Immunopathology of natural infection with Trypanosoma cruzi in dogs

Veterinary Parasitology 162 (2009) 151–155

Contents lists available at ScienceDirect

Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar

Short communication

Immunopathology of natural infection with Trypanosoma cruzi in dogs Julio Vladimir Cruz-Chan a,b, Manuel Bolio-Gonza´lez b, Rafael Colı´n-Flores b, Maria Jesus Ramirez-Sierra a, Israel Quijano-Hernandez a, Eric Dumonteil a,c,* a

Laboratorio de Parasitologı´a, Centro de Investigaciones Regionales ‘‘Hideyo Noguchi’’, Universidad Auto´noma de Yucatan, 97000 Me´rida, Yucatan, Mexico Facultad de Medicina Veterinaria y Zootecnia, Universidad Auto´noma de Yucata´n, Me´rida, Yucatan, Mexico c Department of Tropical Medicine, Tulane University, School of Public Health and Tropical Medicine, New Orleans, LO, USA b

A R T I C L E I N F O

A B S T R A C T

Article history: Received 4 August 2008 Received in revised form 30 January 2009 Accepted 13 February 2009

Chagas disease is caused by Trypanosoma cruzi and dogs are an important reservoir of the parasite as well as a good model for the study of the pathogenesis of the disease. We aimed here at characterizing the immunopathology of naturally infected dogs in Merida, Yucatan, Mexico. Following an initial screening for T. cruzi seropositive stray dogs, we examined 9 seropositive and 10 seronegative animals. High lymphocytes and low monocytes counts were observed in peripheral blood from seropositives dogs. Three of nine seropositive dogs presented electrocardiographic alterations including right bundle branch block, sinusal block and QRS complex alterations and some right ventricle enlargement was noted. Histopathologic analysis of cardiac walls revealed significant inflammation with a clear tropism for the right ventricle, although most walls were affected. Seropositive dogs presented low IgG1 and high IgG2 levels. Higher IgG1 levels were associated with increased cardiac index and myocarditis, suggesting that a Th2 immune response leads to susceptibility and increased disease severity. These observations shed some light on the mechanisms of pathogenesis of Chagas disease in dogs, and provide a good framework for the evaluation of novel drugs and vaccines in this animal model. ß 2009 Elsevier B.V. All rights reserved.

Keywords: Chagas disease Dog Chronic phase Pathology

1. Introduction Chagas disease is caused by Trypanosoma cruzi a flagellated protozoan parasite, transmitted by hematophagous triatomine bugs. With over 10 million infected people, it remains a major public health problem in the Americas. In addition to humans, the parasite can infect a wide variety of mammalian hosts, some of which may act as sylvatic or domestic reservoirs. Among these, dogs have been found to play an important role in domestic transmission cycles and are considered as a risk factor for human infection (Cohen and Gu¨rtler, 2001; Gurtler

* Corresponding author at: Laboratorio de Parasitologı´a, Centro de Investigaciones Regionales ‘‘Dr. Hideyo Noguchi’’, Universidad Auto´noma de Yucata´n, Av. Itzaes 490  59, 97000 Me´rida, Yucata´n, Mexico. Tel.: +52 999 924 5910x118; fax: +52 999 923 6120. E-mail address: [email protected] (E. Dumonteil). 0304-4017/$ – see front matter ß 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2009.02.024

et al., 2007). Seroprevalence rates of infection in different dog populations and geographic areas range from 3.4% in Oklahoma, USA (Bradley et al., 2000) to 21% in the State of Mexico, Mexico (Estrada-Franco et al., 2006), and canine Chagas disease is becoming of increasing veterinary concern in the Americas (Kjos et al., 2008). An interesting feature of T. cruzi infection in dogs in that it leads to cardiac alterations which are very similar to those detected in humans. As such, they have been considered a very good animal model for the study of Chagas disease pathogenesis as well as for drug development against the parasite (Guedes et al., 2002, 2007; Meurs et al., 1998). In spite of this, there are still many aspects of T. cruzi pathogenesis in dogs (and humans) that remain poorly understood. This is due in part to the variety of protocols that have been used, with studies focusing on natural or experimental infection, and using a variety of T. cruzi strains, doses, and duration of infection, making integration of the different observations challenging.

