Immunogenicity of a recombinant Sendai virus expressing the capsid precursor polypeptide of foot-and-mouth disease virus

Research in Veterinary Science 104 (2016) 181–187

Contents lists available at ScienceDirect

Research in Veterinary Science journal homepage: www.elsevier.com/locate/rvsc

Immunogenicity of a recombinant Sendai virus expressing the capsid precursor polypeptide of foot-and-mouth disease virus Guo-Ging Zhang a,d,1, Xiao-Yun Chen c,1, Ping Qian a,b, Huan-Chun Chen a,b, Xiang-Min Li a,b,⁎ a

State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, Hubei, PR China Key Laboratory of development of veterinary diagnostic products, Ministry of Agriculture, Wuhan 430070, PR China China Institute of Veterinary Drug Control, No.8 south street of Zhongguancun, Haidian district, Beijing, PR China d The Animal Multiplication Farm of Hubei Province, The Hubei Animal Husbandry and Veterinary Bureau, No.69 Xiongchu Ave., Wuchang District, Wuhan 4300064, PR China b c

a r t i c l e

i n f o

Article history: Received 27 July 2015 Received in revised form 1 December 2015 Accepted 14 December 2015 Keywords: FMDV Capsid precursor polypeptide Recombinant SeV-P1 Immunogenicity

a b s t r a c t In this study, SeV was used as a vector to express capsid precursor polypeptide (P1) of Foot-and-mouth disease virus (FMDV) by using reverse genetics. The rescue recombinant SeV (rSeV-P1) can efficiently propagate and express P1 protein by Western blot and IFA analysis. To evaluate the immunogenicity of rSeV-P1, BALB/c mice were divided into several groups and immunized intramuscularly with various doses of rSeV-P1, rSeV-eGFP, PBS and commercial FMD vaccine, respectively, and then challenged with an intraperitoneal injection of 1 × 106 TCID50 of virulent serotype O FMDV O/ES/2001 strain 4 weeks after booster immunization. Mice vaccinated with rSeV-P1 acquired FMDV-specific ELISA antibodies, neutralizing antibodies as well as cellular immune response. Meantime, mice immunized with rSeV-P1 (dose-dependent) had the ability to inhibit the replication of FMDV in the sera after FMDV challenge. Our results indicated that the recombinant SeV-P1 virus could be utilized as an alternative strategy to develop a new generation of safety and efficacious vaccine against FMDV infection. © 2015 Elsevier Ltd. All rights reserved.

1. Introduction Foot-and-mouth disease (FMD) is one of the most contagious and economically important diseases of a wide variety of cloven-hoofed animals (Alexandersen and Mowat, 2005; Jamal and Belsham, 2013). The characteristic clinical signs of FMD are high fever, anorexia and vesicles lesions on the tongue, nose and feet (Alexandersen et al., 2003; Pacheco et al., 2010). Foot and mouth disease virus (FMDV), a member of the family Picornaviridae, is the causative agent of FMD. There are seven serotypes of FMDV (A, O, C, Asia 1, SAT1, SAT2 and SAT3) and a large number of subtypes (Domingo et al., 2002; Knowles and Samuel, 2003; Carrillo et al., 2005; Domingo et al., 2005). The virion contains a positive single-stranded RNA genome encoding a polyprotein which is processed into structural and nonstructural proteins (Mason et al., 2003). The structural proteins, including VP1, VP2, VP3 and VP4, are the secondary cleavage products of the capsid precursor polypeptide (P1-2A) by the 3C protease. P1 protein contains T/B cell epitopes and is the main antigens responsible for inducing protective responses and make it is a candidate immune antigen for the development of novel vaccine (Balamurugan et al., 2003; Li et al., 2008a, 2008b).

⁎ Corresponding author at: State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, Hubei, PR China E-mail address: [email protected] (X.-M. Li). 1 These two authors contributed equally to this work.

http://dx.doi.org/10.1016/j.rvsc.2015.12.009 0034-5288/© 2015 Elsevier Ltd. All rights reserved.

Effective vaccines have played an important role in control campaigns and eradication of FMD (Sutmoller et al., 2003). Inactivated FMDV vaccines have been proved to be effective tools for the prevention of this disease in most countries. However, there still exist some dangerously potent factors, such as little or no cross-protection, posing hindrance in differentiation of infected from vaccinated animals and incomplete inactivation (Rodriguez and Gay, 2011). FMD outbreak due to improper inactivation and leakage of virus were reported (Barteling and Vreeswijk, 1991; Enserink, 2007). In order to overcome those problems, several new experimental FMDV vaccine platforms have been developed to produce effective and safe vaccine (Ludi and Rodriguez, 2013). Meamwhile, FMDV is highly sensitive to interferon and double-stranded RNA-dependent protein kinase and 2′-5′A synthetase/RNase L were involved in the inhibition of FMDV replication (Chinsangaram et al., 2001). Interferons have been used to control FMDV replication and as an adjuvant in the development of novel vaccines. Several experiments showed that adenovirus expressing Alpha interferon or Alpha and Gamma interferons could rapidly protects swine from Foot-and-Mouth Disease (Chinsangaram et al., 2003; Summerfield et al., 2009; Su et al., 2013; Kim et al., 2015). Sendai virus (SeV) is an enveloped virus with a non-segmented negative strand RNA virus (NNSV). SeV belongs to the family Paramyxoviridae including human parainfluenza viruses type 1 and 3 (hPIV-1 and 3), and bovine parainfluenza virus type 3 (Karron and Collins, 2013). SeV associated disease (influenza-like disease) has a worldwide distribution and has been found in mice, hamsters, rats,

