seven VH replacement mutations are in CDR2, although as shown in Table 1, these mutations in the absence of a speci®c CDRH3 sequence (PD2.360-PD2.PD2) are not suf®cient to mediate ILD binding. Interestingly, puri®ed E1/E3 binding domain expressed as a glutathione S-transferase (GST) fusion protein did not elicit a positive response in ELISA when probed with GL.PD2-PD2.PD2 (Table 1). The correct folding of this construct in the context of ELISA is undetermined. At present, therefore, the precise speci®city of the mutant Fab GL.PD2-PD2.PD2 remains to be determined. Production of a series of intermediate constructs should aid in ``mapping'' the critical antigen determinants required for the recognition by GL.PD2-PD2.PD2. Exchange of the PD2 heavy-chain CDR3 with the CDR3 sequence from the non-related antibody 360 (Zhu et al., 1999) resulted in complete absence of binding to the didomain and the ILD (Table 1). This indicates that the CDR3 is critical to the speci®city of the antibody, and that the lipoylated epi-

Epitope Spreading in Primary Biliary Cirrhosis

tope is interacting with the antibody in a conventional manner and not in a superantigen fashion involving only framework regions (Potter et al., 1997). Con®rmation of the contact residues will be determined following X-ray crystal structure analysis. An examination of the monoclonal antibodies generated from patients with PBC indicates that there is a preponderant usage of lambda light chains in IgG antibodies with PDC-E2 speci®city. It is not exclusive, however, as two reported IgM mAb (Pascual et al., 1994), and one IgG mAb (Chen et al., 1998) were associated with kappa light chains. We have demonstrated here that the mutations in VL-encoded FR1-FR3 do not effect antigen speci®city (Figure 2), while it is the sequence of the light-chain CDR3 that in¯uences antigen binding (Figure 2), even when the constant region is lambda. We used the speci®city of a germline revertant PD2 Fab to determine whether anti-PDC-E2 antibodies with ILD speci®city had been selected from the somatically mutated IgG memory B-cell pool produced in response to unspeci®ed antigens, or whether these autoantibodies are the products of PDC-E2-driven responses involving af®nity maturation and class-switch processes similar to those in response to exogenous antigens. Since the germline genes for both the heavy and light chains are known, the mutated residues can be identi®ed. By engineering the germline revertant sequence of the mutated parental PD2, the immunoglobulin structure on the surface of the naõÈve B-cell that initially interacted with the triggering antigen was recreated. The only caveat is that we do not know whether the heavy-chain CDRH3 has acquired mutations. We tested the ®ne speci®city of the germline revertant Fab against several recombinant antigens including the didomain, the ILD and whole bovine PDC (Table 1). Germline revertant Fab GL.PD2-GL.GLW did not bind any of the recombinant domain antigens or the whole bovine PDC. The Ig on the surface of the B-cell with which endogenous PDC-E2 interacted, therefore, could not have been germline encoded, but was already mutated, suggesting that the PDC-E2 interacted with a B-cell from the memory cell pool that was generated during a response to an unidenti®ed initiating antigen. It appears from the lack of reactivity of the complete germline revertant with human PDC-E2 ILD and didomain, E. coli PDC-E2 didomain and whole bovine PDC that neither human nor bacterial PDCE2 are the inducing antigens in PBC. This refutes the previous suggestion that molecular mimicry between microbial and human PDC-E2 is an initiating factor in PBC (Butler et al., 1993). The data suggest that epitope spreading from a currently unidenti®ed inducing antigen is involved in the development of autoantibodies in PBC. The shift in focus of the immune response to PDC-E2 may have ®rst occurred with the acquisition of speci®city for an epitope involving the E1/E3 binding

