Immunolipoplexes: An Efficient, Nonviral Alternative for Transfection of Human Dendritic Cells with Potential for Clinical Vaccination

ARTICLE

doi:10.1016/j.ymthe.2004.12.009

Immunolipoplexes: An Efficient, Nonviral Alternative for Transfection of Human Dendritic Cells with Potential for Clinical Vaccination Peng H. Tan,1 Sven C. Beutelspacher,1,2,3 Yao-He Wang,4 Myra O. McClure,2 Mary A. Ritter,1 Giovanna Lombardi,1 and Andrew J. T. George1,* 1

Department of Immunology, and 4Cancer Research UK Molecular Oncology Unit, Division of Medicine, Faculty of Medicine, Imperial College London, Hammersmith Hospital, Du Cane Road, London W12 ONN, UK 2 Jefferiss Research Trust Laboratories, Wright-Fleming Institute, Imperial College London, St. Mary’s Hospital, Norfolk Place, London W2 1PG, UK 3 University Eye Hospital, University of Heidelberg, INF 400, D69120 Heidelberg, Germany *To whom correspondence and reprint requests should be addressed. Fax: +44 (0)20 8383 2788. E-mail: [email protected].

Available online 21 January 2005

Genetic manipulation of dendritic cells (DCs) is important in the context of using either mature DCs to immunize patients or immature DCs to induce tolerance. Here, we describe a novel method of transfecting monocyte-derived human DCs using immunolipoplexes containing anti-CD71 or antiCD205 monoclonal Abs. This results in up to 20% transfection, which can be increased to 20–30% if the immunolipoplexes are used to transfect CD14+ monocytes prior to differentiation into DCs. Transfected DCs can be substantially enriched using a drug-selection protocol during differentiation. Unlike adenoviral transduction, this nonviral transfection does not alter the expression of costimulatory molecules or the production of proinflammatory cytokines by DCs. In addition, DC function is unaltered, as assessed by mixed lymphocyte reactions. To test the feasibility of the immunolipoplexes and selection protocol for therapeutic intervention, we transfected DCs with the immunomodulatory enzyme indoleamine 2,3-dioxygenase (IDO). Allogeneic T cells exposed to IDOexpressing DCs did not proliferate, secreted more IL-10 and less Th1 and Th2 cytokines, and had a higher amount of apoptosis than T cells incubated with control DCs. Furthermore the remaining T cells were rendered anergic to further stimulation by allogeneic DC. These immunolipoplexes, which can be easily and rapidly assembled, have potential for clinical immunization, in particular for tolerance induction protocols.

INTRODUCTION Presentation of antigen by dendritic cells (DCs) to T cells is central to the immune response [1,2]. Mature DCs (mDCs), which express high levels of MHC class II and costimulatory molecules, are the only cells capable of activating naRve T cells. Immature DCs (iDCs), on the other hand, which express lower levels of MHC class II and costimulatory molecules, are capable of inducing anergy in T cells that recognize them [3]. This has led to considerable interest in the application of DCs as tools for immunotherapy. In one approach, administration of mDCs expressing the appropriate antigen may be useful for immunizing patients in the context of cancer or infectious diseases [4]. Alternatively, iDCs may be effective at inducing tolerance in autoimmune disease or transplantation [3]. In both contexts, there can be a need to modify the DCs genetically, either to introduce the gene encoding for the antigen of interest

790

or to express molecules capable of altering the function of the DCs. Until now, adenovirus has been the vector of choice to achieve efficient transduction of DCs because monocytederived DCs are terminally differentiated and nondividing [5–8]. However, various vectors based on the Retroviradae family are effective in transducing DCs [9–15]. One drawback of the use of viral vectors is that they frequently activate iDCs [16–18]. In addition, adenoviraltransduced mDCs have a reduced immunostimulatory capacity, which has been suggested to be due either to viral immunodominance or to immunoregulation by viral proteins [8]. An alternative strategy is the use of nonviral vectors, although up till now these have been relatively inefficient. A third approach is RNA-mediated transfection of DCs, which has been shown to be efficient in many DC vaccine protocols [19–24]. In this report, we describe an enhanced nonviral approach using immuno-

MOLECULAR THERAPY Vol. 11, No. 5, May 2005 Copyright C The American Society of Gene Therapy 1525-0016/$30.00

doi:10.1016/j.ymthe.2004.12.009

lipoplexes [25] to target two different endocytic receptors; CD71, the transferrin receptor [26], and CD205, a member of the macrophage mannose receptor family [27]. This results in improved delivery of plasmid DNA. Our approach is therefore an efficient alternative to viral vectors for the transduction of DCs and avoids some of the disadvantages associated with the viral vectors.

RESULTS Nonviral Vector-Mediated Transfections of DCs We tested a variety of nonviral vectors for their ability to transfect DCs. They included commercially available polymers, such as polyethylenimine (PEI), ExGene 500, and SuperFect, and conventional chemical methods such as calcium phosphate (Supplementary Fig. 1A, bottom). All these were relatively inefficient (b2%) at gene transfer to DCs even following optimization of conditions. While electroporation can transfect Langerhans cells and CD34+-derived DCs efficiently [28], this was not seen for monocyte-derived DCs (Supplementary Fig. 1A, bottom). All these methods are highly toxic to iDCs (Supplementary Fig. 1B, bottom) and mDCs (data not shown), with 40–80% cell death. Liposomes have previously been used to transfect DCs with the gene encoding tumor-derived peptide [29]. However, with the enhanced green fluorescent protein (EGFP) construct, the transfection efficiency using liposomes on iDCs or mDCs was low (b4%) (Supplementary Fig. 1A, top) and was associated with 4/8 liposomes (Lipofectin, DOTAP, FuGENE 6, and CLONfectin) with a high degree of toxicity (50–70%) for both iDCs (Supplementary Fig. 1B, top) and mDCs (data not shown). Transduction with these vectors caused insignificant changes in surface markers such as MHC class II and costimulatory molecules (data not shown). We determined the functional ability of transduced DCs using a mixed lymphocyte reaction (MLR) with the DCs as stimulators and allogeneic T cells as responders. In a MLR, iDCs are incapable of inducing the proliferation of the T cells, while mDCs induce a strong proliferative response. As shown in Supplementary Fig. 1C, some of the nonviral vectors increased the allogeneic response seen for both mDCs (LipofectAMINE and DOTAP) and iDCs (all lipids except Tfx-50 and Lipofectin). This is consistent with data demonstrating the effect of lipids on DC allogeneic stimulation [29]. Anti-CD71- or Anti-CD205-Immunolipoplex Transduction of DCs The endocytic molecules CD71 (transferrin receptor) and CD205 (mouse DEC205 homologue; a member of the macrophage mannose receptor family) are both expressed on iDCs and mDCs, although expression of CD71 is higher on iDCs, while that of CD205 is higher on mDC (Fig. 1A) [26,30]. We complexed liposomes with anti-