182

G.-G. Zhang et al. / Research in Veterinary Science 104 (2016) 181–187

guinea pigs, as well as men and pigs (Faisca and Desmecht, 2007). With the development of reverse genetics technology, the application of SeV as a recombinant viral vector has been investigated in recent years because of several special features including cytoplasmic gene expression, strong immunogenicity and wide host cell specificity. Nowadays, SeV vectors are widely used for gene therapy and vaccine (Griesenbach et al., 2005; Bukreyev et al., 2006; Nakanishi and Otsu, 2012; Hikono et al., 2012). In this study, a recombinant rSeV-P1 expressing the capsid precursor polypeptide (P1) of FMDV was generated. The efficiency of rSeV-P1 to express the capsid precursor protein was examined and the immunogenicity was investigated in a mouse model. The results showed that direct immunization with rSeV-P1 induced a higher level of FMDVELISA antibody, neutralizing antibody and gamma interferon. Most importantly, the immunization with rSeV-P1 offered partial protection in a mouse model of FMDV infection. This study demonstrates the great potential of SeV as a novel vaccination vector that offers substantial flexibility for FMDV infection. 2. Materials and methods

Table 1 Primers and probe used in this study. Primer

Sequence 5′ → 3’

FMDVpF (Forward)a FMDVpR (Reverse)a FMDVvpFb FMDVvpRb eGFP-Fc eGFP-Rc IFN-γ-Fd IFN-γ-Rd 2B-Fe 2B-Re GAPDH-Ff GAPDH-Rf Probeg

TTTACGCGTATGGGAGCCGGACAATC TTTACGCGTTTACTGCTTTACAGGTGC GTTGAGAACTACGGTGGCGAG TTCTGCTTGTGTCTGGCGTC TTTACGCGTGCAGAAGAACGGCATCAAGG TTTACGCGTGTGCTCAGGTAGTGGTTGTC TGGCATAGATGTGGAAGAA GTGTGATTCAATGACGCTTA ACAAAACACGGACCCGACTT CTTTTACTCCTATGGCCAGTTCCT GCCCAAGATGCCCTTCAGT CCTTCCGTGTTCCTACCCC AACCGACTGGTGTCCGCGTTT

a

Primers used to clone the FMDV P1 gene. Primers used for the identification of recombinant virus rSev-P1. c Primers used to the clone eGFP gene. d The special primers for analysis of IFN-γ mRNA expression through real-time RT-PCR. e Primers used for the quantification of FMDV targeted at 2B gene by real-time RT-PCR. f Primers used for the control of real-time RT-PCR. g The specific probe used for the quantification of FMDV targeted at 2B gene by realtime RT-PCR. b

2.1. Viruses and cells FMDV O/ES/2001 strain (serotype O) was propagated in baby hamster kidney (BHK-21, ATCC) cells, and the supernatants of infected cells were clarified and stored at − 80 °C. Wild type Sendai virus (wt SeV) was kindly provided by Professor Shaobo Xiao (Huazhong Agricultural University) and propagated in BHK-21 cells. Recombinant vaccinia virus (rVV-T7) expressing T7 phage RNA polymerase was used for rescue recovery experiments. BHK-21 and BSR cells (a BHK-21 cell stable expressing the phage T7 RNA polymerase, kindly provided by Professor Zhenfang Fu, Huazhong Agricultural University) were cultured in Dulbecco's modified Eagle's medium (DMEM, Gibco, USA), supplemented with 10% fetal bovine serum (FBS; Gibco, New Zealand) and 100 U/ ml penicillin (Invitrogen) and 100 μg/ml of streptomycin (Invitrogen). 2.2. Plasmids and FMD vaccine The plasmid pMD-P1, containing the coding regions of capsid precursor (P1) of type O FMDV O/ES/2001 strain, was constructed previously (Li et al., 2008b). pSeV, containing a cDNA coding for the full length antigenome of SeV deleting the envelope fusion protein gene (F), pGEM-N, pGEM-P and pGEM-L, containing a cDNA coding region for the N, P and L sequence of SeV according to the sequence of SeV (GeneBank accession number DQ219803) were synthesized according to Touzelet O's method (Sangon Biotech, China) (Touzelet et al., 2009). eGFP gene was cloned from the plasmid of peGFP-C1 (Invitrogen). Commercial inactivated FMD vaccine was used as a positive control for animal experiment (China Agricultural Vet. Bio. Science and Technology Co., Ltd. Lanzhou, China). 2.3. Construction of recombinant virus rSev-P1 All primers used in this study are summarized in Table 1. The 2208 bp of P1 coding sequences of FMDV type O was sub-cloned into the pSeV BamHI site between N and P, yielding plasmids pSeV-P1 (Fig. 1A). pSeV-eGFP was also gained by inserting a 750 bp eGFP fragment from peGFP-C1 (Clontech) into pSeV with the same method. Cotransfection was carried out using Lipofectine 2000 (Invitrogen, USA) method according to the manufacturer's instructions to rescue recombinant SeV-P1 (rSev-P1) and SeV-eGFP viruses. Briefly, BHK-21 cells were infected with 0.5 MOI rVV-T7 for 1 h at 37 °C, and then co-transfected with helper plasmids pGEM-N (5 μg), pGEM-P (5 μg), pGEM-L (1.5 μg) and 5 μg of pSeV-P1 or pSeV-eGFP, and then incubated at 33 °C for 5 h. The transfection mixtures were then replaced with DMEM (1% fetal bovine serum, 100 U/ml penicillin and 100 μg/ml of streptomycin)

