Immunosuppressive Cytokine Interleukin-10 mRNA Expression Correlates with Tumour Progression in Oral Squamous Cell Carcinoma

Suzuki, Kubota, Shimizu, et al

Asian J Oral Maxillofac Surg 2005;17(1):11-19. ORIGINAL RESEARCH

Immunosuppressive Cytokine Interleukin-10 mRNA Expression Correlates with Tumour Progression in Oral Squamous Cell Carcinoma Kenji Suzuki,1 Eiro Kubota,1 Satoshi Shimizu,1 Shigeyuki Ozawa,1 Hideo Imamura,2 Masaaki Goto,2 Takeshi Katsuki2 1 Department of Oral and Maxillofacial Surgery, Kanagawa Dental College, Kanagawa, and 2 Department of Oral and Maxillofacial Surgery, School of Medicine, Saga University, Saga, Japan

Abstract Objective: To examine the correlation between immunosuppressive cytokine interleukin-10 mRNA expression and clinicopathological characteristics of patients with oral squamous cell carcinoma. Patients and Methods: Expression of interleukin-10 mRNA in tissues taken from 34 patients with oral squamous cell carcinoma was examined by reverse transcription–polymerase chain reaction and immunohistochemical analysis. Results: The cDNA encoding for T-lymphocyte receptor complex, CD3-δ, was amplified in all samples, indicating the presence of tumour infiltrating lymphocytes. Interleukin-10 mRNA was detected in 21 of 34 samples (61.8%). Densitometric analysis of the cDNA bands demonstrated that the ratio of CD3-δ to control β-actin was significantly lower in patients with advanced-stage carcinoma compared with those with earlystage disease (p = 0.047). However, the ratio of interleukin-10 to CD3-δ was significantly higher in the advanced stages than in the early stages (p = 0.012). Conclusions: These results suggest that tumour infiltrating lymphocytes decrease with progression of the tumour, whereas interleukin-10 expression remains constant around the tumour. These data also suggest that interleukin-10 may be produced not only by T cells but also by tumour cells. Key words: Carcinoma, squamous cell, Interleukin-10, Reverse transcriptase polymerase chain reaction

Introduction Mononuclear cell infiltrates consisting predominantly of T lymphocytes have been noted in various human cancer tissues.1 Despite abundant infiltration of T lymphocytes in and around tumours, most such malignancies are able to evade the protective scrutiny of the immune system. Tumour infiltrating lymphocytes (TILs) isolated from human cancer tissues exhibit profound functional defects in vitro such as inability to proliferate, failure to bind to target tumour cells, and loss of killer activity to autologous tumour cells.2 Patients with tumours were therefore considered amenable to immunosuppression. 3,4 Correspondence: Eiro Kubota, Department of Oral and Maxillofacial Surgery, Kanagawa Dental College, 82 Inaoka-cho, Yokosuka, Kanagawa, 238-8580, Japan. Tel: (81 468) 228 848; Fax: (81 468) 228 848; E-mail: [email protected]

Asian Oral Maxillofac Surg Vol 17, 1, 2005 © 2005J Asian Association of Oral andNo Maxillofacial Surgeons.

However, the mechanisms by which tumour cells can alter host immune responses are still poorly understood. One possibility is that the tumour produces immunosuppressive factors that downregulate local immune responses, especially Tlymphocyte functions.5-7 In this connection, it is of great interest that increased expression of mRNA for a potent immunosuppressive cytokine, interleukin10 (IL-10), is frequently detectable in various human cancer tissues.8 IL-10 was first characterised as a product of T-helper cell type 2 (Th2) clones that could inhibit various immune functions such as antigen presentation,9,10 synthesis of interferon-γ (IFN-γ),5,9-11 macrophage activation,11,12 and antigen-specific Tcell proliferation.6,13 IL-10 can also inhibit IL-2 and 11

Cytokine Expression in Oral Squamous Cell Carcinoma

IL-12 production from T-helper cell type (Th1) cells during primary antigen stimulation and subsequently prevents the development of Th1 cells as well as cellmediated immune responses. The inhibition of Th1 activity by Th2-derived cytokine was considered to alter the Th1-Th2 balance, thus causing impaired immunoreactivity.14,15

Kanagawa, Japan. Patients’ clinical data such as Tcell category, disease stage, lymph node metastasis status, and histological grading of tumour cells (well, moderate, or poor) are listed in Table 1. All specimens acquired were trimmed, frozen in CO2-chilled RNA lysis buffer (Applied Biosystems, Foster, USA), and kept at -80°C until RNA extraction.