152

J.V. Cruz-Chan et al. / Veterinary Parasitology 162 (2009) 151–155

Electrocardiographic alterations include disturbance of QRS complex and ST segment, right bundle branch blockade (RBBB), left anterior fascicular block (LAFB), ventricular tachycardia and ventricular extrasystols (Montenegro et al., 2002). Also, histopathologic analysis indicate that lesions can be more severe in the right atrium and ventricle (Barr et al., 1991). Interestingly, cardiomegaly has been found to be correlated with low or absent levels of IgG1 following experimental infection with T. cruzi strains from lineage II, suggesting that this antibody isotype may be used for the prognosis of infection (Guedes et al., 2008). However, in humans there is still controversy about the prognosis value of antibody isotypes (Vercosa et al., 2007; Vitelli-Avelar et al., 2007). To further clarify these aspects, we investigated here the immunopathology of T. cruzi natural infection in dogs from the city of Merida, Yucatan, Mexico. Triatomine vectors are indeed present in this city (Guzman-Tapia et al., 2007), and seroprevalence levels of T. cruzi infection in dogs of up to 14.4% have been reported (Jimenez-Coello et al., 2008). 2. Materials and methods 2.1. Animals A total of 143 random stray dogs from the Center of Feline and Canine Control of the city of Me´rida (898W, 21.58N), Yucatan, Mexico were screened between November 2006 and January 2007 for the presence of serum IgG against T. cruzi by ELISA, resulting in 16 seropositive animals (11.2%). 9 seropositive and 10 apparently healthy seronegative dogs were then randomly selected for analysis. Their ages ranged from 3 months to 10 years old, and they weighted 6–19 kg. All animal handling was performed according to local and international guidelines and the protocol was approved by the Institutional Bioethics Committee. 2.2. Clinical evaluation and necropsies Physical examination was performed on each dog and blood samples were drawn from the jugular vein. Leukocyte counts were determined using a Vetabc Animal Blood Counter and electrocardiograms (ECGs) were recorded and the width and height of relevant waves measured (Quijano-Hernandez et al., 2008). Animals were euthanatized with an overdose of barbiturates and a full necropsy was performed. Cardiomegaly was assessed by calculating the cardiac index (ratio between heart and body weight), the ventricle index (ratio between right/left ventricle weight), and the right and left ventricle major axis length (length between tricuspid or mitral valve and ventricle apex, respectively, normalized to heart weight) (Bienvenu and Drolet, 1991; Feneley et al., 1990; Guedes et al., 2008).

0.02 mg of T. cruzi lysate from a local strain (H1) as antigen. Following washing and blocking, a 1:200 dilution of dog serum samples was added to the wells and the plates were incubated for 1 h at 37 8C. Phosphatase-conjugated rabbit anti-dog IgG (Sigma), peroxidase-conjugated goat anti-dog IgG1 or sheep anti-dog IgG2 (Serotec) were then added at concentrations of 1:1000, 1:1000 and 1:4000, respectively, followed by pNPP or o-phenylenediamine substrates, and plates were read on a BioRad 550 reader. The cut-off value for total IgG levels was determined as the mean optical density of negative samples plus three standard deviations. 2.4. Histopathologic analysis Tissue samples from the five cardiac walls were fixed in 10% formalin, dehydrated, and embedded in paraffin. 4 mm sections were stained with hematoxylin and eosin for histopathologic evaluation. Digital images from each of the cardiac walls were taken at 10 magnification and the density of cell nuclei was quantified by image analysis using Multispec 3.0 software (Purdue University, IN, USA) (Zapata-Estrella et al., 2006). 2.5. Detection of parasite DNA by PCR Isolation of DNA from the right auricle was performed with QIAamp DNA Mini kit (QIAGEN), and we tested for the presence of T. cruzi DNA by PCR (Comes et al., 1996) using the primers 50 -GCTCTTGCCCACAAGGGTGC TCZ-F and 50 CCAAGCAGCGGATAGTTCAGG TCZ-R (Cummings and Tarleton, 2003). 2.6. Statistical analysis Blood cell counts, IgG1 and IgG2 levels, inflammatory cell density, and ECG quantitative data were analyzed with Mann–Whitney test using Prism 4.0. Correlations between variables and a multiple least square regression analysis were used to evaluate relationships between variables, and tests were run using JMP 5.0. 3. Results 3.1. Clinical evaluation ECG recordings from 9 seropositive and 10 seronegative dogs revealed cardiac alterations in 3/9 seropositive dogs, including one animal with a sinusal block, one with a right bundle branch block, and one with QRS complex alteration. One negative dog presented a sinusal block. Seropositive dogs presented significantly higher lymphocyte counts (4341  714 vs. 2445  409; Mann–Whitney test, P = 0.03) as well as lower monocyte counts (386  55 vs. 646  92; Mann–Whitney test, P = 0.03) compared to seronegative animals. 3.2. Necropsies and histopathologic evaluation