MOLECULAR THERAPY Vol. 11, No. 5, May 2005 Copyright C The American Society of Gene Therapy

ARTICLE

bodies using a previously described technique involving mild heat aggregation of antibodies [25]. When we added immunolipoplexes containing anti-CD71 or anti-CD205 to either mDCs or iDCs, there was an increase both in binding of immunolipoplexes to the cell surface and in their internalization compared with uncomplexed liposomes (Figs. 1B and 1C) or isotype control Ig (9E10)complexed liposomes (data not shown). As might be expected from the lower endocytosis of mDCs compared to iDCs [31], internalization by the iDCs was greater than that of mDCs. Consistent with these findings, we saw an increase in transfection efficiency of iDCs with both monoclonal antibodies (mAbs); however, only antiCD205 increased transfection efficiency in mDCs (Fig. 2). The toxicity following transfection was similar to that seen with lipids (Fig. 2). Anti-CD71- or Anti-CD205-Immunolipoplex Transductions of DCs Did Not Alter the Phenotype and Function of DCs Transfection of iDCs with immunolipoplexes did not result in any changes to the phenotype of iDCs with respect to the expression of MHC class I, MHC class II, and costimulatory molecules (Fig. 3A). In addition, when transduced iDCs were matured using a cocktail of inflammatory cytokines, the phenotype of the cells was the same as that of untransduced cells matured in parallel. When we used the DCs as stimulators in a MLR, the low T cell proliferation seen in response to the iDCs was unaltered by transfection (Fig. 3B), while following maturation, the transfected mDCs retained their capacity to stimulate allogeneic MLR (Fig. 3B). Anti-CD71-Mediated Transfections of DC Progenitors Followed by Differentiation Since a maximal transfection efficiency of ~15% (as seen with anti-CD71 on iDCs) may not be sufficient in many clinical settings, we investigated an alternative protocol to try to improve the transfection efficiency. Instead of transfecting iDCs, we extended the anti-CD71 receptormediated transfection to DC progenitors (adherenceenriched monocytes), since these express CD71 at levels comparable to those of iDCs (Fig. 1A, left). This antiCD71-mediated transfection of progenitors gave higher transfection efficiency (20–30% with Tfx-50) than transfection of iDCs (Figs. 4A and 4B, left). Following transfection, the progenitors could be readily differentiated into iDCs and mDCs without any difference in the phenotype of the resulting DCs compared to untransfected progenitors (Fig. 4C). No effect was seen on the functional ability of these transfected and differentiated progenitors to stimulate a MLR in either the immature or the mature state (Fig. 4D). In cases in which 20–30% transfection efficiency is not sufficient, drug selection during the differentiation can be used. In our case, in which the plasmid encodes the neomycin-resistant gene,

791

ARTICLE

doi:10.1016/j.ymthe.2004.12.009

FIG. 1. Transfection of DCs with CD71- and CD205-receptor-mediated methods. (A) Prior to transfection of DCs the expression of CD71 and CD205 on iDCs and mDCs was determined using flow cytometry, with staining by the isotype control shown in solid black. (B) The ability of the Abs to target immunolipoplexes to iDCs and mDCs was determined using Cy5-labeled DNA complexed with three different liposome preparations (Tfx-50, Lipofectin, LipofectAMINE) in conjunction with anti-CD71, anti-CD205, or no Ab (black background is untreated cells). (C) The internalization kinetics of immunolipoplexes in iDCs and mDCs, made with the three different liposomes and anti-CD71, anti-CD205, or no Ab, was determined using flow cytometry. The data shown are the means F SD of triplicates. All data shown are representative of at least three experiments.

G418 selection resulted in close to 100% GFP-positive cells (Fig. 4B, right). Comparison of Immunolipoplex-Mediated Transfection with Adenoviral Vector In accordance with previous reports [5–8], we have shown that adenoviral vectors are efficient at transducing DCs, achieving greater than 80% transfection efficiency. We have further confirmed [7,8] that exposure of iDCs to either GFP-encoding (AdGFP) or control (Ad0) virus (m.o.i. 500) resulted in upregulation of both costimulatory molecules (such as CD40, CD80, and ICOS L) and MHC class I or II molecules on iDCs (Fig. 5A). This effect may due to viral particle entry into cells via a CD40-

792

independent pathway [7]. However, no augmentation of the expression of these molecules following exposure of mDC to viral particles was seen in this study (data not shown). Consistent with other observations [8] we have shown that at high MOI, needed to achieve high transfection efficiency, the capacity of mDCs to stimulate allogeneic T cells in an MLR was reduced (Fig. 5B). This reflects a response of the DCs to viral transduction, with an increased level of expression of the enzyme indoleamine 2,3-dioxygenase (IDO) [61]. As expected from the phenotypic activation of iDCs by rAd vectors, transduced iDCs had an increased capacity to stimulate allogeneic T cells. As shown above, transfection with immunolipoplexes had no effect on DC function. As previously

MOLECULAR THERAPY Vol. 11, No. 5, May 2005 Copyright C The American Society of Gene Therapy

doi:10.1016/j.ymthe.2004.12.009

ARTICLE

FIG. 2. Transfection efficiency and toxicity of lipoplexes and immunolipoplexes. (Top) The transfection efficiency of iDCs and mDCs was determined using flow cytometry following transfection of pCMV-EGFP plasmid by lipoplexes or immunolipoplexes formed with either anti-CD205 or anti-CD71 antibodies. Three different liposome preparations (Tfx50, Lipofectin, and LipofectAMINE) were used. Results are means F SD of three independent experiments. (Bottom) The toxicity of liposomes and anti-CD71 and anti-CD205 immunolipoplexes was assessed using trypan blue exclusion. Results are means F SD of three independent experiments.