for a further 48 h. The transfected monolayers were harvested by 2 cycles of freezing and thawing, and 200 ul of the suspension was injected into the allantoic cavity of 9-day-old embryonated chicken eggs. After 3 days the allantoic fluids were harvested and identified by Western blot and immunofluorescence assay (IFA). 2.4. Western blot and indirect immunity fluorescence analysis The protein expression was evaluated by Western blot and IFA. 9day-old embryonated chicken eggs were injected with rSeV-P1 and allantoic fluids were harvested, centrifuged and were subjected to Western blot analysis three days later. Samples were separated using 10% SDS-polyacrylamide gel electrophoresis and then transferred to nitrocellulose. The membrane was blocked with 5% nonfat milk in TBS and incubated with rabbit anti-FMDV serum (diluted 1:500, kindly provided by Doctor Keshan Zhang, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, China) for 1 h at 37 °C followed by three washes of 5 min each with PBST. The blots were then reacted with HRP-conjugated goat anti-rabbit IgGs (dilution 1:5000, Sigma) for 1 h at 37 °C. At last, the bands were visualized by the ECL method with ChemiDOCTM system (Bio-Rad). For IFA, BHK-21 cells were seeded into 24-well plates and infected 1 with rSeV-P1 and wtSeV at a MOI. At 36 h post-infection, the cells were fixed with methanol/acetone (1:1) for 30 min at −20 °C and then with 1% bovine serum albumin (Sigma). The cells were subsequently incubated with rabbit anti-FMDV serum (diluted 1:100, kindly provided by Doctor Keshan Zhang, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, China). The fixed cells were incubated with CY3-conjugated goat anti-rabbit antibody (1:100 dilution, Sigma). The cells were examined under a laser scanning confocal microscope (LSM 510, Zeiss, USA). 2.5. Growth properties of rSeV-P1 To analyze the genetic stability of the foreign gene in the recombinant rSeV-P1 virus, the virus was sequentially grown on CEFs for 20 passages and viral RNAs were extracted and analyzed using VP1-specific primers. The expression of P1 protein was also determined by Western blot analysis with rabbit anti-FMDV serum (diluted 1:100, kindly provided by Doctor Keshan Zhang, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, China). One step

G.-G. Zhang et al. / Research in Veterinary Science 104 (2016) 181–187

183

Fig. 1. The construction of recombinant Sendai virus (rSeV-P1) expressing the P1 gene of FMDV. (A) The schematic representation of the organization of the plasmids carrying the full length cDNA of SeV, FMDV P1 gene and eGFP gene. (B) The basic procedure to rescue recombinant SeV by co-transfection with pSeV-P1 or pSeV-eGFP and helper plasmids pN, pP, pL to BSR cells. (C–D) BHK-21 cells infected with rSeV-P1 (lane 1) or rSeV-eGFP (lane 2) were collected for the detection of FMDV P1 protein expression by SDS-PAGE. (C) and Western blotting (D) The results of SDS-PAGE and Western blot showed that an approximate 72 kDa protein corresponding to the expected size of P1 was detected in cells at 72 h post infection with rSeV-P1. (E) The expression of P1 protein was identified by indirect immunofluorescence assay (IFA). The cells were fixed and permeabilized with methanol for IFA, cells infected with rSeV-P1 developed immunofluorescence (a) and mock-infected cells did not developed immunofluorescence (b).

growth kinetic assay was performed to determine the titer of recombinant rSeV-P1 and rSeV-eGFP virus as previously described (Touzelet et al., 2009). Briefly, BHK-21 cells in 12-well plates were infected either by recombinant virus rSev-P1 or rSeV-eGFP with 1 × 106 TCID50 per well. Cells were harvested at different time points and titrated on BHK-21 cells with Reed–Muench method.

2.6. Animal immunization and viral challenge Groups of four-week-old female BALB/c mice (10 mice/group) were purchased from the Hubei Centre of Disease Control, China (Approval number: SCXK (E) 2008–005, No. 42000600001280). They were housed and handled according to the Hubei Provincial Animal Care and Use Committee Guidelines. The mice were intramuscularly immunized with rSeV-P1 at different titers (1 × 28 and 1 × 29 HA/mouse), or were injected with 1 × 28 HA/mouse of rSeV-eGFP, 100 μL of commercial FMD vaccine (according to manufacturer's instructions, containing 1.0 μg of BEI-inactivated 146S FMDV antigen) and 100 μL of PBS. Booster injection with the same dose was performed at 4 week after primary immunization. Serum samples were collected at 0, 2, 4, 6 and 8 weeks after initial immunization for serological tests. At 8 week after primary immunization, half of mice in each group were sacrificed with isoflurane and splenocytes were isolated for IFN-γ analysis, and the remaining mice were challenged intraperitoneally with 1 × 106.0 TCID50 of virulent FMDV O/ES/2001 strain to investigate whether the immunization of rSeV-P1 could suppress viral replication in mice. All animal experiments with FMDV were conducted in the biosafety level 3 + containment facility approved by the Chinese Ministry of Agriculture.