43

Epitope Spreading in Primary Biliary Cirrhosis

domain. However, with both silent and replacement mutations simultaneously occurring on both heavy and light chains, and possibly during several rounds of germinal center reactions, it is impossible to recreate the exact order of replacement amino acid residue accumulation in mAb PD2 as it occurred naturally. Following an initial intermolecular epitope shift directed towards an epitope involving the E1/E3 binding domain, an intramolecular epitope shift occurred, possibly with the acquisition of the CDRH2 mutations, with the speci®city ®nally directed towards the ILD. We hypothesize that the speci®city of IgG autoantibodies in PBC for PDC-E2 ILD is reached by a hierarchial mutation-dependent series of steps in both heavy and light chains from the original naõÈve B-cell. This suggests that PDC-E2 ILD interacts with memory B-cells which display mutated immunoglobulin on their surface. The mechanism involved in the intramolecular epitope shift most likely involves B-cells as antigen-presenting cells (Mamula, 1998). It is reported that the ®ne speci®city of surface immunoglobulin can directly in¯uence the particular peptide transported to the B-cell surface for interaction with T-cells (Davidson and Watts, 1989). It appears, therefore, that autoimmune response to different epitopes in PBC is likely not due to individual responses to each peptide, but rather is a response which originates with a single epitope with the capability of intramolecular shifting. One can speculate that the original PDC-E2 epitope is perhaps at the junction of the ILD and E1/E3 binding domains, which leads to the epitope shift to the adjacent inner lipoyl domain. Whether AMA are simply an epiphenomenon or if they make a pathogenic contribution to PBC remains to be seen, but their extraordinary speci®city indicates it is very likely they are related to the pathogenesis of PBC. The results presented here have profound implications on our view of the PBC trigger antigen. The identity of the trigger antigen will provide valuable information in the understanding of the etiology of PBC. The speci®city of the germline revertant is currently under investigation.

Materials and Methods Antibody genes PD2 is an IgG2/l mAb isolated from the peripheral blood of a patient with advanced PBC, as described (Thomson et al., 1998; EMBL accession numbers AJ001168 and AJ001173). Dr A. Thompsett kindly provided the heavy-chain CDR3 template for 360, isolated from a patient with a splenic B-cell lymphoma (Zhu et al., 1999). The germline-encoded Vl3l-Jl2 light chain (LV4CE51; MG382, accession number L35918), derived from an IgM rheumatoid factor, was a kind gift from Dr A. Solomon, described (Eulitz et al., 1995). The negative control Fab, FIF.17B, is encoded by a V4-34 heavy chain derived from a cold agglutinin paired with a VkIIIb light chain from an IgM mAb of unknown speci®city derived from

a patient with infectious mononucleosis (Mockridge et al., 1996). The amino acid sequences are shown in Figure 1. Construct assembly Immunoglobulin heavy (H) and light (L) chain genes were cloned into the phagemid vector pHEN1 as a S®INotI fragment for expression as Fab fragments on the surface of bacteriophage fd. VH domains are contained within a S®I-BstEII fragment, and complete L chains are contained with a SacI-NotI fragment. VH and L chains, therefore, can be exchanged in this cassette system to produce different Fabs. L chains were expressed as fusion proteins covalently linked to the N terminus of the gene 3 protein via a c-myc linker. DNA segments encoding VL and Cl domains were joined by PCR-SOEing (Horton et al., 1989). Removal of parental PD2 mutations was done by PCR mutagenesis (Ho et al., 1989). The oligomer sequences for the PCR reactions are shown in Table 2. Gene sequences were con®rmed on DNA isolated from single colonies using dideoxy chaintermination sequencing (Sanger et al., 1980) using an automated sequencer (ABI PrismTM). Growth and expression of phage Fab fragments Fab expression is under the control of the lacZ promoter that is suppressed by the addition of glucose to the culture medium. The Fab constructs were transformed into competent E. coli TG1. Single colonies were inoculated into 25 ml of 2  YT broth supplemented with 100 mg ml ampicillin and 1 % (w/v) glucose and grown at 37  C to an A600 of between 0.5 and 1.0. VCS interference resistance helper phage (Stratagene, Cambridge, UK) containing a kanamycin-resistance gene was added to a ®nal concentration of 109 pfu/ml. The medium was replaced with 2  YT supplemented with 100 mg/ml ampicillin and 25 mg/ml kanamycin without glucose, and the culture was incubated overnight at 30  C. Phage was concentrated and puri®ed by two rounds of precipitation with polyethylene glycol 6000 and resuspended in 1 ml of phosphate-buffered saline (PBS). Recombinant PDC-E2 domains The initial PCR ampli®cation of E2 didomains was performed using (a) the original pHUMIT plasmid, containing the entire human E2 gene (which was kindly provided by Dr Eric Gershwin, University of California at Davis) and (b) the E. coli aceF gene cloned into plasmid pGS623 (kindly provided by Professor J. R. Guest, University of Shef®eld). The human E2 didomain construct encompassed the region S (Ser) 128 to D (Asp) 306, whereas the equivalent region of E. coli E2 encompassed V (Val) 221 to I (Ile) 369. Human ILD, both wildtype and mutant, encodes S (Ser) 128 to K (Lys) 229. The human E1/E3 binding domain is Q (Gln) 248-D (Asp) 306. The authenticity of the ampli®ed sequences in these recombinant vectors was con®rmed using an automated ABI sequencing system at the University of Glasgow. Primers were designed so as to permit directional cloning into the BamHI and EcoRI sites of the plasmid pGEX-2T which permits expression of the recombinant polypeptide as a glutathione S-transferase (GST) fusion protein. Recombinant plasmids were isolated following transformation of E. coli DH5 alpha, and subsequently expressed in E. coli BL21 (DE3).