reported [32], transduction with rAd resulted in secretion of Th1 cytokines (IFN-g and interleukin-12 (IL-12)), IL1h, IL-6, IL-8, and TNF-a in iDCs as well as IFN-g in mDCs but we saw no increase in cytokine secretion following plasmid, lipoplex, and immunolipoplex transfection (Supplementary Fig. 2). Immunolipoplex-Mediated Delivery of the IDO Gene (INDO) and a Selection Protocol for IDO-Transfected DCs IDO has been shown to have an important role in downregulating immune responses, both in immuneprivileged sites such as the placenta [33] and in a subset of tolerogenic DCs [34,35]. We therefore investigated whether overexpression of IDO in either iDCs or mDCs would be effective in blocking the allogeneic T cell response seen in an MLR. As described above, we transfected monocytes using immunolipoplexes with a plasmid encoding murine IDO before they were differentiated into iDCs or (following activation) mDCs. As shown in Fig. 6A, both iDCs and mDCs treated in this manner overexpressed murine IDO (detected in human cells using murine-specific antibodies). The levels of IDO were increased if the DCs were drug selected following transfection. Densitometry analysis indicated that the level of expression following drug treatment was approx-

MOLECULAR THERAPY Vol. 11, No. 5, May 2005 Copyright C The American Society of Gene Therapy

imately twice that seen without selection. This is not as great an increase as would be expected if the original transfection efficiency were 20–30%, possibly reflecting differences in the efficiency of IDO expression compared to the marker gene. As expected, with the exception of IDO, there was no difference in the phenotypes of monocytes, iDCs, or mDCs, following transfection using immunolipoplexes. To determine the functional consequences of IDO transfection, we used both iDCs and mDCs as stimulators in an MLR. We either left the cells untransfected or transfected them with a mock plasmid or IDO-encoding plasmid. We either drug selected transfected DCs (which would be expected, based on the data obtained with EGFP transfection, to result in close to 100% of cells expressing IDO) or left them unselected (which would result in 20–30% transfection efficiency). As shown, expression of IDO (either with or without drug selection) abolished the ability of iDCs or mDCs to stimulate an MLR (Fig. 6B). It should be noted that untransfected iDCs were considerably less efficient stimulators than mDCs. The effect of IDO transfection was abolished by addition of the competitive inhibitor of IDO, 1-methyltryptophan (1-MT). While T cells exposed to IDO-transfected DCs (mDCs or iDCs) did not proliferate, they did secrete increased levels

793

ARTICLE

doi:10.1016/j.ymthe.2004.12.009

FIG. 3. Effects of anti-CD71 and anti-CD205 transfection on DC phenotype and function. (A) iDCs were either untransfected or transfected with immunolipoplexes made with anti-CD71 or anti-CD205 mAb. The phenotype of the cells was then determined by flow cytometry either as iDCs (top two rows) or following maturation into mDCs by treatment with a cocktail of inflammatory agents (bottom two rows). (B) The functional effects of transfection were also determined in MLR. Cells (either iDCs or mDCs) were either untransfected or transfected with anti-CD71 or anti-CD205 immunolipoplexes. In some cases the iDC were activated with the cocktail of inflammatory stimuli. The ability of these cells to induce an allogeneic MLR was tested. [3H]Thymidine incorporation was analyzed on day 5 and expressed as the mean F SD of triplicates. All data shown are representative of at least three experiments.

of IL-10 (as determined by ELISA of culture supernatants), with decreased IFN-g, IL-1h, IL-4, IL-12, and TNF-a compared with those exposed to control DCs (Supplementary Fig. 3). Generation of Anergic T Cells after Coculture with IDO-Tansfected DCs To determine if T cells exposed to DC expressing IDO had become anergic, we carried out two-step cultures. We cocultured naRve allogeneic T cells with DCs (transfected with IDO or mock plasmid) for 5 days and then let them rest for 2 days. We then rechallenged them with either mDC from the same donor or third party DCs. We assessed proliferation on days 3, 5, and 7 to differentiate between a primary and a secondary response. T cells previously exposed to IDO-transfected DCs failed to respond to mDCs from the same donor, although they did respond to third party DCs with kinetics typical of a primary response (peak at day 5) (Fig. 7A). T cells stimulated with control DCs in the first culture showed a subsequent rapid response to DCs from the same donor, typical of a secondary immune response

794

(peak at day 3). The third party response of T cells that were cocultured with IDO-transfected DCs was little lower than that of the control cultures. This is consistent with the large number of apoptotic cells that were seen following culture with IDO-transfected DCs (Fig. 7B), as determined by annexin V and propidium iodide staining. The T cells exposed to IDO-expressing DC had high levels of p27kip1 (Fig. 7C), consistent with their anergic phenotype [36,37]. As expected, the hyporesponsiveness of the T cells could be somewhat reversed by addition of exogenous rIL-2, consistent with the lack of responsiveness being due to a combination of anergy induction and apoptosis.

DISCUSSION Human DCs can be prepared using CD34+ progenitor cells from several sources or using CD14+ progenitors of the monocyte lineage from peripheral blood. We focused on the latter approach, because it is logistically the simplest and is generally applicable for therapy. Genetic manipulation of these DCs is a promising approach for

MOLECULAR THERAPY Vol. 11, No. 5, May 2005 Copyright C The American Society of Gene Therapy

doi:10.1016/j.ymthe.2004.12.009

ARTICLE

FIG. 4. Transfection of DC precursors can generate transfected DCs with unaltered phenotype and function. CD14+ progenitors of DCs (monocytes) were generated from PBL. These progenitor cells were transfected with liposomes made with Tfx50 (T), Lipofectin (L), or LipofectAMINE (LA) or with immunoliposomes formed between the same liposomes and anti-CD71 Ab. The monocytes were differentiated into iDCs using GM-CSF and IL4. (A) Transfection efficiency was determined using flow cytometry; each circle represents an individual subject. (B) A representative experiment is shown, both using iDCs (top) and following incubation with inflammatory cytokines (bottom), indicating EGFP expression either by visualization by fluorescence microscopy (counterstained with propidium iodide, the percentage positive indicated) (left) or by FACS (right). While transfection efficiencies of 20–30% are achievable, it is possible to obtain essentially 100% transfected DCs if the differentiation into DCs is carried out in the presence of G418, as demonstrated by both fluorescence microscopy and FACS staining (right). (C) The phenotype of transfected cells, both with and without maturation with inflammatory agents, is shown (top left, iDC; top right, DC following maturation with inflammatory agents), untransfected cells are shown on the bottom. (D) The ability of these cells (both iDCs and mDCs) to stimulate allogeneic T cells in a MLR is shown. The results are shown as a representative experiment of at least five experiments.

immunization in the treatment of a range of diseases, including cancer and infectious diseases, as well as for tolerance-inducing strategies for allergy, transplant rejection, and autoimmune diseases. The therapeutic application of iDCs in treating allergy, transplant rejection, and autoimmune diseases requires a strategy for manipulating DCs without activation of the cells. Adenoviral vectors yield transfection efficiencies exceeding 80%, but these vectors deliver viral genes and proteins together with the inserted constructs [38]. This has several consequences. First, the resulting immunogenicity of the DC can reduce the effectiveness of repeat dosing due to the generation of an antiviral response. Second, viral proteins can interfere with DC function, for example, by altering antigen processing or presentation.