2.7. Serological tests Detection of serum antibodies to the FMDV was performed by indirect ELISA using 96-well flat-bottomed plates (Nunc) coated with recombinant FMDV VP1 protein antigen according to the manufacturer's recommendations (Wuhan KeQian Biological Co., Ltd.). The absorbance at 450 nm was determined by an ELISA reader (Labsystems MK3). Serum neutralization assays were essentially performed as previously described (Li et al., 2008b). The neutralization titer was calculated as the reciprocal of the last serum dilution to neutralize 100 TCID50 homologous FMDV in 50% of the wells using the Reed–Muench method. 2.8. Real-time PCR analysis of IFN-γ mRNA expression Splenocytes (1 × 106/mL were cultured in 12-well plates for 20 h at 37 °C in the presence of 5% CO2, with or without 20 μL of UV-inactivated FMDV or UV-inactivated SeV. Total RNA was extracted with TRIzol reagent (Life Technologies) and one microgram of RNA was reverse transcribed using the First Strand cDNA Synthesis Kit (TOYOBO, Japan) in a 20-μl reaction mixture. Real-time The cDNA product was further amplified with SYBR® Green Real-time PCR Master Mix (ToYoBo) with specific primers targeted at the 2B gene of O/ES/2001 (Table 1). β-actin was used as an endogenous reference control. Each cDNA sample was performed in triplicate. PCR amplification was performed using in a LightCycler® 480 Real-Time PCR System (Roche; Indianapolis, IN, USA) under the following conditions: 2 min at 50 °C, 5 min at 95 °C, and 45 cycles of 15 s at 95 °C, 30 s at 55 °C and 30 s at 72 °C 5 min. Gene expression was determined using the relative quantity and then analyzed as previously described (Fan et al., 2008).

184

G.-G. Zhang et al. / Research in Veterinary Science 104 (2016) 181–187

2.9. Virus detection in the sera of mice after FMDV challenge Eight mice in each group were injected intraperitoneally with a virus suspension containing 1 × 106 TCID50 of FMDV O/ES/2001 strain at 8 weeks after primary immunization. Blood was collected at 3 day post-challenge and total RNA was extracted from 50 μL of serum with TRIzol reagent (Life Technologies) according to manufacturer's instructions. The amount of viral genomes was measured by quantitative realtime PCR assay with specific primers and/or probe targeting 2B gene of FMDV O/ES/2001 strain using a LightCycler 480 Real-Time PCR System (Roche; Indianapolis, IN, USA). Thermal cycling conditions were 1 min at 95 °C, then 40 cycles of 15 s at 95 °C, 30 s at 60 °C and 45 s at 72 °C. GAPDH was used as the internal control. Gene expression was analyzed as described previously (Li et al., 2009; Xu et al., 2014). Primer pairs and probe are shown in Table 1. 2.10. Statistical analysis Statistical analysis was conducted using the GraphPad Prism Version 5 (GraphPad Software, La Jolla, CA, USA, 2012). One-way ANOVA was used for statistical analyses among different groups. P-value less than 0.05 was considered statistically significant.

A recombinant virus rSeV-eGFP was also generated with the same method as the control. 3.2. Stability and growth properties of rSeV-P1 To assess the genetic stability and growth kinetics of rSeV-P1, the virus was grown in embryonated chicken eggs sequentially for 20 passages. The viral RNA was extracted and analyzed using FMDV VP1 specific primers (Table 1). Results showed that P1 gene was stably inserted into the SeV genome (Fig. 2A). Furthermore, the nucleotide sequence of P1, P5, P10, P15 and P20 was sequenced and results showed that there was not any change between different passage viruses. The expression of P1 protein was also determined by Western blot analysis with rabbit anti-FMDV serum (diluted 1:100, kindly provided by Doctor Keshan Zhang, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, China). The positive signals were observed in the infected cells, but not in the mock-infected cells (Fig. 2B). Furthermore, one-step growth curve was conducted to address whether the insertion of P1 gene affected the replication of rSeV-P1. The result showed that there were no differences in growth kinetics between rSeV-P1, rSeV-eGFP and wtSeV (Fig. 2B).

3. Results

3.3. Humoral immune responses elicited by rSeV-P1 in immunized mice

3.1. Construction of recombinant Sendai virus rSeV-P1

To evaluate the immunogenicity of rSeV-P1, groups of BALB/c mice were immunized intramuscularly with various doses (1 × 28 and 1 × 29 HA/mouse) of rSeV-P1, 1 × 28 HA/mouse of rSeV-eGFP, inactivated FMD vaccine and PBS. Sera were collected at 0, 2, 4, 6 and 8 week post-initial inoculation and analyzed for VP1-specific ELISA antibodies. As shown in Fig. 3A, the antibody titers reached a detectable level in the vaccinated groups, except for the group immunized with rSeV-eGFP and the negative group after primary immunization. A further increase in antibody titers was observed at 2 weeks after booster immunization and takes on a dose dependent in groups immunized with rSeV-P1. However, the mean FMDV-specific ELISA antibody titers

The recombinant virus rSeV-P1 was constructed by introducing FMDV P1 gene into the viral genome of SeV by the method of reverse genetics. To rescue rSeV-P1 virus, P1 gene of FMDV ES/2001 strain was inserted into the intergenic sequence of the genome between the N and P genes of SeV to generate the pSeV-P1 vector (Fig. 1A). The recombinant virus (rSeV-P1) was rescued from the plasmids pSeV-P1 and pGEM-N, pGEM-P, pGEM-L in BSR cells. rSeV-P1 was further amplified in embryonated chicken eggs and the P1 gene was stably expressed in BHK-21 cells as determined by IFA and western analysis (Fig. 1B & C).

