Immunological role of thiol-dependent peroxiredoxin gene in Macrobrachium rosenbergii

Fish & Shellfish Immunology 33 (2012) 121e129

Contents lists available at SciVerse ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Immunological role of thiol-dependent peroxiredoxin gene in Macrobrachium rosenbergii Jesu Arockiaraj a, Sarasvathi Easwvaran a, Puganeshwaran Vanaraja a, Arun Singh b, Rofina Yasmin Othman a, Subha Bhassu a, * a

Centre for Biotechnology in Agriculture Research, Division of Genetics & Molecular Biology, Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603 Kuala Lumpur, Malaysia Centre for Aquaculture Research and Extension, St. Xavier’s College (Autonomous), Palayamkottai, Tamil Nadu 627002, India

b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 29 February 2012 Received in revised form 2 April 2012 Accepted 21 April 2012 Available online 28 April 2012

In this study, we have reported a full length of peroxiredoxin (designated MrPrdx) gene, identified from the transcriptome of freshwater prawn Macrobrachium rosenbergii. The complete gene sequence of the MrPrdx is 940 base pairs in length, and encodes 186 amino acids. MrPrdx contains a long thioredoxin domain in the amino acid sequence between 34 and 186. The gene expressions of MrPrdx in healthy and the infectious hypodermal and hematopoietic necrosis virus (IHHNV) challenged M. rosenbergii were examined using quantitative real time polymerase chain reaction. MrPrdx is highly expressed in all the other tissues of M. rosenbergii considered for analysis and the highest in gills. The expression is strongly up-regulated in gills after IHHNV infection. To understand MrPrdx functional properties, the recombinant MrPrdx protein was expressed in Escherichia coli BL21 (DE3) and purified. A peroxidise activity assay was conducted using recombinant MrPrdx protein at different concentrations. This peroxidises activity showed that the recombinant MrPrdx is a thiol-dependant protein. Additionally, this result showed that recombinant MrPrdx protein, as a secretory protein can remove H2O2 and protect DNA damage. This finding leads a possible way to propose the recombinant MrPrdx protein as an effective medicine for reactive oxygen species (ROS) related diseases. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Peroxiredoxin Prawn Virus Gene expression DNA protection

1. Introduction Peroxiredoxin (Prdx) is also known as thiol-specific oxidant (TSA), thioredoxin peroxidase (TPX), alkylhydroperoxide reductase, natural killer enhancing factor (NKEF), calpromotin and torin. It belongs to a superfamily of antioxidative proteins [1,2] and found in prokaryote to eukaryote [3]. In general, Prdx protects organisms as it shield from the attack by reactive oxygen species (ROS) such as superoxide anion (O
2), hydrogen peroxide (H2O2) and hydroxyl radical (OH
) [4,5]. Statistical research shows that 90% production of the ROS components are found within mitochondrial cells [6]. ROS is important as it is involved in biochemical processes, however excessive ROS components cause oxidative stress by reacting with cellular lipids, proteins and nucleic acids which is destructive in nature and subsequently lead to various diseases [7,8]. Thus, cellular defense mechanism against excessive ROS is set

* Corresponding author. Tel.: þ60 3 79675829; fax: þ60 3 79675908. E-mail address: [email protected] (S. Bhassu). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2012.04.010

to be equilibrium by Prdx with the aid of additional enzymes [9e11]. Established mammalian Prdx has 6 isoforms identified as Prdx1, -2, -3, -4, -5 and -6, where each isoforms are classified into three sub-groups based on the presence of cysteine residue at catalytic active site [3,12]. Despite different subgroup of Prdx, all of it consist of peroxidatic Cys residue (Cys-SPH) which is converted to Cys sulfenic acid (Cys-SPOH) as the peroxide substrate are oxidized [13]. Prdx 1e5 are grouped into 2-Cys Prdx proteins as two conserved cysteine residues are present in both the N- and Cterminal. Meanwhile Prdx-5 is classified into a typical 2-Cys Prdx proteins as it contains a conserved cysteine residues at N-terminal and additional non-conserved cysteine residue whereas Prdx-6 is classified into 1-Cys Prdx as it require a cysteine residue at Nterminal which is sufficient for catalytic function [1,14]. 2-Cys Prdx proteins are known to be involved in immune responses against bacterial agents [2]. Each isoforms of 2-Cys Prdx is abundant in respective different location throughout the cell where Prdx-1 is found in the cytosol and the nucleus, Prdx-2 in the cytosol and bind with the erythrocyte membrane, Prdx-3 is a mitochondrial protein and Prdx-4 is secreted via the golgi