Local expression of IL-10 and transforming growth factor-β (TGF-β) has been considered to exacerbate the progression and metastasis of primary carcinomas.16,17 In conjunction with this activity, one of the immunosuppressive cytokines, IL-10, has been shown to contribute to the deterioration of immune function: its immunosuppressive effect was reversed only by adding the blocking antibody to IL-10.18 Thus, it was proposed that augmentation of the expression of IL-10 in the vicinity of oral squamous cell carcinoma (OSCC) would suppress antitumour T-cell responses, thereby facilitating undesired tumour growth.

RNA Extraction RNA was extracted from biopsy specimens using Isogen (Wako Pure Chemical Industries, Osaka, Japan) according to the instructions provided by the manufacturer. Quantification of cytokine mRNA expression was done according to the method previously described by Diaz et al.19 Briefly, total RNA was reverse transcribed into cDNA in a 20-μL reaction mixture containing Moloney murine leukaemia virus reverse transcriptase (GIBCO-BRL, Grand Island, USA), random hexanucleotide primers (Wako Pure Medical, Osaka, Japan), 5 x polymerase chain reaction (PCR) buffer (94 mM Tris-HCl pH 6.9, 453 mM KCl, 23 mM MgCl2), 10 mM dNTPs (dATP, dCTP, dGTP, dTTP), and 0.1 M dithiothreitol. The PCR mixture was added to 1 μg of first-strand cDNA. The PCR mixture contained 1 U of Takara Taq DNA polymerase (Takara, Kyoto, Japan), 100 μM of each appropriate 5' and 3' primers, 2.5 mM of dNTP, and 25 mM MgCl2, 2 μL of 10 x PCR buffer [100 mM Tris-HCl, 500 mM KCl, 0.1% (weight/ volume) gelatin, pH 8.3], in a total volume of 30 μL. The oligonucleotide primer sequences for IL-2,20 IL-10,21 IL-12(p40),22 TGF-β,16 CD3-δ,8 and β-actin20 are shown in Table 2. Primer for TGF-β1 was used for detection of TGF-β mRNA as previously reported.19,20 The reaction mixture was amplified with a thermal cycler for 30 to 35 cycles.

In this study, IL-10 mRNA expression was examined in freshly excised human OSCC tissues, and correlated with the clinicopathological features of OSCC.

Patients and Methods Biopsy Specimens Tissues obtained from biopsy specimens of 34 patients with primary OSCC were analysed. The study was performed in accordance with the Institutional Review Board policies of Saga Medical School, Saga, Japan, and Kanagawa Dental College, Clinical characteristics

Stage

Number of patients

Tumour size

T1 T2 T3 T4

4 18 3 9

Clinical stage

I II III IV

3 12 6 13

Lymph node metastasis

Negative Positive

19 15

Tumour differentiation

Poor Moderate Well

3 8 23

Table 1. Clinicopathological characteristics of patients with oral squamous cell carcinoma.

12

The amplification cycles were optimised for each primer pair. The first cycle consisted of denaturation at 94°C for 5 minutes, followed by denaturation at 94°C for 30 seconds, annealing at 58°C to 65°C [IL-10, 65°C; CD3-δ, 62°C; IL-2, 60°C; IL-12(p40), 60°C; TGF-β, 60°C; and β-actin, 60°C] for 30 seconds, and primer extension at 72°C for 1 minute. The last cycle for primer extension was 72°C for 5 minutes. The PCR-amplified products were separated by electrophoresis on 2% agarose gels and visualised by ethidium bromide staining. Asian J Oral Maxillofac Surg Vol 17, No 1, 2005

Suzuki, Kubota, Shimizu, et al Primer

Sense oligonucleotide

Antisense oligonucleotide

Product size (bp)