Fig. 2. The biological characteristics analysis of rSeV-P. (A) rSeV-P1 was grown in embryonated chicken eggs sequentially for 20 passages and the total RNAs were amplified by RT-PCR with a specific primer for VP1 gene according to FMDV O/ES/2001 strain and analyzed by electrophoresis. 1: marker DL2000; 1–2: passages 1, 3, 6, 9, 12, 15 and 18; 9: cells infected with wtSeV; (B) The expression of P1 gene by Western blotting assay. 1–7: passages 1, 3, 6, 9, 12, 15 and 18 infected cells; 8: Mock-infected cells; (C) One-step growth curve was performed as described previously (Touzelet et al., 2009). Briefly, BHK-21 cells in 12-well plates were infected either by recombinant virus rSeV-eGFP, rSeV-P1 or wtSeV with 1 × 106 TCID50 per well. Cells were harvested at indicated time points, and titrated on BHK-21 cells.

G.-G. Zhang et al. / Research in Veterinary Science 104 (2016) 181–187

185

Fig. 3. Specific antibody responses to FMDV detected by indirect ELISA and serum neutralization assays. Each group of mice (n = 10) was immunized i.m. with rSeV-P1 or control. Serum samples were collected at 2, 4, 6 and 8 weeks after primary immunization and analyzed for induced ELISA antibodies. (A) and neutralizing antibodies. (B) specific to FMDV. Mice were immunized intramuscularly with various doses (1 × 28 and 1 × 29 HA/mouse) of rSeV-P1, 1 × 28 HA/mouse of rSeV-eGFP and PBS. Data represent mean ± SEM. Different letters (a, b and c) indicate a statistically significant difference between the different experimental groups (P b 0.05).

in the group immunized with commercial inactivated vaccine were higher than that in groups immunized with rSeV-P1 (P b 0.05). Serum samples were further evaluated for the ability to neutralize FMDV in vitro by serum neutralization assays. As shown in Fig. 3B, mice immunized with 1 × 28 and 1 × 29 HA of rSeV-P1 developed mean neutralizing antibody titers of 1:32 and 1:128 at 4 weeks after primary immunization, which increased further to 1:64 and 1:64 at 6 weeks, respectively. As expected, sera from mice immunized with commercial inactivated FMD vaccine display higher neutralizing antibody activity throughout the whole experiment (P b 0.05). Mice inoculated with PBS or rSeV-eGFP did not produce specific anti-FMDV antibody.

3.5. Detection of FMDV RNA through real-time PCR All groups were intraperitoneally challenged with 1 × 106 TCID50 of FMDV strain O/ES/2001. The mice were bled at 3 days after FMDV challenge. Total RNA was extracted from the sera and FMDV viral RNA was quantified by real-time RT-PCR targeting FMDV 2B gene. As shown in Fig. 5, viral RNA of the PBS, rSeV-eGFP and low dose of rSeV-P1 group were significantly higher compared to other two immunized groups (P b 0.05), and there is no difference in the three groups (P N 0.05). A significantly lower viral was present in the higher dose immunization group of rSeV-P1 and commercial inactivated vaccine compared to the negative groups. However, the viral RNA of group immunized with commercial FMD vaccine is lower than higher dose of rSeV-P1 (P b 0.05) (Fig. 5).

3.4. FMDV-specific cellular immune responses elicited by rSeV-P1 virus in mice

4. Discussion

To characterize the cell-mediated immune responses in mice immunized with rSeV-P1, mice were sacrificed at 8 weeks after primary immunization and IFN-γ mRNA expression in splenocytes re-stimulated with UV-inactivated SeV or FMDV was measured by real-time RT-PCR. As shown in Fig. 4A, the mean relative IFN-γ mRNA expression with SeV-stimulated was significantly higher in groups immunized with rSeV-P1 and rSeV-eGFP than PBS group (P b 0.05). The mean relative IFN-γ mRNA expression was significantly higher in groups immunized with commercial inactivated FMD vaccine group. Though the IFN-γ level was a little higher in group immunized with rSeV-P1 than rSeVeGFP and PBS groups, there were no significant differences among rSeV-P1, rSeV-eGFP and PBS groups (P N 0.05).

FMD is a devastating disease causing morbidity to livestock and serious economic damage to livestock industry (Jamal and Belsham, 2013). Although the current FMD vaccine is efficient to protect animals from FMDV infection, it does not offer protection until 5–7 days after vaccination (Golde et al., 2005). Meantime, this vaccine is associated with several problems, such as safety and differentiation between infected and vaccinated animals (DIVA) (Sutmoller et al., 2003; Rodriguez and Gay, 2011). Therefore, it is necessary to develop novel FMD vaccines for essentially controlling this disease. More and more studies showed that innate and acquired immune all play an important role in protection against FMDV infection. Type I and II interferon could effectively inhibit virus replication in vitro and rapidly protect animals against FMDV

186

G.-G. Zhang et al. / Research in Veterinary Science 104 (2016) 181–187

Fig. 4. The relative expression of IFN-γ mRNA in mice. Mice were immunized and splenocytes were isolated 8 weeks after primary immunization and were incubated in vitro with UV-inactivated FMDV or SeV for 20 h. Relative quantity of IFN-γ mRNA expression was determined by real tine RT-PCR (β–actin gene expression as the housekeeping gene). (A) The relative expression of IFN-γ mRNA in mice stimulated with UVinactivated SeV. (B) The relative expression of IFN-γ mRNA in mice stimulated with UVinactivated FMDV. Data represent the mean ± SEM. Different letters (a, b and c) indicate a statistically significant difference between the different experimental groups (P b 0.05).