122

J. Arockiaraj et al. / Fish & Shellfish Immunology 33 (2012) 121e129

apparatus [13]. Among the member of 2-Cys Prdx, Prdx-3 is known to involve in apoptosis process, a cellular defence mechanism where normal cellular and tissue homeostasis was balanced [15]. It is available abundantly in mitochondria, thus oxidation of Prdx-3 in the presence of H2O2 in mitochondrial leads to further apoptosis process and subsequent early disruption of mitochondrial redox homeostasis [15]. The first Prdx which are characterized as TPX was isolated from Saccharomyces cerevisiae [16]. Recently, various group of Prdx genes from different species has been reported including Prdx from Fenneropenaeus chinensis (Chinese shrimp) [17], Marsupenaeus japonicas (kuruma shrimp) [2], Entamoeba histolytica (anaerobic parasitic protozoan) [18], Homo sapiens (human) [19], Prdx-2 homologue from Lampetra japonica (lamprey) [20], Prdx-5 from Argopecten irradians (bay scallop) [11], Prdx-6 from Eriocheir sinensis (Chinese mitten crab) [5], Scophthalmus maximus (turbot) [21], Haliotis discus discus (disk abalone) [22] and typical 2-Cys peroxiredoxin from Thunnus maccoyii (southern bluefin tuna) [13]. Recent research has proven that Prdx is found abundant throughout diverse tissues in crustacean as reported in E. sinensis [5], Marsupenaeus japonicus [2], F. chinensis [17] and the green shore crab Carcinus maenas [23]. Prdx is an antioxidative agent that involves critical function in saving animals against the DNA damage by ROS. For instance, Maningas et al. [2] reported that Prdx-1 protect bacterial peptidoglycon injected M. japonicus from DNA damage by ROS. Another study [5] indicated that the involvement of Prdx-6 in responses against Listonella anguillarum bacterial infection in E. sinensis. Prdx-1 from F. chinensis was shown to reduce H2O2 in the presence of dithiothreitol (DTT) against Vibrio anguillarum infection [17]. Kim et al. [24] found that Prdx from Gryllotalpa orientalis play a protective role against oxidative stress caused by temperature shock. Similarly Prdx involved in the protection of shrimp infected with white spot syndrome virus (WSSV) from oxidative stress [25]. Prdx is protecting Eurypanopeus depressus induced by acute hypo-osmotic stress caused by the increased metabolic activities associated with hyperosmoregulation [26]. Macrobrachium rosenbergii is a potential commodity freshwater species which has listed sixth largest aquaculture species in Asia based on volume [27]. However the shrimp farming poses threaten as out breaking of infectious disease such as infectious hypodermal and hematopoietic necrosis virus (IHHNV), white spot syndrome virus (WSSV), nodavirus diseases (white tail diseases), yellow head virus (YHV) and taura syndrome virus (TSV) [28]. Therefore it is vital to study the gene that triggers immune responses in order to develop a promising specific pathogen free trait line [29,30]. Prdx will be an important gene to study to gain insight and its contribution in M. rosenbergii defense mechanism. It is reported that component of 2-Cys Prdx, lipopolysaccharide (LPS) of invading bacteria has lead to pro-inflammatory responses which has been triggered by Prdx-2 in mice [31]. In this study we focused the gene expression and immunological role of Prdx, component of 2-Cys Prdx in IHHNV infected M. rosenbergii. Numerous Prdx have been list out from various species, even though a detail study in M. rosenbergii Prdx is still missing, with special reference to its immune aspects. In this study, we report a full length cDNA of Prdx (designated as MrPrdx) from M. rosenbergii. The expression profiles of MrPrdx mRNA in M. rosenbergii after IHHNV challenge were studied and the enzyme activity of recombinant MrPrdx protein was assayed. 2. Materials and methods 2.1. Experimental animal Healthy prawns (average body weight 10 g) were obtained from the Bandar Sri Sendayan, Negeri Sembilan, Malaysia. Prawns were

maintained in flat-bottomed glass tanks (300 L) with aerated and filtered freshwater at 28  1  C in the laboratory. All prawns were acclimatized for 1 week before challenged to IHHNV. A maximum of 15 prawns per tank were maintained during the experiment. 2.2. Identification of M. rosenbergii peroxiredoxin A full length MrPrdx gene was identified from the M. rosenbergii transcriptome unigenes obtained by Illumina’s Solexa sequencing technology. Briefly, unigenes obtained from the assembly of the Illumina Solexa short reads from the sequencing of the muscle, gills and hepatopancreas transcriptomes of M. rosenbergii. A peroxiredoxin gene has been identified through BLAST (http://blast.ncbi. nlm.nih.gov/Blast) homology searches against the GenBank database from the unigene dataset of M. rosenbergii transcriptome. 2.3. Sequence characterization The full-length MrPrdx sequence was compared with other sequences available in NCBI GenBank database and the similarities were analyzed. The open reading frame (ORF) and amino acid sequence of MrPrdx was obtained by using DNAssist 2.2. Characteristic domains or motifs were identified using the PROSITE profile database (http://prosite.expasy.org/scanprosite/). The N-terminal transmembrane sequence was determined by DAS transmembrane prediction program (http://www.sbc.su.se/wmiklos/DAS). Signal peptide analysis was done using the SignalP (http://www.cbs.dtu. dk). Pair-wise and multiple sequence alignment were analyzed using the ClustalW version 2 program (http://www.ebi.ac.uk/Tools/ msa/clustalw2/). The phylogenetic relationship of the MrPrdx was determined using the Neighbor-Joining (NJ) Method and PHYLIP (3.69v). 2.4. Gene expression of MrPrdx after IHHNV infection For IHHNV induced mRNA expression analysis, the prawns were injected with IHHNV, as described by Arockiraj et al. [32]. Briefly, IHHNV infected prawn tail tissue, tested positive by nested PCR was homogenized in sterile 2% NaCl (1:10, w/v) solution and centrifuged in a tabletop centrifuge at 5000 rpm for 5 min at 4  C. The supernatant was filtered through 0.45 mm filter and used for injecting (100 ml per 10 g prawn) the animals. Samples were collected before (0 h), and after injection (3, 6, 12, 24 and 48 h) and were immediately snap-frozen in liquid nitrogen and stored at
80  C until the total RNA was isolated. Using a sterilized syringe, the haemolymph (0.2e0.5 ml per prawn) was collected from the prawn heart and immediately centrifuged at 3000 g for 10 min at 4  C to allow haemocyte collection for total RNA extraction. Tissue homogenate prepared from healthy tail muscle served as control. Each sample was analyzed in 3 duplicates. The results are expressed as relative fold of one sample as mean  standard deviation. 2.5. RNA extraction and cDNA conversion Total RNA was isolated from the tissues of each animal using TRI Reagent following manufacturer’s protocol (Guangzhou Dongsheng Biotech, China). Total RNA was treated with RNase free DNA set (5 Prime GmbH, Hamburg, Germany) to remove the contaminating DNA. The total RNA concentration was measured spectrophometrically (NanoVue Plus Spectrophotometer, GE Healthcare UK Ltd, England). First-strand cDNA was synthesized from total RNA by M-MLV reverse transcriptase (Promega, USA) following the manufacturer’s protocol with AOLP primer (50 GGCCACGCGTCGA CTAGTAC(T)16 (A/C/G)30 ).