44

Epitope Spreading in Primary Biliary Cirrhosis

Cultures (50 ml) grown at 37(C were induced by the addition of 1 mM IPTG after reaching an A600 of approximately 0.5. Growth was continued for a further three hours before harvesting by centrifugation at 5000 g for 15 minutes at 4  C. Pellets were resuspended in 3.5 ml of phosphate-buffered saline (PBS), 0.15 M NaCl in 20 mM sodium phosphate buffer (pH 7.5) prior to sonication (4  C, 4  10 second bursts at one minute intervals, at 60 mA (Vibracell Soniprobe, Jencons Scienti®c Ltd., UK). The resultant sonicate was supplemented with 0.2 % (v/v) Triton X-100 and stirred once for 30 minutes prior to centrifugation at 14,000 g for ten minutes at 4  C. Empty vector lysates were prepared as a negative control. Puri®cation of the GST fusion protein was performed according to the manufacturer's instructions (Pharmacia, UK). Brie¯y, the ®nal supernatant was passed down a 2  1 ml glutathione-Sepharose 4B column pre-equilibrated in PBS and then speci®cally eluted in 10 mM reduced glutathione, 50 mM Tris-HCl (pH 8.0). Fractions (1 ml) were collected, and aliquots (20ml) analyzed for purity of the eluted fusion protein by SDS-PAGE. Puri®ed GST-didomains were pooled, dialyzed into PBS and concentrated using PEG 6000. The recombinant domains are shown in Table 1. These include the PDC-E2 didomain (ILD, hinge region plus E1/E3 binding domain), the ILD as a monodomain, the non-lipoylated ILD (due to a K (Lys) to E (Glu) mutation at residue 173), and the E. coli didomain. The K to E mutation was carried out using PCR site-directed mutagenesis. Quantitative ELISA to measure the level of phage-expressed Fab ELISA wells (Nunc maxisorb) were coated with 200ml of anti-Fdg capture antibody at a concentration of 10 mg/ ml in NaHCO3/Na(CO3)2 (pH 9.5) coating buffer. The wells were blocked with 4 % (w/v) skimmed milk powder (Marvel)/PBS/Tween 20 for one hour, at 37  C on a plate shaker (DPC Micromix 5TM). The wells were emptied and the plates washed four times with PBS/T. Test phage were serially two-fold diluted starting at 1:50 in 4 % milk/PBS/T. A standard phage of known concentration was diluted in 4 % milk/PBS/T to a concentration of 500 pg/ml, and serially twofold diluted. The plates were incubated for one hour at 37  C on a plate

shaker, then washed four times with PBS/T. A 200 ml volume of biotinylated anti-phage (Sigma, Poole, UK) diluted 1:1000 in 2 % milk/PBS/T was added to the wells and incubated for 0.5 hour with shaking at 37  C. The wells were washed four times with PBS/T, and streptavidin-HRP diluted 1:8000 in PBS/T was added to each well. The plates were incubated, without shaking, for 0.5 hour at 37  C, washed, and ortho-phenylenediamine (OPD) substrate (Sigma) added. The reactions were stopped with 80 ml/well 5 M sulfuric acid, and the absorbance values were read in an ELISA plate reader (Dynex) at 490 nm. This capture assay detects only combined VH-VL Fab molecules, and does not detect non-Fab-expressing phage.