infection in vivo (Moraes et al., 2007; Nfon et al., 2008; Summerfield et al., 2009; Kim et al., 2014, 2015). In the present study, we reported the construction of a recombinant rSeV-P1 expressing FMDV capsid precursor polypeptide (P1) and preliminary evaluation of its immunogenicity in mice. In this case, rSeVP1 was obtained using reverse genetics technique by co-transfection between a plasmid containing a cDNA coding for the full length antigenome of SeV and helper plasmids pGEM-N, pGEM-P and pGEML (Fig. 1A). The identification of rSeV-P1 was confirmed by PCR, Western blotting and IFA analysis (Fig. 1B and C). Because the insertion of a

foreign might alter the properties of rSeV-P1, experiments were carried out to compare rSeV-P1 with the parent SeV. One growth curve showed that the propagation characteristics of rSeV-P1 were not significantly different from the parent SeV (wtSeV) in the embryonated chicken eggs (Fig. 2). P1 contains major antigen epitopes and could induce antibodies against FMDV in our previous study (Li et al., 2008b). In this study, rSeV-P1 virus could elicit significant immunity against FMDV in mice. As shown in Fig. 3, mice inoculated with rSeV-P1 induced high levels of anti-FMDV antibodies, including ELISA and neutralizing antibodies, and the level significantly increased after a booster immunization. In order to enhance the cellular immune, we used SeV as the viral vector to express the capsid protein (P1). SeV naturally infects the respiratory tract of mice and is used as an inducer of IFN expression (Faisca and Desmecht, 2007; Didcock et al., 1999). Meanwhile, SeV can efficiently induce cell-mediated protective immune responses, which are particularly useful against viruses infecting via the respiratory tract (Bukreyev et al., 2006; Faisca and Desmecht, 2007). Nowadays, SeV vectors have been investigated as platforms for vaccines against the human immunodeficiency virus, influenza virus, hPIV-1–3 and respiratory syncytial virus (Hara et al., 2011; Hikono et al., 2012; Jones et al., 2009, 2012). Meanwhile, FMDV infects mainly via the enteric and respiratory organs, the vaccine can effectively induce the production of mucosal immunity is also important (Pan et al., 2014). Our study showed that rSeV-P1 could effectively induce the production of IFN-α and IFN-β in BHK-21 cells (data not shown). Higher IFN-γ expression in mice immunized with rSeV-P1 and rSeV-eGFP were observed after the stimulation with inactivated SeV (Fig. 4A). But the IFN-γ expression in mice immunized with rSeV-P1 was lower than that of commercial FMD vaccine with the stimulation of inactivated FMDV (Fig. 4B). The results of virus detection in the sera of mice after FMDV challenge showed that all mice in the PBS, rSeV-eGFP and low dose of rSeV-P1 groups taking on higher level of viral RNA in the spleen. However, high dose of rSeV-P1 group conferred partial protection, but still lower than the commercial FMD vaccine group. Those may be related with the following reason. BALB/c mice were immunized intramuscularly but not intranasally in this study, this may influence the immunity effect (Pan et al., 2014; Alejo et al., 2013; Moriya et al., 2011). In summary, the recombinant Sendai virus rSeV-P1 was successfully constructed. rSeV-P1 could effectively express the capsid precursor polypeptide and induce humoral and cellular immunity against FMDV in mice. The immune efficacy could offer partial protection against the homologous FMDV O/ES/2001 strain challenge. Additional studies will be conducted to evaluate the immunogenic and protective effects in pigs with different routes of immunization injection and different dose of rSeV-P1. Author contributions Designed the experiments: PQ, XML, and HCC; performed the experiments: GQZ; analyzed the data: XML and GQZ; wrote the paper: PQ, XYC, and GQZ; Proofed the manuscript: XML, PQ, and HCC. All authors read and approved the final manuscript. Conflicts of interest The authors declare no conflict of interest. Acknowledgments

Fig. 5. Quantification of FMDV targeted at 2B gene by real-time RT-PCR. Mice were immunized and challenged at 8 weeks after primary immunization. The mice were bled at 3 days after 1 × 106 TCID50 FMDV challenge, blood were collected and total RNA were extracted with TRIzol reagent (Life Technologies). The amount of viral genome was measured by RT-PCR assay targeting at FMDV 2B gene. Different letters (a, b and c) indicate a statistically significant difference between the different experimental groups (P b 0.05).

This work was supported by the National Programs for High Technology Research and Development of China (No. 2011AA10A2115) and Fundamental Research Funds for the Central Universities (2010PY001, 2011PY050).