J. Arockiaraj et al. / Fish & Shellfish Immunology 33 (2012) 121e129 Table 1 Details of primers used in this study. Name

Target

Sequence (50 e30 direction)

MrPrdx (F1) MrPrdx (R2) b-actin (F3) b-actin (R4) MrPrdx (F5)

qRT-PCR amplification qRT-PCR amplification qRT-PCR internal control qRT-PCR internal control ORF amplification

MrPrdx (R6)

ORF amplification

TTACAGCTCTCAGTCGAGCCATGT AGTGAAGGCTCCAGGTACAGCAAA ACCACCGAAATTGCTCCATCCTCT ACGGTCACTTGTTCACCATCGGCATT (GA)3GAATTCTTTGCTGTACCTGGAG CCTTCACTEcoRI (GA)3AAGCTT GTGGCACCTTGCCAT CTTCAACAAHindIII

2.6. Tissue specific transcriptional responses of MrPrdx by real time PCR The relative expression of MrPrdx in the hemocytes, pleopods, walking legs, eye stalks, gills, hepatopancreas, stomach, intestine, brain and muscle were measured by quantitative real time polymerase chain reaction (qRT-PCR). qRT-PCR was carried out using an ABI 7500 Real-time Detection System (Applied Biosystems) in 20 ml reaction volume containing 4 ml of cDNA from each tissue, 10 ml of Fast SYBRÒ Green Master Mix, 0.5 ml of each primer (20 pmol/ml) and 5 ml dH2O. The qRT-PCR cycle profile was 1 cycle of 95  C for 10 s, followed by 35 cycles of 95  C for 5 s, 58  C for 10 s and 72  C for 20 s and finally 1 cycle of 95  C for 15 s, 60  C for 30 s and 95  C for 15 s. The same qRT-PCR cycle profile was used for the internal control gene, b-actin. b-actin primers were designed based on EST of 1357 bp (GenBank Accession No. AY651918) from M. rosenbegrii. The primer details of gene specific primer (MrPrdx) and internal control (b-actin) are presented in Table 1. After the PCR program, data were analyzed with ABI 7500 SDS software (Applied Biosystems). To maintain consistency, the baseline was set automatically by the software. The comparative CT method (2
ddCT method) was used to analyse the expression level of MrPrdx [33].

123

product was transformed into XL1 blue cells and the correct recombinant product (as confirmed by restriction enzyme digestion and sequencing) was transformed into competent Escherichia coli BL21 (DE3) cells for protein expression. 2.8. Induction of MrPrdx protein expression in E. coli BL21 Transformed E. coli BL21 cells were incubated in ampicillin (100 mg/mL) Luria broth (LB) overnight. This culture was then used to inoculate 100 mL of LB broth in 0.2% glucose-rich medium with ampicillin at 37  C until cell density reached 0.7 at OD600. E. coli BL21 harbouring pMAL-c2x-MrPrdx was induced for over expression with 1 mM isopropyl-b-thiogalactopyranoside (IPTG) and incubated at 15  C for 4 h. Cells were harvested by centrifugation (4000 g for 20 min at 4  C). E. coli BL21 uninduced culture was used as a negative control. Then the cells were resuspended in column buffer (TriseHCl, pH 7.4, 200 mM NaCl) and frozen at
20  C overnight. After thawing on ice, cells were disrupted by sonication. The crude MrPrdx fusion protein fused with maltose binding protein (MBP) was purified using pMALÔ protein fusion and purification system protocol (New England Biolabs UK Ltd, United Kingdom). Further, DEAE-SepharoseÔ ion exchange chromatography method used to purify the recombinant MrPrdx protein away from the fusion protein, and also we provided an additional purification step for removing trace contaminants according to the manufacture’s protocol (New England Biolabs UK Ltd, United Kingdom). Then the purity of the expressed protein was verified by 12% SDS-PAGE and the molecular weight of target protein was evaluated using protein molecular weight standards. Proteins were visualized by staining with 0.05% Coomassie blue R-250. The concentrations of purified proteins were determined by the method of Bradford [36] using bovine serum albumin (BSA) as the standard. The purified protein was kept at
80  C until determination of further activity assays. 2.9. Peroxidase activity assay

2.7. Cloning of MrPrdx coding sequence into the pMAL-c2X expression vector All of the cloning experiments were carried out according to Sambrook et al. [34] with slight modifications [35]. The primer set of MrPrdx were designed with the corresponding restriction enzyme sites for EcoRI and HindIII at the N- and C-termini respectively (Table 1) in order to clone the coding sequence into the expression vector, pMAL-c2X (New England Biolabs UK Ltd, United Kingdom). Using plasmid DNA of MrPrdx as a template and Taq DNA polymerase (Invitrogen BioServices India Pvt. Ltd, Bangalore, India), PCR was carried out to amplify the coding sequence. The PCR product was purified using the QIAquick Gel Extraction Kit (QIAGEN India Pvt. Ltd., New Delhi, India). Then, both insert and vector were digested with the respective restriction enzymes. The ligated