Interleukin-2

ATGTACAGGATGCAACTCCTGTCT

GTTAGTGTTGAGATGATGCTTTGA

458

Interleukin-10

ATGCCCCAAGCTGAGAACCAAGACCCA

TCTCAAGGGGCTGGGTCAGCTATCCCA

325

Interleukin-12(p40)

GAAATGGTGGTCCTCACCTGTG

ACGCAGAATGTCAGGGAGAAGTAG

695

Transforming growth factor-β

CAGAAATACAGCAACAATTCCTGG

TTGCAGTGTGTTATCCGTGCTGTC

186

CD3-δ

CTGGACCTGGGAAAACGCATC

GTACTGAGCATCATCTCGATC

309

β-Actin

TGACGGGGTCACCCACACTGTGCC

TAGAAGCATTTGCGGTGGACGATG

661

Table 2. Polymerase chain reaction primers and product size.

Semiquantitative Reverse Transcription– Polymerase Chain Reaction Assay The quantification of mRNA specific for each cytokine in OSCC tissues was evaluated by semiquantitative reverse transcription–polymerase chain reaction (RT-PCR). The signal intensities of IL-10, TGF-β, and CD3-δ were compared with that of β-actin, and the signals for IL-10, IL-2, and IL12(p40) were compared with that of CD3-δ. Signals obtained by densitometric analysis of these PCR products were measured in arbitrary densitometric units. The densitometric scanning was performed using a Fujix DF-20 digital camera system (Fujifilm, Tokyo, Japan) with quantification analysis software (PDI Technical Services Inc, New York, USA). Peripheral Blood Lymphocyte Isolation Three millilitres of blood was collected from a healthy volunteer and diluted 1:1 with 5% heparin-containing phosphate-buffered saline (PBS). The diluted blood was overlaid onto 3 mL of lymphocyte separation medium (Cedarlane Laboratories Ltd, Ontario, Canada) and centrifuged at 1800 g for 30 minutes. The interface layer containing mononuclear cells was collected, washed twice with PBS, and the cell pellet was suspended at 1 x 106 cells/mL in Roswell Park Memorial Institute 1640 medium containing 10% foetal calf serum, streptomycin 100 μg/mL, penicillin 100 U/mL, and gentamycin 20 μg/mL. The cells were stimulated with phytohaemagglutinin (PHA) at a final concentration of 5 μg/mL for 24 hours in an incubator at 37°C with 5% CO2. Statistical Analysis The cytokine mRNA profiles were compared among individual tumours to determine whether any correlations existed between the mRNA profiles and Asian J Oral Maxillofac Surg Vol 17, No 1, 2005

clinicopathological variables such as histological grading of the tumour. Experiments were carried out at least twice for each sample. The significance of the observed differences was determined using the Mann-Whitney U test. Means and standard deviations were calculated. Probability values of less than 0.05 were regarded as statistically significant. Immunohistochemical Staining OSCC tissues were embedded in optimal cutting temperature compound (Tissue-Tek, Miles, Elkhart, USA) at -80°C. The tissue segments were sectioned with a cryostat at 6 μm and sections were fixed in 4% paraformaldehyde for 15 minutes at 4°C. The sections were preincubated with Block-ace (Dainippon Pharmaceutical, Osaka, Japan) to block non-specific binding of antibodies. Microwave pretreatment was performed for 3 minutes with 0.1 M sodium citrate, pH 6.0. The sections were then incubated with mouse antihuman CD3δ (UCHT1; PharMingen, San Diego, USA) or antihuman IL-10 (B-N10; Bende Medsystems, San Bruno, USA) for 30 minutes at 37°C. Endogenous peroxidase activity was blocked with 0.3% H2O2 and 0.1% NaN3 in distilled water for 10 minutes at room temperature, followed by incubation with goat antimouse immunoglobulin (Ig) conjugated to peroxidase-labelled polymer (Dako EnVersion+TM; Dako Co, Carpinteria, USA). After these processes, the sections were rinsed 3 times with 0.5% PBS. Histochemical colour development was achieved using Vectastatin DAB (3,3'-diamonobenzidine) substrate kit (Vector Laboratories, Burlingame, USA). Finally, the sections were counterstained with haematoxylin. Tissue sections that had been incubated with goat antimouse Ig showed only minimal background staining. 13