MOLECULAR THERAPY Vol. 11, No. 5, May 2005 Copyright C The American Society of Gene Therapy

Third, the presentation of virally encoded immunodominant peptides may interfere with the presentation of other antigens. These can result in the reduction of the capacity of mDCs to stimulate antigen-specific T cells. In addition, the use of viral vectors to transduce iDCs can result in activation of these cells, creating problems when the iDCs are to be used for tolerance induction. Furthermore, achieving robust, large-scale manufacture, quality control, and storage of viruses presents additional problems. In contrast, the receptor-mediated system outlined in this paper avoids these problems, although the transfection efficiency of these immunolipoplex vectors is not as high as that achieved with viruses (~20% vs 80–100%). For some applications this may be sufficient, since human DCs transfected at b20% efficiency were able to

795

ARTICLE

doi:10.1016/j.ymthe.2004.12.009

FIG. 5. Comparison of adenovirus-mediated transduction of DCs with immunolipoplexes. (A) iDCs were transduced with AdGFP (right) or control Ad0 (middle) at a m.o.i. of 500:1 or left untransduced (iDCs). They were then analyzed by flow cytometry on day 3 for expression of the markers indicated. In the case of cells transduced with AdGFP, the results are shown for cells gated for the expression of GFP (i.e., transfected cells). The results shown are one of three representative experiments. (B) The functional consequence of these phenotypic changes was tested in MLRs to evaluate the capacity of the DCs to stimulate allogeneic T cells. The cells (iDCs or mDCs) were transduced with rAd, lipoplexes, or anti-CD71 immunolipoplexes, or with DNA alone, and then used as stimulators in a MLR. The results shown are one of three representative experiments and show the mean F SD of triplicate cultures.

FIG. 6. Overexpression of mouse IDO using immunolipoplexes resulting in inhibition of allogeneic T cell proliferation. Monocytes were transfected on day 2 using immunolipoplexes carrying mouse IDO plasmid or control plasmid (labeled mock) and then differentiated into DC using IL-4 and GM-CSF with (mDC) or without (iDC) the addition of proinflammatory agents on day 8. In some cases G418 was used to select for transfected cells (labeled selected). (A) The expression of mouse IDO levels was determined by Western blotting with mAb specific for mouse IDO. The densities of the IDO bands (normalized to h-actin) are shown below, as the means F SD of three experiments. (B) These cells were then used in MLR either in the absence (left) or in the presence (right) of 1MT. The [3H]thymidine incorporation was measured on day 5. The results are means F SD of triplicate wells.

796

MOLECULAR THERAPY Vol. 11, No. 5, May 2005 Copyright C The American Society of Gene Therapy

doi:10.1016/j.ymthe.2004.12.009

stimulate in vitro expansion and activation of antigenspecific, autologous CD8+ T cells for recall antigens, resulting in their lytic activity on target cells in cancer immunization [39]. In addition, functional potency following transfection with a gene encoding tumor antigens may exceed that predicted from the level of detectable transfected DCs, partly because DCs expressing antigen-encoding genes at undetectable levels can stimulate antigen-specific T cell responses [40] and partly because antigen may be transferred readily from DCs producing it endogenously to other DCs [41]. Both anti-CD71 and anti-CD205 immunolipoplexes gave robust DC transfection, with 10–20% of iDCs expressing EGFP at readily detectable levels after treatment with anti-CD71 immunolipoplexes, although little expression was seen in mDC. In contrast, anti-CD205 immunolipoplexes gave lower efficiency (~10%) but equivalent levels of expression in both iDCs and mDCs. These efficiencies greatly exceed that observed for nonAb-targeted immunolipoplexes. An increased transfection efficiency (20–30%) was achieved using anti-CD71 immunolipoplexes with DC monocyte progenitors. These cells were able to differentiate to phenotypically and functionally normal iDCs and mDCs. Drug selection in this DC progenitor system led to almost 100% of cells expressing the marker gene. DCs, according to their maturation status, have the potential to induce either immune activation (mDC) or tolerance (iDC). Importantly, transfection with our immunolipoplexes does not alter either the phenotype or the function of the target monocytes, iDCs and mDCs, and thus is suitable for both positive and negative modulation of the immune response. The choice of targeting mAbs was based upon their ability to induce receptor-mediated endocytosis. Although anti-CD71 gave higher levels of transfection, the anti-CD205 provides a greater degree of specificity since its expression is more limited. In this respect, the technique has an advantage over peptide-mediated gene transfer [39]. Moreover, recent experiments in the murine system indicate that in vivo antigen targeting using anti-CD205 mAb leads to CD4 and CD8 T cell tolerance rather than activation, indicating that anti-CD205 immunolipoplexes may be particularly important for immune downregulation in autoimmunity, allergy, and transplantation [42,43]. In contrast, the anti-CD71 immunolipoplex system using DC progenitors matured through to mDC is likely to be more effective in generating an immune response in situations such as cancer and infectious disease. For clinical application, a potential drawback of our system is the lower transfection efficiency in comparison with viral strategies. However, in our hands, 107 DCs can reliably be generated from 150 ml of peripheral blood; immunolipoplex-mediated transfection of these cells results in reliable generation of DC preparations containing ~105–106 transfected cells (taking into account the

MOLECULAR THERAPY Vol. 11, No. 5, May 2005 Copyright C The American Society of Gene Therapy