2.10. Statistical analysis

Table 2 ScanProsite motif analysis of MrPrdx protein. Details of domain and motifs (Nos.) Domain: Thioredoxin (1) Common motifs: N-myristoylation site (5) Amidation site (1) Protein kinase C phosphorylation site (3) Casein kinase II phosphorylation site (3) cAMP and cGMP dependent protein Kinase phosphorylation site (1)

This assay was conducted followed the methodology of Thurman et al. [37] with slight modifications [20]. The various concentrations of the purified recombinant MrPrdx protein (rMrPrdx) were incubated with 50 mM Hepes-HCl (pH7.0) containing 5 mM DTT at room temperature for 10 min. After incubation, 6 mL 30% H2O2 was added into the each concentration of reaction mixture, and then incubated for 0, 2, 4, 6, 8 and 10 min respectively at room temperature. At every incubation time the absorbance was measured at 475 nm and reported. After incubation, 100 mL 100% (w/v) trichloroacetic acid (TCA) was added to the assay mixture at room temperature followed by 10 mM Fe(NH4)2(SO4)2 and 2.5 M KSCN. Finally, the peroxide content was determined by the measurement of the red colored ferrithiocyanate complex. The measurement was read at 475 nm absorbance.

AA position 34e186 23e28, 77e82, 149e154, 173e178 & 175e180 61e64 33e35, 122e124 & 153e155

For comparison of relative MrPrdx gene expression, statistical analysis was performed using one-way ANOVA and mean comparisons were performed by Tukey’s Multiple Range Test using SPSS 11.5 at the 5% significant level. 3. Results 3.1. Identification of full length MrPrdx gene and sequence analysis

105e108, 131e134 & 179e182 154e157

A full length MrPrdx gene was identified from the M. rosenbergii transcriptome unigenes obtained by Illumina’s Solexa sequencing technology. The complete sequence of MrPrdx is 940 base pairs

124

J. Arockiaraj et al. / Fish & Shellfish Immunology 33 (2012) 121e129

Fig. 1. A phylogenetic tree of MrPrdx with 47 other Prdx classes (Prdx 1, 2, 3, 4, 5 and 6) was reconstructed by the Neighbour-Joining Method. The tree is based on an alignment corresponding to full-length amino acid sequences, using ClustalW and PHYLIP (3.69v). The numbers shown at the branches denote the bootstrap majority consensus values of 1000 replicates. GenBank accession numbers for the protein sequences are given in the parentheses. The genetic distance is 0.2.

(bp), which consisted of a 50 untranslated region (UTR) of 8 bp, an open reading frame of 558 bp encoding 186 amino acid (aa) residues and a 30 UTR of 374 bp. The MrPrdx nucleotide sequence has been deposited in GenBank under accession number HQ668096. This putative MrPrdx amino acid sequence does not have either signal peptide region or transmembrane region. The deduced mature MrPrdx protein had a theoretical mass of 20 kDa and an isoelectric point of 8.8.

3.2. MrPrdx sequence analysis, phylogeny and homology comparison The ScanProsite results together with ProRule-based predicted intra-domain features reported in Table 2. BLAST analysis showed that MrPrdx shares more than 80% similarity with other Prdx-5 including Korean firefly Pyrocoelia rufa (GenBank accession no. AF516693), 81% with mosquito Culex quinquefasciatus (GenBank

J. Arockiaraj et al. / Fish & Shellfish Immunology 33 (2012) 121e129

125

Fig. 2. Multiple sequence alignments of MrPrdx with seven other homologous sequences. Peroxiredoxin-5 of fruit fly D. melanogaster (NP_650679), marine worm A. marina (AAY96293), Antartica soft-shell clam L. elliptica (ACE76884), Atlantic bay scallop A. irradians (ADQ57291), Japanese scallop C. farreri (ABR27748), Atlantic salmon S. salar (ACI66176) and human H. sapiens (AAI13724) are shown. Asterisk marks indicate identical amino acids and numbers to the right indicate the amino acid position of peroxiredoxin in the corresponding species. Conserved substitutions are indicated by (:) and semi-conserved substitutions are indicated by (.). Deletions are indicated by dashes. Structurally important residues such as cysteines (C) are highlighted in pink color, the important signature motifs at 70e85 and 172e180 are boxed. GenBank accession numbers for the amino acid sequences are given in the parentheses. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

accession no. EDS30825) and 80% with dark rover ant Brachymyrmex patagonicus (GenBank accession no. ADX36414) than the other Prdx classes. Moreover, MrPrdx shares a remarkable conservation with other Prdx-5 amino acid sequences from various invertebrate and vertebrate organisms. The amino acid sequence analysis by BLASTp indicates that MrPrdx is likely to be a Prdx-5 class. A phylogenetic tree was constructed based on the selected protein sequences of different Prdx classes from various organisms (Fig. 1). This analysis showed that Prdx of each class (totally 6 classes) clustered separately and it is showing the relative position of MrPrdx in evolution with 47 representative species. The phylogentic results also suggested that MrPrdx is a Prdx-50 . The sequence similarities between MrPrdx and other Prdx-5 groups were analyzed using the ClustalW software. The multiple sequence

alignment (Fig. 2) of MrPrdx with other homologous Prdx-5 groups showed that Cys78 and Cys178 were found to be highly conserved in all the organisms analyzed. These conserved cysteine residues positioned within the signature motifs such as Val70-Pro71-Gly72Ala73-Phe74-Thr75-Pro76-Gly77-Cys78-Ser-79Lys80-Thr81-His82Leu83-Pro84-Gly85 and Asp172-Gly173-Thr174-Gly175-Leu176-Ser177Cys178-Ser179-Leu180 respectively. 3.3. Tissue distribution of MrPrdx and its expression after IHHNV infection The MrPrdx tissue distribution in healthy M. rosenbergii and its expression after IHHNV infection were determined using real time PCR. In the healthy tissue, MrPrdx was significantly