Cytokine Expression in Oral Squamous Cell Carcinoma

Results Optimisation of Semiquantitative Reverse Transcriptase–Polymerase Chain Reaction Analysis of Cytokine mRNA in Oral Squamous Cell Carcinoma The relative expression of cytokine mRNA in OSCC with respect to mRNA for β-actin or CD3-δ was optimised by the RT-PCR technique, and the reproducibility and accuracy were confirmed as previously described.19 Total RNA obtained from PHA-stimulated peripheral blood mononuclear cells was reverse transcribed; equal amounts of cDNA were further amplified by 23, 27, 31, 35, 39, and 43 cycles for β-actin. Densitometric analysis revealed that the amplification of β-actin was proportional to the amount of cDNA used. Dose-dependent amplification was not observed for β-actin when the number of amplifying cycles was set beyond 39 cycles. Thirty amplifying cycles were therefore used for β-actin. Similarly, the correct amplifying cycles (30 cycles) for CD3-δ were determined. Thirty five amplifying cycles were appropriate for IL-2, IL-10, IL-12(p40), and TGF-β. To ensure non-saturating and reproducible amplification conditions, equal volumes of various concentrations of cDNAs (final dilution ranging from 1 to 1/16, with 1/4 dilution corresponding to 1 μg of cDNA) were amplified for β-actin. PCR products were separated by electrophoresis and visualised with ethidium bromide staining, followed by densitometric analysis. Amplification of β-actin at various dilutions of cDNA ranging from 1/16 to 1 was proportional to the amount of cDNA produced. Furthermore, the ratio of densitometric units of cytokine bands against βactin remained constant. However, PCR products obtained following amplification of cDNA used at a dilution of 1/32 or less were not visible by ethidium bromide staining. Measurement of Cytokine mRNA Expression by Semiquantitative Reverse Transcriptase–Polymerase Chain Reaction The transcription of the IL-2, IL-10, IL-12(p40), and TGF-β genes was examined by RT-PCR in 34 biopsy specimens. Figure 1 illustrates the amplified products 14

of cytokines from a representative sample of OSCC that lacks both IL-2 and IL-12(p40) mRNA (Figure 1a) and those of PHA-stimulated peripheral blood lymphocytes, which express all of the cytokine messages examined (Figure 1b). a β-Actin Interleukin-2

Interleukin-10

Interleukin-12(p40)

Transforming growth factor-β CD3-δ

b

β-Actin Interleukin-2

Interleukin-10

Interleukin-12(p40)

Transforming growth factor-β CD3-δ

Figure 1. Semiquantitative reverse transcription–polymerase chain reaction analysis of interleukin-2, interleukin-10, interleukin-12(p40), transforming growth factor-β, and CD3-δ mRNA in oral squamous cell carcinoma tissues and phytohaemagglutinin-stimulated peripheral blood lymphocytes. (a) Interleukin-10, transforming growth factor-β, and CD3-δ mRNA were detectable in most oral squamous cell carcinoma tissues, whereas interleukin-2 and interleukin-12(p40) mRNA were barely detectable; and (b) all of these cytokine messages were detectable in phytohaemagglutinin-stimulated peripheral blood lymphocytes. Asian J Oral Maxillofac Surg Vol 17, No 1, 2005

Suzuki, Kubota, Shimizu, et al

Correlation Between Cytokine mRNA Expression and Clinicopathological Characteristics of Oral Squamous Cell Carcinoma The expression of CD3-δ mRNA recovered from OSCC tissue was significantly lower in the advanced stages of carcinoma than in the early stages (p = 0.047), and tended to decrease in large tumours (p = 0.071) [Figure 2]. In the advanced stages, the ratio of IL-10 to β-actin was not statistically different when compared with that of the early stages. However, the ratio of IL-10 to CD3-δ in the advanced

stages was significantly higher than that of the early stages (p = 0.012) [Figure 3a]. TGF-β mRNA expression was not statistically different between the advanced stages and the early stages (p = 0.099). The ratio of IL-10 to β-actin had no correlation with the tumour classification, although a signia 1.6 <0.05 1.4 Densitometric units

Amplification of β-actin mRNA was successful for all biopsy samples. Samples showed positive amplification for CD3-δ mRNA, indicating the presence of TILs in each of the tumour tissues. IL-2 mRNA was observed in only 4 of 34 tumours (11.8%) and IL-12(p40) mRNA was observed in 9 of 34 tumours (26.5%). In contrast, IL-10 mRNA was observed in 21 of 34 tumours (61.8%), and TGF-β mRNA was observed in all the tumour samples (100.0%). The relation between cytokine gene expression and clinicopathological parameters (e.g., stage, classification of tumour size, lymph node metastasis status, and histological grading of tumour cells) of OSCC samples was further examined.