2.3. ELISA Total IgG, as well as IgG1 and IgG2 were measured by ELISA. Briefly, 96-well plates were coated overnight with

No gross pathology was observed in any of the dogs. Cardiac and ventricle index were not significantly different between seronegative and seropositive animals, but there

J.V. Cruz-Chan et al. / Veterinary Parasitology 162 (2009) 151–155 Table 1 Cardiac index and measurements of seronegative and seropositive dogs.

Cardiac index (heart/body weight  100) Ventricle index (right/left ventricle weight) Right ventricle major axis (cm/g) Left ventricle major axis (cm/g) a

Seronegative

Seropositive

59.1  3.8

56.9  4.0

1.65  0.16

1.87  0.17

0.068  0.006

0.082  0.007a

0.074  0.006

0.089  0.006

Mann–Whitney test, P = 0.06.

was a slightly longer ventricle major axis in seropositive dogs (Table 1). Histopathologic observation indicated the presence of inflammation constituted predominantly of focal mononuclear infiltrates in all cardiac walls of seropositive dogs, except the left auricle, while the

153

myocardium of seronegative dogs was completely normal (Fig. 1). Inflammation in seropositive dogs was also distributed heterogeneously in the different walls (Fig. 1, ANOVA, F = 1.259, P = 0.012), and was particularly concentrated in the right ventricle. No amastigote nests were observed in any of the cardiac tissue sections. 3.3. Parasitologic and immunologic evaluation We tested for the presence of T. cruzi DNA in cardiac biopsies by PCR. Only 1/9 seropositive dogs was positive for T. cruzi DNA, and it corresponded to a symptomatic dog presenting RBBB. IgG1 levels tended to be higher in seropositive dogs compared to seronegatives, but remained low (Fig. 2A). On the other hand, IgG2 antibodies were significantly higher in seropositive dogs compared to seronegative ones (Fig. 2A).

Fig. 1. Quantification of inflammatory cell density of seronegative and seropositive dogs. Images from tissue sections of the indicated cardiac walls were analyzed for the quantification of inflammatory cell density. Each dot represents the mean value of 3–5 digital images from an individual dog. (*) and (**) indicate significant differences between seronegative and seropositive dogs (Mann–Whitney test, P < 0.05 and P < 0.01, respectively).

Fig. 2. Antibody isotypes levels of seronegative and seropositive dogs. T. cruzi-specific IgG isotype levels were measured by ELISA in triplicate (A). Each dot represents data from an individual dog. (*) indicates a significant difference between seronegative and seropositive dogs (Mann–Whitney test, P = 0.007). IgG1 levels of seropositive dogs were significantly correlated with cardiac index (r2 = 0.51, P = 0.032) (B), ventricle index (r2 = 0.54, P = 0.024) (C), and inflammatory cell density in the right auricle (r2 = 0.52, P = 0.029) (D) and septum (r2 = 0.58, P = 0.017) (E).