126

J. Arockiaraj et al. / Fish & Shellfish Immunology 33 (2012) 121e129

Fig. 3. Gene expression patterns of MrPrdx by qRT-PCR. 3A: Tissue distribution of MrPrdx in different tissues of M. rosenbergii. Data are expressed as a ratio to MrPrdx gene expression in stomach. Values are shown as mean  standard deviation of three replicates. The different superscript alphabets are significantly different (P < 0.05). 3B: The time course of MrPrdx gene expression in gills at 0, 3, 6, 12, 24, and 48 h post infected with IHHNV. Data are expressed as a ratio to MrPrdx gene in sample from control group. Values are shown as mean  standard deviation of three replicates. The different superscript alphabets are significantly different (P < 0.05) between the IHHNV infected and the control group.

(P < 0.05) distributed in gills followed by hepatopancreas, haemocytes, muscle, pleopods, intestine, brain, eyestalk, walking leg and stomach (Fig. 3A). Therefore, gills were selected to investigate the gene expression of MrPrdx after IHHNV infection. To analyze the expression profile of M. rosenbergii MrPrdx during disease challenge, M. rosenbergii were challenged with IHHNV and the gills were analyzed by real time PCR (Fig. 3B). The levels of MrPrdx mRNA transcripts significantly (P < 0.05) increased until 12 h post-injection (p.i.), a sudden decrease of MrPrdx mRNA expression appeared at 24 h and at 48 h, the gene expression was reached almost near to the basal level. Significant differences (P < 0.05) in expression were found at 3, 6, 12 and 24 h post-injection between the IHHNV challenged and the control group. 3.4. Expression and purification of MrPrdx protein The mature Mrprdx molecule was expressed in E. coli cells after cloning the cDNA into the EcoRI and HindIII restriction sites of pMAL-c2x-MrPrdx expression vector, IPTG driven expression of MrPrdx was done in E. coli BL 21 (DE3) cells. The recombinant MrPrdx was purified from the supernatant of induced cells. The result of SDS-PAGE showed that the recombinant MrPrdx along

with fusion protein, the recombinant protein gave a major single band with molecular mass around 62.5 kDa (42.5 kDa for MBP and 20 kDa for MrPrdx). Further, the recombinant MrPrdx protein has been purified from the MBP fusion protein using DEAE-Sepharose ion exchange chromatography method, and finally the recombinant MrPrdx protein showed a single band with molecular weight about 20 kDa. 3.5. Peroxidase activity assay The peroxidase activity assay of recombinant MrPrdx protein was determined by the decrease of hydrogen peroxide (H2O2) strength in the assay mixture with the presence or absence of DTT (Fig. 4A). As predicted, when DTT was present in the assay reaction mixture, the strength of H2O2 degradation was gradually increased as the concentration of recombinant MrPrdx protein increased. But considerably, the H2O2 degradation was higher than the control group which do not have recombinant MrPrdx protein (Fig. 4B). Comparatively, the recombinant MrPrdx protein had almost no functional effect on the degradation of H2O2 without DTT. Based on these results, it is possible to suggest that the peroxidase activity of recombinant MrPrdx proteins is functioning in a thiol-dependant manner.

J. Arockiaraj et al. / Fish & Shellfish Immunology 33 (2012) 121e129

127

Fig. 4. Hydrogen peroxide (H2O2) elimination activity of recombinant M. rosenbergii peroxiredoxide (rMrPrdx). 4A: The effect of dithiothreitol (DTT) on rMrPrdx protein activity. The recombinant MrPrdx reaction mixture along with DTT and without DTT is reported. DTT was added to different concentrations of rMrPrdx protein. Values are shown as mean  standard deviation of three replicates. The different superscript alphabets are significantly different (P < 0.05) between rMrPrdx with DTT and rMrPrdx without DTT at each concentration (mg/mL) of rMrPrdx protein. 4B: Peroxidase activity of rMrPrdx in different concentrations (0, 20, 50, 100 mg/mL) and incubation times (0, 2, 4, 6, 8 and 10 min). The values are shown in mean  standard deviation of the three replicates. The different superscript alphabets are significantly different (P < 0.05) between different concentration (mg/mL) of rMrPrdx protein at each time point.