ARTICLE

toxicity). For some clinical applications this would be sufficient; however, more cells could be generated following either donation of larger amounts of blood or leukapheresis. To prove this approach could have immunotherapeutic application, we have investigated the effects of expressing the enzyme IDO in DC. Cells expressing IDO, an enzyme that catabolizes tryptophan, prevent T cell proliferation in vitro by depleting this essential amino acid [44]. Activated T cells experiencing growth arrest due to tryptophan deprivation have an increased tendency to die via apoptosis through Fas–FasL interactions (Fig. 7B) [44]. In addition the breakdown products of tryptophan catabolism (kynurenines) may also have an effect on both the viability and the function of T cells [45]. IDO is found not only in immune-privileged sites, such as the placenta [33], but also in a subset of DCs (CD123 CCR4 in human [34] and CD8a+ in the mouse [35]) that are naturally tolerogenic. IDO is also upregulated in DCs when CD80/86 is crosslinked with CTLA4-Ig [46] or CTLA4 expressed on the surface of regulatory T cells [47]. Overexpression of IDO in macrophages [48] and a fibrosarcoma cell line [49] has been shown to inhibit allogeneic T cell proliferation. We have now shown that overexpression of IDO using immunoliposome transfection by either iDCs or, more impressively, by mDCs will also result in production of the anti-inflammatory cytokine IL-10 (Supplementary Fig. 3). The transfection of IDO had a strong immunoregulatory effect even when the DCs were not drug selected, indicating that this strategy could be effective even when only a portion (20–30%) of the DCs express the gene of interest. We went on to show that the exposure of T cells to IDOtransfected DCs increases the amount of apoptosis seen and can also result in anergy of the remaining DC (Figs. 7A and 7C). This indicates that both deletional and anergic mechanisms operate, which is consistent with the consequences of both tryptophan depletion (apoptosis) and frustrated T cell activation (anergy). In summary, we have demonstrated a robust, nonviral method to transfect DCs or their progenitors. This has an advantage over the use of rAd in that it does not alter the phenotype or function of the DCs. We have shown that transfection of DC with IDO allows the generation of DC that are capable of generating anergic T cells. This, together with the known consequences of IDO expression on immune function, indicates that this strategy might be effective in the generation of tolerogenic DC for clinical vaccination, for example in the context of transplantation or autoimmune disease. Additionally, receptor-mediated transfection provides a convenient and rapid means of transfecting DCs for fundamental, preclinical, and clinical research purposes without the need to generate viral vectors. It could be used, for example, to screen rapidly novel genes encoding the numerous candidate antigens or immunomodulatory proteins that are emerging from

797

ARTICLE

doi:10.1016/j.ymthe.2004.12.009

FIG. 7. Generation of anergic T cells after coculture with IDO-transfected mDCs. (A) Purified T cells (106) were cocultured with mDCs (10:1 ratio), which were either untransfected or transfected with IDO or mock plasmid. After 5 days, T cells were rested in culture for a further 2 days. The cells were then put into fresh culture either with mDCs from the same donor (i and iii) or with third party mDCs (ii and iv) at a 5:1 ratio in the presence (iii and iv) or absence (i and ii) of 10 U/ml exogenous rIL-2. The proliferation of T cells was determined by [3H]thymidine incorporation on days 3, 5, and 7. The results are expressed as the means F SD of triplicate wells. (B) The recovered T cells from the coculture with either untransfected mDCs or mDCs transfected with IDO or mock plasmid were analyzed using annexin V-FITC and propidium iodide (PI) staining followed by flow cytometry on day 5. The y axis represents PI staining and x axis represents annexin V-FITC. (C) T cells exposed to untransfected DCs, mock-transfected DCs, or IDO-transfected DCs were analyzed for expression of p27kip1 and h-actin expression by Western blotting.

genomics to identify those giving optimal immunity or tolerance.

5% CO2 atmosphere for 5–10 days. DCs were matured (to give mDC) in 20 ng/ml TNF-a (PreproTech, London, UK), 20 ng/ml IL-1h (PreproTech), 20 ng/ml LPS (Sigma), 10 ng/ml PGE2 (Sigma), 20 ng/ml IFN-g (PreproTech) for 48 h. All reagents were obtained from Sigma unless stated otherwise.

MATERIALS AND METHODS

Adenovirus production. The E1a , partial E1b , partial E3 adenovirus serotype 5 vector Ad0 (a kind gift from Dr. M. J. A Wood, Human Anatomy, University of Oxford, Oxford, UK) and AdGFP (carrying the enhanced green fluorescence protein-1; Clontech, Palo Alto, CA, USA) were amplified and titered using a standard plaque assay on 293 cells as previously described [51]. For transduction, 104 cells were incubated with adenovirus vectors (Ad0 or AdGFP at a MOI of 500) in 100 Al OptiMEM I for 2–3 h at which time the volume was increased to 0.5 ml by addition of DC culture medium.

DC preparation and cultures. Human DC were generated from peripheral blood monocytes by treatment with granulocyte–macrophage colony stimulating factor (GM-CSF) and IL-4 as described [50]. Peripheral blood mononuclear cells were isolated from buffy coat preparation of healthy donors by Ficoll–Hypaque centrifugation (density of 1.077 g/cm3) followed by plastic adherence to enrich monocytes and CD14 bead selection. The nonadherent cell fraction was used for T cell isolation as described below. To obtain immature DCs, adherent cells were cultured in X-Vivo 10 medium (BioWhittaker, Cambridge, UK) containing 10% human serum (Sigma, Poole, UK), 2 mM l-glutamine (Invitrogen, Paisley, UK), 100 U/ml penicillin and streptomycin (Invitrogen) in the presence of GM-CSF (20 ng/ ml) (Firstlink, Birmingham, UK) and IL-4 (20 ng/ml) (Firstlink) at 378C in

798

Lipoplex preparations. Several lipid formulations were used in this study: Tfx-50 (Promega, Southampton, UK), Lipofectin, LipofectAMINE 2000 (Invitrogen), Effectene (Qiagen, Crawley, UK), DOTAP, FuGENE 6, X-treme Gene Q2 (Roche Diagnostic, Basel, Switzerland), and CLONfec-

MOLECULAR THERAPY Vol. 11, No. 5, May 2005 Copyright C The American Society of Gene Therapy