G.-G. Zhang et al. / Research in Veterinary Science 104 (2016) 181–187

References Alejo, D.M., Moraes, M.P., Liao, X., Dias, C.C., Tulman, E.R., Diaz-San Segundo, F., Rood, D., Grubman, M.J., Silbart, L.K., 2013. An adenovirus vectored mucosal adjuvant augments protection of mice immunized intranasally with an adenovirus-vectored foot-and-mouth disease virus subunit vaccine. Vaccine 31, 2302–2309. Alexandersen, S., Mowat, N., 2005. Foot-and-mouth disease: host range and pathogenesis. Curr. Top. Microbiol. Immunol. 288, 9–42. Alexandersen, S., Zhang, Z., Donaldson, A.I., Garland, A.J., 2003. The pathogenesis and diagnosis of foot-and-mouth disease. J. Comp. Pathol. 129, 1–36. Balamurugan, V., Renji, R., Saha, S.N., Reddy, G.R., Gopalakrishna, S., Suryanarayana, V.V., 2003. Protective immune response of the capsid precursor polypeptide (P1) of foot and mouth disease virus type ‘O’ produced in Pichia pastoris. Virus Res. 92, 141–149. Barteling, S.J., Vreeswijk, J., 1991. Developments in foot-and-mouth disease vaccines. Vaccine 9, 75–88. Bukreyev, A., Skiadopoulos, M.H., Murphy, B.R., Collins, P.L., 2006. Nonsegmented negative-strand viruses as vaccine vectors. J. Virol. 80, 10293–10306. Carrillo, C., Tulman, E.R., Delhon, G., Lu, Z., Carreno, A., Vagnozzi, A., Kutish, G.F., Rock, D.L., 2005. Comparative genomics of foot-and-mouth disease virus. J. Virol. 79, 6487–6504. Chinsangaram, J., Koster, M., Grubman, M.J., 2001. Inhibition of L-deleted foot-and-mouth disease virus replication by alpha/beta interferon involves double-stranded RNAdependent protein kinase. J. Virol. 75, 5498–5503. Chinsangaram, J., Moraes, M.P., Koster, M., Grubman, M.J., 2003. Novel viral disease control strategy: adenovirus expressing alpha interferon rapidly protects swine from foot-and-mouth disease. J. Virol. 77, 1621–1625. Didcock, L., Young, D.F., Goodbourn, S., Randall, R.E., 1999. Sendai virus and simian virus 5 block activation of interferon-responsive genes: importance for virus pathogenesis. J. Virol. 73, 3125–3133. Domingo, E., Baranowski, E., Escarmís, C., Sobrino, F., 2002. Foot-and-mouth disease virus. Comp. Immunol. Microbiol. Infect. Dis. 25, 297–308. Domingo, E., Escarmís, C., Lázaro, E., Manrubia, S.C., 2005. Quasispecies dynamics and RNA virus extinction. Virus Res. 107, 129–139. Enserink, M., 2007. Reports blame animal health lab in foot-and-mouth whodunit. Science 317, 1486. Faisca, P., Desmecht, D., 2007. Sendai virus, the mouse parainfluenza type 1: a longstanding pathogen that remains up-to-date. Res. Vet. Sci. 82, 115–125. Fan, H., Pan, Y., Fang, L., Wang, D., Wang, S., Jiang, Y., Chen, H., Xiao, S., 2008. Construction and immunogenicity of recombinant pseudotype baculovirus expressing the capsid protein of porcine circovirus type 2 in mice. J. Virol. Methods 150, 21–26. Golde, W.T., Pacheco, J.M., Duque, H., Doel, T., Penfold, B., Ferman, G.S., Gregg, D.R., Rodriguez, L.L., 2005. Vaccination against foot-and-mouth disease virus confers complete clinical protection in 7 days and partial protection in 4 days: use in emergency outbreak response. Vaccine 23, 5775–5782. Griesenbach, U., Inoue, M., Hasegawa, M., Alton, E.W., 2005. Sendai virus for gene therapy and vaccination. Curr. Opin. Mol. Ther. 7, 346–352. Hara, H., Hara, H., Hironaka, T., Inoue, M., Iida, A., Shu, T., Hasegawa, M., Nagai, Y., Falsey, A.R., Kamali, A., Anzala, O., Sanders, E.J., Karita, E., Mwananyanda, L., Vasan, S., Lombardo, A., Parks, C.L., Sayeed, E., Krebs, M., Cormier, E., Ackland, J., Price, M.A., Excler, J.L., 2011. Prevalence of specific neutralizing antibodies against Sendai virus in populations from different geographic areas: implications for AIDS vaccine development using Sendai virus vectors. Hum. Vaccin. 7, 639–645. Hikono, H., Miyazaki, A., Mase, M., Inoue, M., Hasegawa, M., Saito, T., 2012. Induction of a cross-reactive antibody response to influenza virus M2 antigen in pigs by using a Sendai virus vector. Vet. Immunol. Immunopathol. 146, 92–96. Jamal, S.M., Belsham, G.J., 2013. Foot-and-mouth disease: past, present and future. Vet. Res. 44, 1–14. Jones, B., Zhan, X., Mishin, V., Slobod, K.S., Surman, S., Russell, C.J., Portner, A., Hurwitz, J.L., 2009. Human PIV-2 recombinant Sendai virus (rSeV) elicits durable immunity and combines with two additional rSeVs to protect against hPIV-1, hPIV-2, hPIV-3, and RSV. Vaccine 27, 1848–1857. Jones, B.G., Sealy, R.E., Rudraraju, R., Traina-Dorge, V.L., Finneyfrock, B., Cook, A., Takimoto, T., Portner, A., Hurwitz, J.L., 2012. Sendai virus-based RSV vaccine protects African green monkeys from RSV infection. Vaccine 30, 959–968.