4. Discussion Peroxiredoxins are thiol-specific antioxidant enzymes, present in a wide range of species. It prevents cellular damage from oxidative stress by helping to remove ROS. Therefore, it is believed that Prdx to be available in the organisms for protection against the toxic substance such as ROS [12]. Cellular responses to stresses are an evolutionary, ubiquitous and essential mechanism for cell survival. Viral infection is indeed a stressful process [38,39]. Diseases caused by viruses are the greatest challenge to worldwide shrimp aquaculture [40]. However, up to this date, there is no effective method to control viruses, especially IHHNV. A better understanding of shrimp immune responses will be very helpful for disease control. For this reason, we described a genomic sequence coding for the peroxiredoxin-5 from M. rosenbergii. MrPrdx sequence shows a consensus region (70VPGAFTPGCSKTHLPG85) in the N-terminal region and another (172DGTGLSCSL180) at C-terminal region. These consensus signature motifs are correspond to the catalytic centre for the peroxidise activity [41]. Similar to AiPrdx-5, our MrPrdx also contains a long 30 UTR, therefore Li et al. [11] reported that this long 30 UTR of Prdx can produce multiple

transcripts in a manner similar to alternative splicing. Moreover, transcripts with 30 UTR of different lengths and contents allow differential regulation of gene expression [42,43]. Although, like other homologues from teleosts and mammals, the signal peptide of MrPrdx was absent, hence it is proved that MrPrdx is a secretory protein [20]. A phylogenetic tree was constructed to evaluate the molecular evolutionary relationships of MrPrdx. Phylogenetic analysis showed six distinct clusters, each cluster belongs to each class of Prdx (class 1e6) in the phylogenetic tree. Prdx from M. rosenbergii clustered with the Prdx-5 group. MrPrdx is closely related to Prdx-5 from Drosophila melanogaster, since these species from similar group of arthropods. MrPrdx formed a sister group with mollusks and fish. As reported by Li et al. [11] it is proved that MrPrdx have a divergence from Prdx-5 of mollusks and fish. The putative amino acid sequence of MrPrdx displayed highest sequence similarities to other Prdx-5 from P. rufa, C. quinquefasciatus and B. patagonicus. Further the ClustalW analysis showed that the two conserved cysteine residues at 78 and 178 amino acid position are important for the antioxidant function by helping as a catalyst as well as a resolving residue [44,45]. Knoops et al. [14] reported that Prdx-5

128

J. Arockiaraj et al. / Fish & Shellfish Immunology 33 (2012) 121e129

has a resolving residue at C-terminal region and this residue is located within the polypeptide region. This residue is making disulfide bond between peroxidatic cysteine and the resolving residue. Interestingly the catalytic site at the N-terminal region has more identity around Cys78 residue than the Cys178 at C-terminal catalytic region in MrPrdx. The gene expression and localization of MrPrdx in M. rosenbergii was investigated at the transcriptional level. Even though MrPrdx mRNA was found in many tissues, e.g., hepatopancreas, walking legs, gills, muscle, stomach, haemocytes, intestine, pleopods, brain and eye stalks, it was highly expressed in the gills. As reported by Maningas et al. [2] the differential expression of Prdx in various shrimp tissues shows that it is an important molecule that could effectively be involved in a number of physiological activities. Therefore, it is possible to suggest that MrPrdx may be involved in the physiological activities including immune function of M. rosenbergii. The highest gene expression in gills may be due to the gills are directly in contact with the water and the first to be exposed to various environmental stresses including oxidative stress such as heat changes, chemicals and pathogens such as bacteria, virus and parasites. Hernandez et al. [46] reported that in crustacean and mollusks an antioxidant thioredoxin enzyme is normally expressed and up-regulated in gills because lot of respiratory oxidative stress happens during electron transfer, and it is proved in the earlier findings [22,47]. MrPrdx gene expression was significantly up-regulated until 12 h p.i and then down-regulated in the following p.i. time points at 24 h and 48 h in IHHNV infected M. rosenbergii. The downregulation may due to the inhibition of gene expression by IHHNV. Lapucki and Normant [48] reported that enzymes in the gills that play critical roles in active transport during osmoregulation. Since the gill is the main site for osmoregulation, the metabolism associated with osmoregulation will lead to the production of ROS [49]. Vazquez et al. [50] reported that in addition to the general antioxidant role of Prdx, it may also be associated with immune responses, where Prdx could serve to remove ROS. Prdx have been proposed to play a part in the physiological oxidative stress response to viral and bacterial infections in arthropods. This study showed that MrPrdx may serve to decrease the cellular damage caused by IHHNV. Horn et al. [26] reported that the knowledge on this gene expression studies can provide useful tools in understanding and quantifying how these organisms respond to various biotic and abiotic environmental stress. This MrPrdx sequence was validated by the pMAL-c2x-MrPrdx expression vector and expressed in E. coli as fusion protein. Recombinant MrPrdx was purified to homogeneity using pMALÔ protein fusion and purification system. The molecular mass of protein was about 20 kDa on 12% SDS-PAGE gel, similar to the earlier reports [20,22]. The purified recombinant MrPrdx protein exhibited H2O2 eliminability. The result of the present study is in accordance with the earlier findings [20]. According to the available literature [51], normally the peroxidise activity is based on the affinity to H2O2, for instance during oxidative stress, the peroxiredoxin multimerize and become chaperone molecules preventing protein aggregation. Additionally, this result showed that recombinant MrPrdx protein, as a secretory protein can remove H2O2 and protect DNA damage. This finding leads a possible way to propose the recombinant MrPrdx protein as an effective medicine for ROS related diseases. This, however, remains to be confirmed by further studies. Acknowledgements The authors would like to thank the funding agencies ABI (5302-03-1030) and FP 055/2010B for supporting this research. And

also University of Malaya, Kuala Lumpur, Malaysia is gratefully acknowledged for providing the Postdoctoral Research Fellowship and Bright Spark Fellowship grants to the first author J. Arockiaraj.