154

J.V. Cruz-Chan et al. / Veterinary Parasitology 162 (2009) 151–155

Further analysis of seropositive dogs indicated that although they had very low levels of IgG1, higher level of this isotype were significantly correlated with a higher cardiac index (Fig. 2B) and higher ventricle index (Fig. 2C), as well as with a higher inflammatory cell density in the right auricle (Fig. 2D) and septum (Fig. 2E). Higher IgG2 levels were also correlated with a higher inflammatory cell density in the right ventricle (r2 = 0.54, P = 0.024), and with a smaller QRS complex (r2 = 0.53, P = 0.027). In a multivariate analysis of these data, cardiomegaly as assessed by the cardiac index could be predicted with a high accuracy (r2 = 0.91, F = 15.98, P = 0.005) with only three significant parameters: IgG1 level, QRS complex width, and the density of inflammatory cells in the right ventricle. 4. Discussion We attempted here to further our understanding the immunopathology of natural T. cruzi infection in dogs and evaluated 19 animals of different breed, sex, ages and natural infection-status, considered to be representative of the stray dog population of Merida, Yucatan, Mexico. Our data provide thus the first description of Chagas disease presentation in dogs naturally infected with Mexican strains of T. cruzi, which have been found to belong predominantly to lineage I (Bosseno et al., 2002). Importantly, no signs of digestive mega-syndrome were observed. Similarly, no significant cardiomegaly was observed and only the measurements of the right ventricle major axis length suggested possible ventricle enlargement, but this did not reach statistical significance (P = 0.06). ECG alterations were observed in 3/9 seropositive dogs, and corresponded to some of the alterations previously reported (Meurs et al., 1998; Montenegro et al., 2002). These data suggest a rather mild clinical presentation compared to other reports, in which extensive cardiomegaly, biventricular dilatation, hydropericardium, as well as life-threatening arrhythmias such as premature ventricular complex or ventricular tachycardia have been observed (Caliari et al., 2002; Morris et al., 1991). However, the stray dogs studied here differ considerably from naturally infected domestic dogs or experimentally infected laboratory animals, and it may be difficult to observe the more severe forms of Chagas disease in this population, as these animals would be expected to have a rather short lifespan. Alternatively, this dog population may present a greater resistance to T. cruzi infection. Our detailed analysis of inflammation in the different heart walls indicated a clear tropism to the right ventricle, followed by the right auricle, and left ventricle. In fact, tropism to the right ventricle and auricle seems to be very common for North American T. cruzi strains (Barr et al., 1991). The PCR detection of T. cruzi DNA in the heart of a single seropositive dog (presenting RBBB) suggested a low sensitivity of our assay, possibly due to low parasite burden, or sampling bias, as not all cardiac walls were tested and we focused on the right auricle only. Repeated testing of sequential samples may be required for a more

sensitive detection of T. cruzi, as reported previously (Araujo et al., 2002). IgG isotypes have been little studied in canine Chagas disease. Similarly to a previous study of experimental infection in Beagles (Guedes et al., 2008), we found IgG2 levels much higher than that of IgG1, suggesting a natural orientation towards a Th1 immune response (Dabbagh and Lewis, 2003; Fujiwara et al., 2005). Interestingly, a previous study reported that low or absent levels of anti-T. cruzi IgG1 were directly correlated with cardiomegaly, and proposed that IgG1 levels could be used as a marker for cardiac pathogenicity of T. cruzi infection (Guedes et al., 2008). However, our results show the opposite, as higher levels of IgG1 were correlated with several parameters of increased cardiac dysfunction and damage, including increased cardiac and ventricle index, and inflammatory cell density in the right auricle and septum. These observations were confirmed by our multivariate analysis, which emphasized the relevance and significance of IgG1 levels. Taken together, our data suggest that infected dogs presenting a Th2 response leading to the production of higher IgG1 levels would allow for cardiomegaly to develop. This interpretation is very consistent with the abundant data from mouse models showing that a Th1 immune response associated with an elevated IgG2a/IgG1 ratio is required to control T. cruzi infection and cardiac tissue damage (Dumonteil, 2007; Hoft et al., 2000; Rodrigues et al., 2002). Thus, elevated IgG1 in dogs may be used for the prognosis of the development of cardiomegaly. Nonetheless, additional analysis including cytokine measurement, should help further define the type of immune response in these dogs. In conclusion, T. cruzi infection in this dog population resulted in typical ECG alterations, although the clinical presentation was rather mild. The right ventricle was the most affected cardiac wall, which may be a shared characteristic of North American strains from lineage I of the parasite. Elevated IgG1 levels were unambiguously associated with increased cardiomegaly and disease severity, in agreement with the requirement for a Th1 immune response for the control of T. cruzi infection. These observations shed some light on the mechanisms of pathogenesis of Chagas disease in dogs, and provide a good framework for the evaluation of novel drugs and vaccine in this animal model. Conflict of interest There is no conflict of interest. Acknowledgements We thank M.V.Z. Roberto Reyes from the Center of Feline and Canine Control in Merida, Yucatan, Mexico for his invaluable help. This work was funded by the Consejo Nacional de Ciencia y Tecnologia (CONACYT), Mexico, grant #SEP-2004-C01-47122 and grant #0603 from the IMEA-Fondation Leon Mba, France to E.D. Funding agencies had no involvement in the study design, in the collection, analysis and interpretation of data; in the writing and submitting of the manuscript.