187

Karron, R.A., Collins, P.L., 2013. Parainfluenza viruses. In: Knipe, D.M., Howley, P.M. (Eds.), Fields Virology, sixth ed. Lippincott Williams & Wilkins Publisher, Philadelphia, PA, USA, pp. 996–1023. Kim, S.M., Kim, S.K., Park, J.H., Lee, K.N., Ko, Y.J., Lee, H.S., Seo, M.G., Shin, Y.K., Kim, B., 2014. A recombinant adenovirus bicistronically expressing porcine interferon-α and interferon-γ enhances antiviral effects against foot-and-mouth disease virus. Antiviral Res. 104, 52–58. Kim, S.M., Park, J.H., Lee, K.N., Kim, S.K., You, S.H., Kim, T., Tark, D., Lee, H.S., Seo, M.G., Kim, B., 2015. Robust protection against highly virulent foot-and-mouth disease virus in swine by combination treatment with recombinant adenoviruses expressing porcine interferon-αγ and multiple small interfering RNAs. J. Virol. 89, 8267–8279. Knowles, N.J., Samuel, A.R., 2003. Molecular epidemiology of foot-and-mouth disease virus. Virus Res. 91, 65–80. Li, Z., Yi, Y., Yin, X., Zhang, Z., Liu, J., 2008a. Expression of foot-and-mouth disease virus capsid proteins in silkworm-baculovirus expression system and its utilization as a subunit vaccine. PLoS One 3, e2273. http://dx.doi.org/10.1371/journal.pone.0002273. Li, X., Liu, R., Tang, H., Jin, M., Chen, H., Qian, P., 2008b. Induction of protective immunity in swine by immunization with live attenuated recombinant pseudorabies virus expressing the capsid precursor encoding regions of foot-and-mouth disease virus. Vaccine 26, 2714–2722. Li, Y., Huang, X., Xia, B., Zheng, C., 2009. Development and validation of a duplex quantitative real-time RT-PCR assay for simultaneous detection and quantitation of footand-mouth disease viral positive-stranded RNAs and negative-stranded RNAs. J. Virol. Methods 161, 161–167. Ludi, A., Rodriguez, L., 2013. Novel approaches to foot-and-mouth disease vaccine development. Dev. Biol. 135, 107–116. Mason, P.W., Grubman, M.J., Baxt, B., 2003. Molecular basis of pathogenesis of FMDV. Virus Res. 91, 9–32. Moraes, M.P., de Los Santos, T., Koster, M., Turecek, T., Wang, H., Andreyev, V.G., Grubman, M.J., 2007. Enhanced activity against foot-and-mouth disease virus by a combination of type I and II porcine interferons. J. Virol. 81, 7124–7135. Moriya, C., Horiba, S., Kurihara, K., Kamada, T., Takahara, Y., Inoue, M., Iida, A., Hara, H., Shu, T., Hasegawa, M., Matano, T., 2011. Intranasal Sendai viral vector vaccination is more immunogenic than intramuscular under pre-existing anti-vector antibodies. Vaccine 29, 8557–8563. Nakanishi, M., Otsu, M., 2012. Development of Sendai virus vectors and their potential applications in gene therapy and regenerative medicine. Curr. Gene Ther. 12, 410–416. Nfon, C.K., Ferman, G.S., Toka, F.N., Gregg, D.A., Golde, W.T., 2008. Interferon-α production by swine dendritic cells is inhibited during acute infection with foot-and-mouth disease virus. Viral Immunol. 21, 68–77. Pacheco, J.M., Arzt, J., Rodriguez, L.L., 2010. Early events in the pathogenesis of foot-andmouth disease in cattle after controlled aerosol exposure. Vet. J. 183, 46–53. Pan, L., Zhang, Z., Lv, J., Zhou, P., Hu, W., Fang, Y., Chen, H., Liu, X., Shao, J., Zhao, F., Ding, Y., Lin, T., Chang, H., Zhang, J., Zhang, Y., Wang, Y., 2014. Induction of mucosal immune responses and protection of cattle against direct-contact challenge by intranasal delivery with foot-and-mouth disease virus antigen mediated by nanoparticles. Int. J. Nanomedicine 9, 5603–5618. Rodriguez, L.L., Gay, C.G., 2011. Development of vaccines toward the global control and eradication of foot-and-mouth disease. Expert Rev. Vaccines 10, 377–387. Su, C., Duan, X., Zheng, J., Liang, L., Wang, F., Guo, L., 2013. IFN-α as an adjuvant for adenovirus-vectored FMDV subunit vaccine through improving the generation of T Follicular helper cells. PLoS One 8, e66134. Summerfield, A., Guzylack-Piriou, L., Harwood, L., McCullough, K.C., 2009. Innate immune responses against foot-and-mouth disease virus: current understanding and future directions. Vet. Immunol. Immunopathol. 128, 205–210. Sutmoller, P., Barteling, S.S., Olascoaga, R.C., Sumption, K.J., 2003. Control and eradication of foot-and-mouth disease. Virus Res. 91, 101–144. Touzelet, O., Loukili, N., Pelet, T., Fairley, D., Curran, J., Power, U.F., 2009. De novo generation of a non-segmented negative strand RNA virus with a bicistronic gene. Virus Res. 140, 40–48. Xu, J., Qian, P., Wu, Q., Liu, S., Fan, W., Zhang, K., Wang, R., Zhang, H., Chen, H., Li, X., 2014. Swine interferon-induced transmembrane protein, sIFITM3, inhibits foot-and-mouth disease virus infection in vitro and in vivo. Antiviral Res. 109, 22–29.