1.2 1.0 0.8 0.6 0.4 0.2 0.0 Interleukin-10 to β-actin ratio

Stage I + II Stage III + IV

b 1.6 <0.05

Densitometric units

1.4

<0.05

CD3-δδ to β-action ratio

0.3

Interleukin-10 to CD3-δδ ratio

1.2 1.0 0.8 0.6 0.4

0.2

0.2 0.0 Interleukin-10 to β-actin ratio

0.1

Interleukin-10 to CD3-δδ ratio

T1 + T2 T3 + T4

0.0 Stage I + II III + IV

Tumour size 1+2 3+4

Figure 2. Correlation between CD3-δ mRNA expression and clinicopathological characteristics of oral squamous cell carcinoma tissues. The expression of CD3-δ mRNA was significantly lower in the advanced stages of carcinoma than in the early stages, and tended to decrease in large tumours. Asian J Oral Maxillofac Surg Vol 17, No 1, 2005

Figure 3. Correlation between interleukin-10 mRNA expression and clinicopathological characteristics of oral squamous cell carcinoma tissues. (a) The interleukin-10 to β-actin ratio in the advanced stages was not significantly different from that in the early stages, although the interleukin-10 to CD3-δ ratio in the advanced stages was significantly higher than in the early stages; (b) the interleukin-10 to β-actin ratio had no correlation with the classification of the tumour, whereas a significantly higher value of the interleukin-10 to CD3-δ ratio was observed in large tumours compared with small tumours.

15

Cytokine Expression in Oral Squamous Cell Carcinoma

Interleukin-12(p40) to CD3-δδ ratio

0.6

0.5 0.05 0.4

0.3

0.2

0.1

0.0 Stage

Tumour size

I + II III + IV

1+2 3+4

Figure 4. Correlation between interleukin-12(p40) mRNA expression and clinicopathological characteristics of oral squamous cell carcinoma tissues. The interleukin-12(p40) to CD3-δ ratio was significantly higher in early-stage and smallsize tumours than in advanced-stage and large-size tumours.

Densitometric units

1.5

1.0

0.5

0.0 Interleukin-10 to β-actin ratio

Interleukin-10 to CD3-δ ratio

N(-) N(+)

Figure 5. Correlation between interleukin-10 mRNA expression and lymph node metastasis status of oral squamous cell carcinoma. Both the interleukin-10 to β-actin ratio and the interleukin-10 to CD3-δ ratio had no correlation with lymph node metastasis status.

ficantly higher value of IL-10 to CD3-δ ratio was observed in large tumours (stage T3 and T4) when compared with that of small tumours (T1 and T2; p = 0.045) [Figure 3b]. On the contrary, mRNA 16

expression of IL-12(p40) was significantly greater in small tumours (T1 and T2) than in large tumours (T3 and T4; p = 0.050) [Figure 4]. The IL-12(p40) mRNA expression demarcated with a tendency to be highly expressed in early-stage carcinoma (p = 0.060) [Figure 4]. Furthermore, there were no correlations between IL-2 or TGF-β mRNA expression and tumour size. IL-10 mRNA was highly expressed in the welldifferentiated cell type of OSCC when compared with poorly or moderately differentiated cell types (p = 0.045 and p = 0.040, respectively). Furthermore, the ratio of IL-10 to CD3-δ had no correlation with lymph node metastasis status of OSCC (p = 0.549) [Figure 5]. Immunohistochemical experiments clearly delineated the existence of IL-10 protein in TILs and cytoplasm of the tumour cells (Figure 6).