Antigen-specific qualitative ELISA ELISA plates were coated with 200 ml/well of overexpressed bacterial lysates diluted in NaHCO3/Na(CO3)2 (pH 9.5) coating buffer overnight at 4  C at concentrations of 5mg/ml. Unbound antigen was discarded and the plates were blocked with 4 % milk/PBS/T and washed as described above. Phage were diluted in 4 % milk/PBS/T to a Fab concentration of 500 pg/ml and serially twofold diluted. Positive and negative Fab controls were tested on each plate, and uncoated wells were used to control for non-speci®c binding of Fab to the plastic. All tests were done in triplicate. Test Fab and positive and negative control ELISAs were performed as described for the quantitative ELISA.

Isolation of genomic DNA Genomic DNA was isolated from approximately 106 lymphocytes from patient PD using the Wizard genomic DNA puri®cation kit following the manufacturer's instructions (Promega). Unrearranged germline Vl31 sequences were ampli®ed using a FR1 primer (50 ATTTCTTCTGAGCTCACTCAGGACCCTGCT 30 ) and a heptamer-nonamer speci®c primer (50 CACAGTGACACAGGCAGATGCGGAAGTGAGACAGAAACCAGCCACCTCGGCCTGGCTCAC 30 ). The PCR products were gel puri®ed and sequenced as previously described.

Table 2. Oligomer sequences used in PCR reactions Primer Name

Sequence (50 !30 )

HVH Sfi Cg100 PD2CDR3 30 PD2CDR3 50 360 b 360 c 360 d FW1 Sac 50 PD2FW3 PD2CDR3 30 Jl2/Cl Cl30 Cl50 Not MG382FW3 MG382CDR3 CDR3W 50 CDR3W Cl

TCGCGGCCCAGCCGGCCATGGCCGAGGTGCAGCTGGTGGAG CACCGTCACCGGTTCGG CACTGCCCCGACCTGATACTCTCGCACAGTAATACACAGC GTATCAGGTCGGGGCAGTG AAAAATCGTATGCATCCTGAGTTCTCGCACAGTAATAAACAGC ACTCAGGATGCATACGATTTTT TGAGGAGACGGTGACCGTG ATTTCTTCTGAGCTCACTCAGGACCCTGCT CACTGCTGTCCCGGGAGTTACAGAAATAGTCAGCCTCATC GACTCCCGCGACAGCAGTG GGTGGCCTTGGGCTGACCTACGACGGTCAGCTTGGTCC GGTCAGCCCAAGGCCACC GCATGCATGCGGCCGCTGAACATTCTGCAGGGGCCA ACTGCTGTCGCGGGAGTCACAGTAATAGTCAGCCTCATC AACTCCCGGGACAGCAGTG CCGAATACCCAATGGTTACCACT AGTGGTAACCATTGGGTATTCGG

Epitope Spreading in Primary Biliary Cirrhosis

Acknowledgements We acknowledge Zadie Davis for DNA sequencing.