References [1] Rhee SG, Chae HZ, Kim K. Peroxiredoxins: a historical overview and speculative preview of novel mechanisms and emerging concepts in cell signaling. Free Radic Biol Med 2005;38:1543e52. [2] Maningas MBB, Koyama T, Kondo H, Hirono I, Aoki T. A peroxiredoxin from kuruma shrimp, Marsupenaeus japonicus, inhibited by peptidoglycan. Dev Comp Immunol 2008;32:198e203. [3] Chae HZ, Robison K, Poole LB, Church G, Storz G, Rhee SG. Cloning and sequencing of thiol-specific antioxidant from mammalian brain: alkyl hydroperoxide reductase and thiol-specific antioxidant define a large family of antioxidant enzymes. Proc Natl Acad Sci U S A 1994;91:7017e21. [4] Aguirre J, Momberg MR, Hewitt D, Hansberg W. Reactive oxygen species and development in microbial eukaryotes. Trends Microbiol 2005;13:111e8. [5] Mu C, Zhao J, Wang L, Song L, Zhang H, Li C, et al. Molecular cloning and characterization of peroxiredoxin 6 from Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol 2009;26:821e7. [6] Murphy MP. How mitochondria produce reactive oxygen species. Biochem J 2009;417:1e13. [7] Halliwell B, Gutteridge JM, Cross CE. Free radicals, antioxidants and human disease. Where are we now? J Lab Clin Med 1992;119:598e620. [8] Matés JM, Perez-Gomez C, Nunez de Castro I. Antioxidant enzymes and human diseases. Clin Biochem 1999;32:595e603. [9] Bryk R, Griffin P, Nathan C. Peroxynitrite reductase activity of bacterial peroxiredoxins. Nature 2000;407:211e5. [10] Hofmann B, Hecht HJ, Flohé L. Peroxiredoxins Biol Chem 2002;383:347e64. [11] Li J, Li L, Zhang S, Zhang G. Cloning, genomic structure, and expression analysis of peroxiredoxin V from bay scallop Argopecten irradians. Fish Shellfish Immunol 2011;30:309e16. [12] Wood ZA, Schroder E, Harris JH, Poole LB. Structure, mechanism and regulation of peroxiredoxins. Trends Biochem Sci 2003;28:32e40. [13] Sutton DL, Loo GH, Menz RI, Schuller KA. Cloning and functional characterization of a typical 2-Cys peroxiredoxin from southern bluefin tuna (Thunnus maccoyii). Comp Biochem Physiol B 2010;156:97e106. [14] Knoops B, Clippe A, Bogard C, Arsalane K, Wattiez R, Hermans C, et al. Cloning and characterization of AOEB166, a novel mammalian antioxidant enzyme of the peroxiredoxin family. J Biol Chem 1999;274:30451e8. [15] Brown KK, Cox AG, Hampton MB. Mitochondrial respiratory chain involvement in peroxiredoxin 3 oxidation by phenethyl isothiocyanate and auranofin. FEBS Lett 2010;584:1257e62. [16] Kim K, Kim I, Lee KY, Rhee SG, Stadtman ER. The isolation and purification of a specific “protector” protein which inhibits enzyme inactivation by thiol/ Fe(III)/O2 mixed-function oxidation system. J Biol Chem 1988;263:4704e11. [17] Zhang Q, Li F, Zhang J, Wang B, Gao H, Huanga B, et al. Molecular cloning, expression of a peroxiredoxin gene in Chinese shrimp Fenneropenaeus chinensis and the antioxidant activity of its recombinant protein. Mol Immunol 2007;44:3501e9. [18] Tachibana H, Xun-Jia C. Entamoeba dispar: cloning and characterization of peroxiredoxin genes. Exp Parasitol 2000;94:51e5. [19] Nguyên-nhu NT, Berck J, Clippe A, Duconseille E, Cherif H, Boone C, et al. Human peroxiredoxin 5 gene organization, initial characterization of its promoter and identification of alternative forms of mRNA. Biochim Biophys Acta 2007;1769:472e83. [20] Sun J, Liu X, Li Q. Molecular cloning, expression and antioxidant activity of a peroxiredoxin 2 homologue from Lampetra japonica. Fish Shellfish Immunol 2010;28:795e801. [21] Zheng WJ, Hua YH, Zhang M, Sun L. Analysis of the expression and antioxidative property of a peroxiredoxin 6 from Scophthalmus maximus. Fish Shellfish Immunol 2010;29:305e11. [22] Nikapitiya C, De Zoysa M, Whang I, Kim CG, Lee YH, Kim SJ, et al. Molecular cloning, characterization and expression analysis of peroxiredoxin 6 from disk abalone Haliotis discus discus and the antioxidant activity of its recombinant protein. Fish Shellfish Immunol 2009;27:239e49. [23] Towle DW, Smith CM. Gene discovery in Carcinus maenas and Homarus americanus via expressed sequence tags. Integr Comp Biol 2006;46:912e8. [24] Kim I, Lee KS, Hwang JS, Ahn MY, Li J, Sohn HD, et al. Molecular cloning and characterization of a peroxiredoxin gene from the mole cricket, Gryllotalpa orientalis. Comp Biochem Physiol B 2005;140:579e87. [25] Mohankumar K, Ramasamy P. White spot syndrome virus infection decreases the activity of antioxidant enzymes in Fenneropenaeus indicus. Virus Res 2006; 115:69e75. [26] Horn JV, Malhoe V, Delvina M, Thies M, Tolley SG, Ueda T. Molecular cloning and expression of a 2-Cys peroxiredoxin gene in the crustacean Eurypanopeus depressus induced by acute hypo-osmotic stress. Comp Biochem Physiol B 2010;155:309e15. [27] Mather PB. Aquaculture in the Asia-Pacific region: applications of molecular population genetics. Pertanika J Trop Agric Sci 2008;31:117e25.