J.V. Cruz-Chan et al. / Veterinary Parasitology 162 (2009) 151–155

References Araujo, F.M., Bahia, M.T., Magalhaes, N.M., Martins-Filho, O.A., Veloso, V.M., Carneiro, C.M., Tafuri, W.L., Lana, M., 2002. Follow-up of experimental chronic Chagas’ disease in dogs: use of polymerase chain reaction (PCR) compared with parasitological and serological methods. Acta Trop. 81, 21–31. Barr, S.C., Schmidt, S.P., Brown, C.C., Klei, T.R., 1991. Pathologic features of dogs inoculated with North American Trypanosoma cruzi isolates. Am. J. Vet. Res. 52, 2033–2039. Bienvenu, J.G., Drolet, R., 1991. A quantitative study of cardiac ventricular mass in dogs. Can. J. Vet. Res. 55, 305–309. Bosseno, M.F., Barnabe, C., Magallon Gastelum, E., Lozano Kasten, F., Ramsey, J., Espinoza, B., Breniere, S.F., 2002. Predominance of Trypanosoma cruzi lineage I in Mexico. J. Clin. Microbiol. 40, 627–632. Bradley, K.K., Bergman, D.K., Woods, J.P., Crutcher, J.M., Kirchhoff, L.V., 2000. Prevalence of American trypanosomiasis (Chagas disease) among dogs in Oklahoma. J. Am. Vet. Med. Assoc. 217, 1853–1857. Caliari, M.V., do Pilar Machado, R., de Lana, M., Caja, R.A., Carneiro, C.M., Bahia, M.T., dos Santos, C.A., Magalhaes, G.A., Sampaio, I.B., Tafuri, W.L., 2002. Quantitative analysis of cardiac lesions in chronic canine chagasic cardiomyopathy. Rev. Inst. Med. Trop. Sao Paulo 44, 273–278. Cohen, J., Gu¨rtler, R.E., 2001. Modeling household transmission of American trypanosomiasis. Science 293, 694–698. Comes, A.M., Humbert, J.F., Cabaret, J., Elard, L., 1996. Using molecular tools for diagnosis in veterinary parasitology. Vet. Res. 27, 333–342. Cummings, K.L., Tarleton, R.L., 2003. Rapid quantitation of Trypanosoma cruzi in host tissue by real-time PCR. Mol. Biochem. Parasitol. 129, 53–59. Dabbagh, K., Lewis, D.B., 2003. Toll-like receptors and T-helper-1/Thelper-2 responses. Curr. Opin. Infect. Dis. 16, 199–204. Dumonteil, E., 2007. DNA vaccines against protozoan parasites: opportunities and challenges. J. Biomed. Biotechnol. 2007, 90520. Estrada-Franco, J.G., Bhatia, V., Diaz-Albiter, H., Ochoa-Garcia, L., Barbabosa, A., Vazquez-Chagoyan, J.C., Martinez-Perez, M.A., Guzman-Bracho, C., Garg, N., 2006. Human Trypanosoma cruzi infection and seropositivity in dogs, Mexico. Emerg. Infect. Dis. 12, 624–630. Feneley, M.P., Elbeery, J.R., Gaynor, J.W., Gall, S.A.J., Davis, J.W., Rankin, J.S., 1990. Ellipsoidal shell subtraction model of right ventricular volume: comparison with regional free wall dimensions as indexes of right ventricular function. Circ. Res. 67, 1427–1436. Fujiwara, R.T., Vale, A.M., Franca da Silva, J.C., da Costa, R.T., Quetz Jda, S., Martins Filho, O.A., Reis, A.B., Correa Oliveira, R., Machado-Coelho, G.L., Bueno, L.L., Bethony, J.M., Frank, G., Nascimento, E., Genaro, O., Mayrink, W., Reed, S., Campos-Neto, A., 2005. Immunogenicity in dogs of three recombinant antigens (TSA, LeIF and LmSTI1) potential vaccine candidates for canine visceral leishmaniasis. Vet. Res. 36, 827–838. Guedes, P.M., Veloso, V.M., Caliari, M.V., Carneiro, C., Souza, S.M., de Lana, M., Chiari, E., Bahia, M., Galvao, L.M., 2007. Trypanosoma cruzi high infectivity in vitro is related to cardiac lesions during long-term infection in Beagle dogs. Mem. Inst. Oswaldo Cruz 102, 141–147. Guedes, P.M., Veloso, V.M., Gollob, K.J., Afonso, L.C., Caldas, I.S., Vianna, P., de Lana, M., Chiari, E., Bahia, M.T., Galvao, L.M., 2008. IgG isotype profile is correlated with cardiomegaly in Beagle dogs infected with