ARTICLE

doi:10.1016/j.ymthe.2004.12.009

tin (Clontech). The lipids were prepared according to the manufacturers’ instructions. The plasmids encoding EGFP under the control of the CMV promoter were prepared and purified as previously described [25]. The DNA/lipid compound ratio (Tfx-50 1:3, Lipofectin 1:3, LipofectAMINE 2000 1:8, Effectene 1:25, DOTAP 1:8, FuGENE 6 1:5, X-treme Gene Q2, 1:6, CLONfectin, 1:8) and incubation time were selected according to the manufacturers’ recommendation [29]. For transfection, DCs (either iDCs or mDCs) were harvested and washed twice in PBS without Ca2+ and Mg2+, and the pellet was then gently resuspended in the DNA–liposomal complexes in OptiMEM I in a total volume of 250 Al at room temperature for 30 min. The cells were left at 378C for 3–4 h. Immunolipoplex preparation. Immunoliposomes were prepared as previously described by us [25]. In brief, heat-aggregated mAb (either antiCD71 (OKT9) [52] or anti-CD205 (MR6) [53]) was mixed with plasmid DNA and liposomes (Tfx-50, Lipofectin, and LipofectAMINE) for 30 min at room temperature (in a total volume of 250 Al) prior to addition to cells. This method allows production of relatively stable immunoliposomes [25]. The immunoliposomes were then incubated with DNA at the ratio recommended for the lipoplexes in accordance with the manufacturers’ guidelines. The resulting transfection complexes were added to 105 freshly prepared DCs. Plasmid internalization assays. The plasmids were labeled with Cy5 (Amersham Pharmacia Biotech, Little Chalfont, UK) in accordance with the manufacturer’s instructions. Internalization of the complexes was determined as previously described [54]. Other nonviral vector transfections. PEI (Sigma) [55], ExGen 500 (TCS Cellworks, Buckingham, UK), SuperFect (Qiagen), and calcium phosphate (Invitrogen) were used in accordance with manufacturers’ instructions. Electroporation was carried out at 250 V, 1500 AF, and a pulse time of 34 ms, as previously described [28]. Mixed lymphocyte reactions and rechallenge experiments. MLRs were carried out as described [56]. Various T cells were purified as previously described using magnetic beads. For investigation into the induction of anergy by treated DCs, MLRs were performed using DCs as stimulators after which the T cells were then Ficoll purified and rested. On the second day of resting, the T cells were rechallenged with allogeneic DCs from the same donor as the original DCs. Challenge with allogeneic third-party DCs was used as a control. The cultures were pulsed with [3H]thymidine after 48 h, and proliferation was measured. When appropriate, 500 AM 1MT was added into MLR. Flow cytometry. The phenotype of transfected or untransfected DCs was assessed by flow cytometry 48 h after transfection (nonviral vector) or 72 h after adenoviral transfection. These times were determined in preliminary experiments when the maximal expression of transgenes was seen. Cell staining was performed using mouse Ab conjugated with allophycocyanin (APC) or primary Ab followed by goat anti-mouse– APC, as previously described [25]. Flow cytometric analysis of all cells was performed using the following mouse monoclonal Abs: 3.9 (antiCD11c), BA-8 (anti-CD14) (Santa Cruz Biotechnology, Santa Cruz, CA, USA), HB14 (anti-CD40), MEM-233 (anti-CD80) (Serotec, Oxford, UK), HB15e (anti-CD83), UB63 (anti-CD86), TU149 (anti-MHC class I), CR3/ 43 (anti-HLA-DR) (Dako, Glostrup, Denmark), and 3D2 (anti-ICOS L) (Neomarker, Fremont, CA, USA). All Abs were obtained from Caltag (Silverstone, UK), unless stated otherwise. Assessment of EGFP reporter gene expression. Following transfection, the EGFP reporter gene (Clontech) expression was determined using flow cytometry or an inverted fluorescence microscope as previously described [25]. ELISA. Supernatants were obtained from DCs (iDCs or mDCs) following transfection on day 3. The levels of cytokines in supernatant were determined. ELISAs for IFN-g, IL-4, IL-10, and IL-12 were carried out as previously described [57]. IL-1h, IL-6, IL-8, and TNF-a were measured using an ELISA kit from R&D Systems (Oxon, UK).

MOLECULAR THERAPY Vol. 11, No. 5, May 2005 Copyright C The American Society of Gene Therapy

Cloning of IDO. The murine IDO gene (approved gene symbol Indo) was amplified from a mouse DC cDNA library with the primer pair AT CGGGCGCGCCGT GGG GGGT CAGT GGAG TA G (sense ) and ATCGGGTACCACTAGTAACGGCCGCCAGCAGT (antisense) using PCR protocols as previously described with an annealing temperature of 588C [58]. The mouse IDO gene was cloned into the mammalian expression vector pCR3.1 (Invitrogen) using TA cloning (Invitrogen) in accordance with the manufacturer’s instructions. Orientation of the IDO insert was assessed by restriction. Western blots. IDO protein levels were measured using Western blotting as previously described [56]. Briefly DCs were lysed with lysis buffer (Reporter Lysis 5 Buffer; Promega, Southampton, UK) in the presence of 1 Al of protease inhibitor (P8340; Sigma) per 1 ml of lysis buffer. Ten micrograms of protein was separated by SDS–PAGE (8%) and blotted onto PVDF membranes. Nonspecific binding was blocked with 5% nonfat dry milk powder in TBS/Tween (50 mmol/L Tris–HCl, pH 8, 150 mM NaCl, 2.5 mM KCl, and 0.1% Tween 20). After incubation with rabbit anti-mouse IDO mAb [59,60] (kindly provided by Dr. O. Takikawa, Department of Pharmacology, Hokkaido University, Sapporo, Japan) (1:250 in 5% milk, 2 h), the blots were washed three times in TBS/Tween and then incubated with HRP-conjugated secondary Ab, swine anti-rabbit IgG (Dako) for 1 h (1:4000), followed by detection with enhanced chemiluminescence (ECL Western Blotting Detection Reagent) (Amersham Pharmacia Biotech). Annexin V–propidium iodide staining. Detection of early apoptotic cells was performed by means of the annexin V–propidium iodide (PI) detection kit (BD Biosciences, Oxford, UK). Briefly, 106 isolated T cells (on day 6) were washed with Dulbecco’s modified Eagle medium, incubated in the dark at 48C with annexin V–fluorescein isothiocyanate (annexin V–FITC) and PI for 15 min and then analyzed by dualcolor flow cytometry. Cells that were annexin V–FITC positive (indicating translocation of phosphatidylserine from the inner to the outer leaflet of the plasma membrane) and PI negative (with intact cellular membrane) were considered early apoptotic cells.

NOTE ADDED IN PROOF While this manuscript was under consideration, another paper was published in which adenovirus was used to transducer murine dendritic cells with the gene encoding IDO. This resulted in inhibition of murine allogeneic T cell responses, similar to that seen by us in the human setting using immunolipolexes. Funeshima N., Fujino M., Kitazawa Y., Hara Y., Hara Y., Hayakawa K., Okuyama T., Kimura H., and Li X-K. (2004). Inhibition of allogeneic T-cell responses by dendritic cells expressing transduced indole amine 2,3-dioxygenase. J. Gene. Med. doi 10.1002/jgm.698.