References Butler, P., Valle, F., Hamilton-Miller, J. M., Brum®tt, W., Baum, H. & Burroughs, A. K. (1993). M2 mitochondrial antibodies and urinary rough mutant bacteria in patients with primary biliary cirrhosis and in patients with recurrent bacteriuria. J. Hepatol. 17, 408-414. Chapman, C. J., Spellerberg, M. B., Smith, G. A., Carter, S. J., Hamblin, T. J. & Stevenson, F. K. (1993). Autoanti-red cell antibodies synthesized by patients with infectious monocuclesis utilize the V4-21 gene segment. J. Immunol. 151, 1051-1061. Chen, Q. Y., Mackay, O. R., Fida, S., Myers, M. A. & Rowley, M. J. (1998). Natural and disease associated autoantibodies to the autoantigen, dihydrolipoamide acetyltransferase, recognize different epitopes. J. Autoimmun. 11, 151-161. Coppel, R. L., McNeilage, L. J., Surh, C. D., Van de Water, J., Spithill, T. W., Whittingham, S. & Gershwin, M. E. (1988). Primary structure of the human M2 mitochondrial autoantigen of primary biliary cirrhosis: dihydrolipoamide acetyltransferase. Proc. Natl Acad. Sci. USA, 85, 8654-8658. Dardel, F., Davis, A. L., Laue, E. D. & Perham, R. N. (1993). Three-dimensinal structure of the lipoyl domain from Bacillus stearothermophilus pyruvate dehydrogenase complex. J. Mol. Biol. 229, 1037-1048. Davidson, H. W. & Watts, C. (1989). Epitope directed processing of speci®c antigen by B lymphocytes. J. Cell. Biol. 109, 85-90. Eulitz, M., Ch'ang, L. Y., Zirkel, C., Schell, M., Weiss, D. T. & Solomon, A. (1995). Distinctive serologic, chemical, and molecular properties of human lIV light chains. J. Immunol. 154, 3256-3265. Fujiwara, K., Okamura-Ikeda, K. & Motokawa, Y. (1992). Expression of mature bovine H-protein of the glycine cleavage system in Escherichia coli and in vitro lipoylation of the apoform. J. Biol. Chem. 267, 20011-20016. Fussey, S. P. M., Guest, J. R., James, O. F. W., Bassendine, M. F. & Yeaman, S. J. (1988). Identi®cation and analysis of the major M2 autoantigens in primary biliary cirrhosis. Proc. Natl Acad. Sci. USA, 85, 8654-8658. Fussey, S. P. M., Bassendine, M. F., James, O. F. M. & Yeaman, S. J. (1989). Characterization of the reactivity of autoantibodies in primary biliary cirrhosis. FEBS Letters, 246, 49-53. Gershwin, M. E. & Mackay, I. R. (1991). Primary biliary cirrhosis: paradigm or paradox for autoimmunity. Gastroenterology, 100, 822-833. Gershwin, M. E., Mackay, I. R., Sturgess, A. & Coppel, R. L. (1987). Identi®cation and speci®city of a cDNA encoding the 70 kd mitochondrial antigen recognized in primary biliary cirrhosis. J. Immunol. 138, 3525-3531. Grif®n, T. A. & Chuang, D. T. (1990). Genetic reconstruction and characterisation of the recombinant transketolase (E2b) component of bovine branchedchain a-keto acid dehydrogenase complex. J. Biol. Chem. 265, 13174-13180.