155

distinct Trypanosoma cruzi strains. Vet. Immunol. Immunopathol. 124, 163–168. Guedes, P.M., Veloso, V.M., Tafuri, W.L., Galvao, L.M., Carneiro, C.M., Lana, M., Chiari, E., Ataide Soares, K., Bahia, M.T., 2002. The dog as model for chemotherapy of the Chagas’ disease. Acta Trop. 84, 9–17. Gurtler, R.E., Cecere, M.C., Lauricella, M.A., Cardinal, M.V., Kitron, U., Cohen, J.E., 2007. Domestic dogs and cats as sources of Trypanosoma cruzi infection in rural northwestern Argentina. Parasitology 134, 69–82. Guzman-Tapia, Y., Ramirez-Sierra, M.J., Dumonteil, E., 2007. Urban infestation by Triatoma dimidiata in the city of Me´rida, Yucatan, Mexico. Vector Borne Zoonotic Dis. 7, 597–606. Hoft, D.F., Schnapp, A.R., Eickhoff, C.S., Roodman, S.T., 2000. Involvement of CD4(+) Th1 cells in systemic immunity protective against primary and secondary challenges with Trypanosoma cruzi. Infect. Immun. 68, 197–204. Jimenez-Coello, M., Poot-Cob, M., Ortega-Pacheco, A., Guzman-Marin, E., Ramos-Ligonio, A., Sauri-Arceo, C.H., Acosta-Viana, K.Y., 2008. American trypanosomiasis in dogs from an urban and rural area of Yucatan, Mexico. Vector Borne Zoonotic Dis. 8, 755–761. Kjos, S.A., Snowden, K.F., Craig, T.M., Lewis, B., Ronald, N., Olson, J.K., 2008. Distribution and characterization of canine Chagas disease in Texas. Vet. Parasitol. 152, 249–256. Meurs, K.M., Anthony, M.A., Slater, M., Miller, M.W., 1998. Chronic Trypanosoma cruzi infection in dogs: 11 cases (1987–1996). J. Am. Vet. Med. Assoc. 213, 497–500. Montenegro, V.M., Jimenez, M., Pinto Dias, J.C., Zeledon, R., 2002. Chagas disease in dogs from endemic areas of Costa Rica. Mem. Inst. Oswaldo Cruz 97, 491–494. Morris, S.A., Barr, S., Weiss, L., Tanowitz, H., Wittner, M., Bilezikian, J.P., 1991. Myocardial beta-adrenergic adenylate cyclase complex in a canine model of chagasic cardiomyopathy. Circ. Res. 69, 185–195. Quijano-Hernandez, I.A., Bolio-Gonza´lez, M.E., Rodrı´guez-Buenfil, J.C., Ramirez-Sierra, M.J., Dumonteil, E., 2008. Therapeutic DNA vaccine against Trypansomoma cruzi in dogs: a pilot clinical trial. Ann. N. Y. Acad. Sci. 1149, 343–346. Rodrigues, M.M., Soares, M.B., Vasconcelos, J.R., 2002. Endogenous interleukin-4 downregulates the type 1 CD4 T cell-mediated immune response induced by intramuscular DNA immunization. J. Interferon Cytokine Res. 22, 1137–1141. Vercosa, A.F., Lorena, V.M., Carvalho, C.L., Melo, M.F., Cavalcanti, M.G., Silva, E.D., Ferreira, A.G., Pereira, V.R., Souza, W.V., Gomes, Y.M., 2007. Chagas’ disease: IgG isotypes against cytoplasmic (CRA) and flagellar (FRA) recombinant repetitive antigens of Trypanosoma cruzi in chronic Chagasic patients. J. Clin. Lab. Anal. 21, 271–276. Vitelli-Avelar, D.M., Sathler-Avelar, R., Wendling, A.P., Rocha, R.D., Teixeira-Carvalho, A., Martins, N.E., Dias, J.C., Rassi, A., Luquetti, A.O., EloiSantos, S.M., Martins-Filho, O.A., 2007. Non-conventional flow cytometry approaches to detect anti-Trypanosoma cruzi immunoglobulin G in the clinical laboratory. J. Immunol. Methods 318, 102–112. Zapata-Estrella, H., Hummel-Newell, C., Sanchez-Burgos, G., EscobedoOrtegon, J., Ramirez-Sierra, M.J., Arjona-Torres, A., Dumonteil, E., 2006. Control of Trypanosoma cruzi infection and changes in T cell populations induced by a therapeutic DNA vaccine in mice. Immunol. Lett. 103, 186–191.