ACKNOWLEDGMENTS The authors thank M. Manunta for technical support. Rabbit anti-mouse IDO Ab was kindly provided by Osamu Takikawa, Department of Pharmacology, Hokkaido University, Sapporo 060-8638, Japan. The work is supported by the MRC and the Royal College of Surgeons Edinburgh (RCS (Ed)) and the BBSRC. A.J.T.G. is a BBSRC Research Development Fellow, P.H.T. is a MRC, RCS (Ed) Training Research Fellow. S.C.B. is supported by Gettrud-Kusen-Stiftung, Hamburg, Germany.

APPENDIX A. SUPPLEMENTARY DATA Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ymthe.2004. 12.009. RECEIVED FOR PUBLICATION JUNE 24, 2004; ACCEPTED DECEMBER 17, 2004.

REFERENCES 1. Banchereau, J., et al. (2000). Immunobiology of dendritic cells. Annu. Rev. Immunol. 18: 767 – 811.

799

ARTICLE

2. Lanzavecchia, A., and Sallusto, F. (2000). Dynamics of T lymphocyte responses: intermediates, effectors, and memory cells. Science 290: 92 – 97. 3. Lechler, R., Ng, W. F., and Steinman, R. M. (2001). Dendritic cells in transplantationfriend or foe? Immunity 14: 357 – 368. 4. Lipscomb, M. F., and Masten, B. J. (2002). Dendritic cells: immune regulators in health and disease. Physiol. Rev. 82: 97 – 130. 5. Dietz, A. B., and Vuk-Pavlovic, S. (1998). High efficiency adenovirus-mediated gene transfer to human dendritic cells. Blood 91: 392 – 398. 6. Diao, J., et al. (1999). Human PBMC-derived dendritic cells transduced with an adenovirus vector induce cytotoxic T-lymphocyte responses against a vector-encoded antigen in vitro. Gene Ther. 6: 845 – 853. 7. Hirschowitz, E. A., Weaver, J. D., Hidalgo, G. E., and Doherty, D. E. (2000). Murine dendritic cells infected with adenovirus vectors show signs of activation. Gene Ther. 7: 1112 – 1120. 8. Jonuleit, H., et al. (2000). Efficient transduction of mature CD83+ dendritic cells using recombinant adenovirus suppressed T cell stimulatory capacity. Gene Ther. 7: 249 – 254. 9. Takayama, T., et al. (1998). Retroviral delivery of viral interleukin-10 into myeloid dendritic cells markedly inhibits their allostimulatory activity and promotes the induction of T-cell hyporesponsiveness. Transplantation 66: 1567 – 1574. 10. Westermann, J., et al. (1998). Retroviral interleukin-7 gene transfer into human dendritic cells enhances T cell activation. Gene Ther. 5: 264 – 271. 11. Akiyama, Y., et al. (2000). Enhancement of antitumor immunity against B16 melanoma tumor using genetically modified dendritic cells to produce cytokines. Gene Ther. 7: 2113 – 2121. 12. Buonocore, S., et al. (2002). Dendritic cells transduced with viral interleukin 10 or Fas ligand: no evidence for induction of allotolerance in vivo. Transplantation 73: S27 – 30. 13. Temme, A., et al. (2002). Efficient transduction and long-term retroviral expression of the melanoma-associated tumor antigen tyrosinase in CD34(+) cord blood-derived dendritic cells. Gene Ther. 9: 1551 – 1560. 14. Negre, D., et al. (2000). Characterization of novel safe lentiviral vectors derived from simian immunodeficiency virus (SIVmac251) that efficiently transduce mature human dendritic cells. Gene Ther. 7: 1613 – 1623. 15. Gruber, A., et al. (2000). Dendritic cells transduced by multiply deleted HIV-1 vectors exhibit normal phenotypes and functions and elicit an HIV-specific cytotoxic Tlymphocyte response in vitro. Blood 96: 1327 – 1333. 16. Brown, M., et al. (2000). Dendritic cells infected with recombinant fowlpox virus vectors are potent and long-acting stimulators of transgene-specific class I restricted T lymphocyte activity. Gene Ther. 7: 1680 – 1689. 17. Miller, G., et al. (2002). Adenovirus infection enhances dendritic cell immunostimulatory properties and induces natural killer and T-cell-mediated tumor protection. Cancer Res. 62: 5260 – 5266. 18. Rea, D., et al. (1999). Adenoviruses activate human dendritic cells without polarization toward a T-helper type 1-inducing subset. J. Virol. 73: 10245 – 10253. 19. Mitchell, D. A., and Nair, S. K. (2000). RNA-transfected dendritic cells in cancer immunotherapy. J. Clin. Invest. 106: 1065 – 1069. 20. Van Tendeloo, V. F., et al. (2001). Highly efficient gene delivery by mRNA electroporation in human hematopoietic cells: superiority to lipofection and passive pulsing of mRNA and to electroporation of plasmid cDNA for tumor antigen loading of dendritic cells. Blood 98: 49 – 56. 21. Heiser, A., et al. (2002). Autologous dendritic cells transfected with prostate-specific antigen RNA stimulate CTL responses against metastatic prostate tumors. J. Clin. Invest. 109: 409 – 417. 22. Su, Z., et al. (2002). Enhanced induction of telomerase-specific CD4(+) T cells using dendritic cells transfected with RNA encoding a chimeric gene product. Cancer Res. 62: 5041 – 5048. 23. Sullenger, B. A., and Gilboa, E. (2002). Emerging clinical applications of RNA. Nature 418: 252 – 258. 24. Milazzo, C., et al. (2003). Induction of myeloma-specific cytotoxic T cells using dendritic cells transfected with tumor-derived RNA. Blood 101: 977 – 982. 25. Tan, P. H., et al. (2003). Antibody targeted gene transfer to endothelium. J. Gene Med. 5: 311 – 323. 26. Huebers, H. A., and Finch, C. A. (1987). The physiology of transferrin and transferrin receptors. Physiol. Rev. 67: 520 – 582. 27. McKay, P. F., et al. (1998). The gp200-MR6 molecule which is functionally associated with the IL-4 receptor modulates B cell phenotype and is a novel member of the human macrophage mannose receptor family. Eur. J. Immunol. 28: 4071 – 4083. 28. Van Tendeloo, V. F., et al. (1998). Nonviral transfection of distinct types of human dendritic cells: high-efficiency gene transfer by electroporation into hematopoietic progenitor- but not monocyte-derived dendritic cells. Gene Ther. 5: 700 – 707. 29. Rughetti, A., et al. (2000). Transfected human dendritic cells to induce antitumor immunity. Gene Ther. 7: 1458 – 1466.