45 Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K. & Pease, L. R. (1989). Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene, 77, 51-99. Hoogenboom, H. R., Grif®ths, A. D., Johnson, K. S., Chiswell, D. J., Hudson, P. & Winter, G. (1991). Multi-subunit proteins on the surface of ®lamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucl. Acids Res, 19, 41334137. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K. & Pease, L. R. (1989). Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene, 77, 61-68. Howard, M. J., Fuller, C., Broadhurst, R. W., Perham, R. N., Tang, J-G., Quinn, J., Diamond, A. G. & Yeaman, S. J. (1998). Three-dimensional structure of the major autoantigen in primary biliary cirrhosis. Gastroenterology, 115, 139-146. Jones, D. E. J. (1996). T-cell autoimmunity in primary biliary cirrhosis. Clin. Sci. 91, 551-558. Leung, P. S. C., Krams, S., Munoz, S., Surh, C. P., Ansari, A., Kenny, T., Robbins, D. L., Fung, J., Starzl, T. E. & Maddrey, W. (1992). Characterization and epitope mapping of human monoclonal antibodies to PDC-E2 the immunodominant autoantigen of primary biliary cirrhosis. J. Autoimmun. 5, 703-718. Leung, P. S. C., Van de Water, J., Coppel, R. L., Nakanuma, Y., Munoz, S. & Gershwin, M. E. (1996). Molecular aspects and the pathological basis of primary biliary cirrhosis. J. Autoimmun. 9, 119128. Mamula, M. J. (1998). Epitope spreading: the role of self peptides and autoantigen processing by B lymphocytes. Immunol. Rev. 164, 231-239. Matsui, M., Nakamura, M., Ishibashi, H., Koike, K., Kudo, J. & Niho, Y. (1993). Human monoclonal antibodies from a patient with primary biliary cirrhosis that recognize two distinct autoepitopes in the E2 component of the pyruvate dehydrogenase complex. Hepatology, 18, 1069-1077. Mockridge, C. I., Chapman, C. J., Spellerberg, M. B., Isenberg, D. A. & Stevenson, F. K. (1996). Use of phage surface expression to analyze regions of a human V4-34 (VH 4-21)-encoded IgG autoantibody required for recognition of DNA. No involvement of the 9G4 idiotope. J. Immunol. 157, 2449-2454. Pascual, V., Cha, S., Gershwin, M. E., Capra, J. D. & Leung, P. S. C. (1994). Nucleotide sequence analysis of natural and combinatorial anti-PDC-E2 antibodies in patients with primary biliary cirrhosis. Recapitulating immune selection with molecular biology. J. Immunol. 152, 2577-2585. Potter, K. N., Li, Y.-C., Pascual, V. & Capra, J. D. (1997). Staphylococcal protein A binding to VH3 encoded immunoglobulins. Int. Rev. Immunol. 14, 291-308. Rowley, M. J., Maeda, T., Mackay, I. R., Loveland, B. E., McMullen, G. L., Tribbick, G. & Bernard, C. C. A. (1992). Differing epitope selection of experimentallyinduced and natural antibodies to a disease-speci®c autoantigen, the E2 subunit of pyruvate dehydrogenase complex. (PDC-E2). Int. Immunol. 4, 12451253. Sanger, F., Carlson, A. R., Barrel, B. G., Smith, A. J. H. & Roe, B. (1980). Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. J. Mol. Biol. 143, 161-178.

46

Epitope Spreading in Primary Biliary Cirrhosis

Surh, C. D., Coppel, R. & Gershwin, M. E. (1990). Structural requirement for autoreactivity on human pyruvate dehyrodgenase-E2, the major autoantigen of primary biliary cirrhosis. J. Immunol. 144, 3367-3374. Thekkumkara, T. J., Ho, L., Wexler, I. D., Pons, G., Liu, T. C. & Patel, M. S. (1988). Nucleotide sequence of a cDNA for the dihydrolipoamide acetyltransferase component of human pyruvate deydrogenase complex. FEBS Letters, 240, 45-48. Thomson, R. K., Davis, Z., Palmer, J. M., Arthur, M. J. P., Yeaman, S. J., Chapman, C. J., Spellerberg, M. B. & Stevenson, F. K. (1998). Immunogenetic analysis of a panel of monoclonal IgG and IgM anti-PDC-E2/X antibodies derived from patients with primary biliary cirrhosis. J. Hepatol. 28, 582-594. Uibo, R., Mackay, I. R., Rowley, M., Humphries, P., Armstrong, J. M. & McNeilage, J. (1990). Inhibition of enzyme function by human autoantibodies to an autoantigen pyruvate dehydrogenase E2: different

epitope for spontaneous human and induced rabbit autoantibodies. Clin. Expt. Immunol. 80, 19-24. Van de Water, J., Turchany, J., Leung, P. S. C., Lake, J., Munoz, S., Surh, C. D., Coppel, R., Ansari, A., Nakanuma, Y. & Gershwin, M. E. (1993). Molecular mimicry in primary biliary cirrhosis. Evidence for biliary epithelial expression of a molecule crossreactive with pyruvate dehydrogenase complex-E2. J. Clin. Invest. 91, 2653-2664. Yeaman, S. J., Fussey, S. P. M., Danner, D. J., James, O. F. W., Mutimer, D. J. & Bassendine, M. F. (1988). Primary biliary cirrhosis: identi®cation of two major M2 mitochondrial autoantigens. Lancet, 1, 10671069. Zhu, D., Thompsett, A. R., Bedu-Addo, G., Stevenson, F. K. & Bates, I. (1999). VH gene sequences from a novel tropical splenic lymphoma reveal a naõÈve B cell as the cell of origin. Brit. J. Haematol. 107, 114120.

Edited by J. Karn (Received 1 June 2000; received in revised form 4 October 2000; accepted 9 October 2000)