J. Arockiaraj et al. / Fish & Shellfish Immunology 33 (2012) 121e129 [28] Lightner VD. The penaeid shrimp viruses TSV, IHHNV, WSSV, and YHV current status in the Americas, available diagnostic methods, and management strategies. J Appl Aquacult 1990;9:27e52. [29] Arockiaraj J, Puganeshwaran V, Sarasvathi E, Singh A, Alinejaid T, Rofina YO, et al. Gene profiling and characterization of arginine kinase-1 (MrAK-1) from freshwater giant prawn (Macrobrachium rosenbergii). Fish Shellfish Immunol 2011;31:81e9. [30] Arockiaraj J, Sarasvathi E, Puganeshwaran V, Singh A, Rofina YO, Bhassu S. Effect of infectious hypodermal and haematopoietic necrosis virus (IHHNV) infection on caspase 3c expression and activity in freshwater prawn Macrobrachium rosenbergii. Fish Shellfish Immunol 2012;32:161e9. [31] Yang CS, Lee DS, Song CH, An SJ, Li S, Kim JM. Roles of peroxiredoxin II in the regulation of proinflammatory responses to LPS and protection against endotoxin-induced lethal shock. J Exp Med 2007;204:583e94. [32] Arockiaraj J, Puganeshwaran V, Sarasvathi E, Singh A, Rofina YO, Bhassu S. Bioinformatic characterization and gene expression pattern of apoptosis inhibitor from Macrobrachium rosenbergii challenged with infectious hypodermal and hematopoietic necrosis virus. Fish Shellfish Immunol 2011;31:1259e67. [33] Livak KJ, Schmittgenm TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25:402e8. [34] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. New York: Cold Spring Harbor Laboratory Press; 1989. [35] Arockiaraj J, Sarasvathi E, Puganeshwaran V, Singh A, Rofina YO, Bhassu S. Prophenoloxidase activating enzyme-III from giant freshwater prawn Macrobrachium rosenbergii: characterization, expression and specific enzyme activity. Mol Biol Rep 2012;39:1377e86. [36] Bradford MM. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of proteinedye binding. Anal Biochem 1976;72:248e54. [37] Thurman RG, Ley HG, Scholz R. Hepatic microsomal ethanol oxidation: hydrogen peroxide formation and the role of catalase. Eur J Biochem 1972;25: 420e30. [38] Prohaszka Z, Fust G. Immunological aspects of heat-shock proteins-the optimum stress of life. Mol Immunol 2004;41:29e44. [39] Dong CW, Zhang YB, Zhang QY, Gui JF. Differential expression of three Paralichthys olivaceus Hsp40 genes in responses to virus infection and heat shock. Fish Shellfish Immunol 2006;21:146e58.

129

[40] Huang PY, Kang ST, Chen WY, Hsu TC, Lo CF, Liu KF, et al. Identification of the small heat shock protein, HSP21, of shrimp Penaeus monodon and the gene expression of HSP21 is inactivated after white spot syndrome virus (WSSV) infection. Fish Shellfish Immunol 2008;25:250e7. [41] Manevich Y, Fisher AB. Peroxiredoxin 6, a 1-Cys peroxiredoxin, functions in antioxidant defense and lung phospholipid metabolism. Free Radic Biol Med 2005;38:1422e32. [42] Sandberg R, Neilson JR, Sarma A, Sharp PA, Burge CB. Proliferating cells express mRNAs with shortened 30 -untranslated regions and fewer microRNA target sites. Science 2008;320:1643e7. [43] Danckwardt S, Hentze MW, Kulozik AE. 30 -end mRNA processing: molecular mechanisms and implications for health and disease. EMBO J 2008;27: 482e98. [44] Seo MS, Kang SW, Kim K, Baines IC, Lee TH, Rhee SG. Identification of a new type of mammalian peroxiredoxin that forms an intramolecular disulfide as a reaction intermediate. J Biol Chem 2000;275:20346e54. [45] Smeets A, Marchand C, Linard D, Knoops B, Declercq JP. The crystal structures of oxidized forms of human peroxiredoxin 5 with an intramolecular disulfide bond confirm the proposed enzymatic mechanism for atypical 2-Cys peroxiredoxins. Arch Biochem Biophys 2008;477:98e104. [46] Hernandez EA, Garcia-Orozco KD, Muhlia-Almazan A, Sanchez LT, Sanchez RMR, Hernandez J, et al. Shrimp thioredoxin is a potent antioxidant protein. Comp Biochem Physiol C 2008;148:94e9. [47] De Zoysa M, Pushpamali WA, Oh C, Whang I, Kim SJ, Lee J. Transcriptional upregulation of disk abalone selenium dependent glutathione peroxidase by H2O2 oxidative stress and Vibrio alginolyticus bacterial infection. Fish Shellfish Immunol 2008;25:446e57. [48] Lapucki T, Normant M. Physiological responses to salinity changes of the isopod Idotea chelipes from the Baltic brackish waters. Comp Biochem Physiol A 2008;149:299e305. [49] Henry RP, Gehnrich S, Weihrauch D, Towle DW. Salinity-mediated carbonic anhydrase induction in the gills of the euryhaline green crab, Carcinus maenas. Comp Biochem Physiol A 2003;136:243e58. [50] Vazquez L, Alpuche J, Maldonado G, Agundis C, Pereyra-Morales A, Zenteno E. Immunity mechanisms in crustaceans. Innate Immunol 2009;15:179e88. [51] Jang HH, Lee KO, Chi YH, Jung BG, Park SK, Park JH, et al. Two enzymes in one: two yeast peroxiredoxins display oxidative stress-dependant switching from a peroxidase to a molecular chaperone function. Cell 2004;117:625e35.