800

doi:10.1016/j.ymthe.2004.12.009

30. Jiang, W., et al. (1995). The receptor DEC-205 expressed by dendritic cells and thymic epithelial cells is involved in antigen processing. Nature 375: 151 – 155. 31. Garrett, W. S., et al. (2000). Developmental control of endocytosis in dendritic cells by Cdc42. Cell 102: 325 – 334. 32. Morelli, A. E., et al. (2000). Recombinant adenovirus induces maturation of dendritic cells via an NF-kappaB-dependent pathway. J. Virol. 74: 9617 – 9628. 33. Munn, D. H., et al. (1998). Prevention of allogeneic fetal rejection by tryptophan catabolism. Science 281: 1191 – 1193. 34. Munn, D. H., et al. (2002). Potential regulatory function of human dendritic cells expressing indoleamine 2,3-dioxygenase. Science 297: 1867 – 1870. 35. Fallarino, F., et al. (2002). Functional expression of indoleamine 2,3-dioxygenase by murine CD8 alpha(+) dendritic cells. Int. Immunol. 14: 65 – 68. 36. Boussiotis, V. A., et al. (2000). p27kip1 functions as an anergy factor inhibiting interleukin 2 transcription and clonal expansion of alloreactive human and mouse helper T lymphocytes. Nat. Med. 6: 290 – 297. 37. Greenwald, R. J., et al. (2001). CTLA-4 regulates induction of anergy in vivo. Immunity 14: 145 – 155. 38. Yang, Y., Li, Q., Ertl, H. C., and Wilson, J. M. (1995). Cellular and humoral immune responses to viral antigens create barriers to lung-directed gene therapy with recombinant adenoviruses. J. Virol. 69: 2004 – 2015. 39. Irvine, A. S., et al. (2000). Efficient nonviral transfection of dendritic cells and their use for in vivo immunization. Nat. Biotechnol. 18: 1273 – 1278. 40. Philip, R., et al. (1998). Transgene expression in dendritic cells to induce antigenspecific cytotoxic T cells in healthy donors. Cancer Gene Ther. 5: 236 – 246. 41. Knight, S. C., et al. (1998). Transfer of antigen between dendritic cells in the stimulation of primary T cell proliferation. Eur. J. Immunol. 28: 1636 – 1644. 42. Hawiger, D., et al. (2001). Dendritic cells induce peripheral T cell unresponsiveness under steady state conditions in vivo. J. Exp. Med. 194: 769 – 779. 43. Bonifaz, L., et al. (2002). Efficient targeting of protein antigen to the dendritic cell receptor DEC-205 in the steady state leads to antigen presentation on major histocompatibility complex class I products and peripheral CD8+ T cell tolerance. J. Exp. Med. 196: 1627 – 1638. 44. Lee, G. K., et al. (2002). Tryptophan deprivation sensitizes activated T cells to apoptosis prior to cell division. Immunology 107: 452 – 460. 45. Grohmann, U., Fallarino, F., and Puccetti, P. (2003). Tolerance, DCs and tryptophan: much ado about IDO. Trends Immunol. 24: 242 – 248. 46. Grohmann, U., et al. (2002). CTLA-4-Ig regulates tryptophan catabolism in vivo. Nat. Immunol. 3: 1097 – 1101. 47. Fallarino, F., et al. (2003). Modulation of tryptophan catabolism by regulatory T cells. Nat. Immunol. 4: 1206 – 1212. 48. Munn, D. H., et al. (1999). Inhibition of T cell proliferation by macrophage tryptophan catabolism. J. Exp. Med. 189: 1363 – 1372. 49. Mellor, A. L., et al. (2002). Cells expressing indoleamine 2,3-dioxygenase inhibit T cell responses. J. Immunol. 168: 3771 – 3776. 50. Zhou, L. J., and Tedder, T. F. (1996). CD14+ blood monocytes can differentiate into functionally mature CD83+ dendritic cells. Proc. Natl. Acad. Sci. USA 93: 2588 – 2592. 51. Bett, A. J., Haddara, W., Prevec, L., and Graham, F. L. (1994). An efficient and flexible system for construction of adenovirus vectors with insertions or deletions in early regions 1 and 3. Proc. Natl. Acad. Sci. USA 91: 8802 – 8806. 52. Hsu, S. M., Zhang, H. Z., and Jaffe, E. S. (1983). Monoclonal antibodies directed against human lymphoid, monocytic, and granulocytic cells: reactivities with other tissues. Hybridoma 2: 403 – 412. 53. de Maagd, R. A., et al. (1985). The human thymus microenvironment: heterogeneity detected by monoclonal anti-epithelial cell antibodies. Immunology 54: 745 – 754. 54. Manunta, M., et al. (2004). Gene delivery by dendrimers operates via a cholesterol dependent pathway. Nucleic Acids Res. 32: 2730 – 2739. 55. Diebold, S. S., et al. (1999). Mannose polyethylenimine conjugates for targeted DNA delivery into dendritic cells. J. Biol. Chem. 274: 19087 – 19094. 56. Tan, P. H., et al. (2004). Phenotypic and functional differences between human saphenous vein (HSVEC) and umbilical vein (HUVEC) endothelial cells. Atherosclerosis 173: 171 – 183. 57. Jordan, W. J., et al. (2004). IL-13 production by donor T cells is prognostic of acute graft-versus-host disease following unrelated donor stem cell transplantation. Blood 103: 717 – 724. 58. King, W. J., et al. (2000). Cytokine and chemokine expression kinetics after corneal transplantation. Transplantation 70: 1225 – 1233. 59. Mackler, A. M., Barber, E. M., Takikawa, O., and Pollard, J. W. (2003). Indoleamine 2,3-dioxygenase is regulated by IFN-gamma in the mouse placenta during Listeria monocytogenes infection. J. Immunol. 170: 823 – 830. 60. Suzuki, S., et al. (2001). Expression of indoleamine 2,3-dioxygenase and tryptophan 2,3-dioxygenase in early concepti. Biochem. J. 355: 425 – 429. 61. Tan, P.H., et al. (2005). Modulation of human dendritic cell function following transduction with viral vectors; implications for gene therapy. Blood, in press.

MOLECULAR THERAPY Vol. 11, No. 5, May 2005 Copyright C The American Society of Gene Therapy