Discussion Cytokine mRNA expression in human OSCC tissues was investigated using semiquantitative RT-PCR. Heterogeneous cytokine mRNA profiles were observed within the tumour tissues. A consistent feature in the cytokine profile was the ubiquitous expression of TGF-β and CD3-δ mRNA in OSCC and PHA-stimulated peripheral blood lymphocytes. mRNA of immunosuppressive cytokine IL-10 was frequently amplified in OSCC (21 of 34 OSCC tissues). Lack of IL-2 or IL-12(p40) cytokine mRNA, which exerts cell-mediated immunity against tumour cells, in OSCC suggests failure of antitumour activity around the tumour. Hence, IL-10, but not TGF-β, might contribute to the pathogenesis of the progression of OSCC, possibly through local immunosuppression against tumours. Accumulating evidence supports the concept that IL-10 may play a role in inducing immunosuppression in patients with cancer. Indeed, lack of IL-2 with concomitant expression of IL-10 in TILs of human carcinoma has recently been reported.23 Production of IL-10 is associated with the induction of anergy in T lymphocytes.24 Although IL-10 was originally described as a product of Th2-type T cells, the cell types that produce IL-10 in the vicinity of malignant tumour remain unclear. In this study, OSCC specimens expressed high levels of IL-10 Asian J Oral Maxillofac Surg Vol 17, No 1, 2005

Suzuki, Kubota, Shimizu, et al

a

b

c

d

Figure 6. Immunohistochemical analysis of oral squamous cell carcinoma tissues on the consecutive tissue sections. (a) Tissue sections incubated with non-immune mouse serum showed only minimal background staining; (b) CD3-δ expression was detected on tumour infiltrating lymphocytes; (c) interleukin-10 expression was detected on the cytoplasm of tumour cells; and (d) haematoxylin and eosin–stained oral squamous cell carcinoma tissue was used as a topographical control.

mRNA compared with those of benign tumours. The ratio of IL-10 to CD3-δ in OSCC was greater with advancement of the tumour stage and T category (Figure 3), although CD3-δ–positive cells (T lymphocytes) inversely decreased in advanced carcinoma (Figure 2). There are 2 possibilities for the increase of IL-10 to CD3-δ ratio in this study: the number of CD3-δ T cells decreases according to the cancer progression, or cells other than CD3-δ T cells that can produce IL-10 may increase in advanced carcinoma. A recent study has demonstrated that IL-10 was produced from various human carcinoma cell lines, including those of the kidney, colon, breast, and pancreas.25 The production of IL-10 protein from cancer cells was directly demonstrated by immunohistochemical staining of bronchogenic carcinoma.26 Ovarian carcinomas, renal cell carcinomas, and basal cell carcinomas expressed IL-10 mRNA more Asian J Oral Maxillofac Surg Vol 17, No 1, 2005

frequently than non-cancerous tissues or other carcinomas.27-29 Furthermore, it has been reported that squamous cell carcinoma cell lines from malignant skin lesions produced IL-10 mRNA as well as IL-10 protein.30 Therefore, evidence consistently suggests that IL-10 could be produced not only by T cells but also by the tumour cells. In this regard, it is quite noteworthy that virus-derived IL-10 gene (BCRF1), which has 70% amino acid homology with genomic IL-10, was recently identified in Epstein-Barr virus (EBV)-infected tumours.31 Yao et al further found that 29 of 41 tumours were positive for EBV-derived EBER-1 RNA by in-situ hybridisation and, of the 29 cases, 19 expressed IL-10 in the tumour cells.32 Although EBV infection was not investigated in this study, it is possible that viral IL-10 may give rise to augmented expression of IL-10 in OSCC. Overexpression of IL-10 may suppress the local immune response, thus providing cancer evasion from the antitumour immunity. 17

Cytokine Expression in Oral Squamous Cell Carcinoma

The expression of IL-10 in OSCC did not correlate with the lymph node metastasis status in this study. This finding might be predominantly caused by other factors such as cell adhesion molecules or matrix-degrading enzymes, which are considered prerequisite for cancer metastasis. The pathological variables in the present study may be important, because the expression of immunosuppressive cytokines may have predictive significance to the prognosis of the malignant tumours. It is becoming clear that immune regulation depends not only on cytokines that enhance immune response, but also on cytokines that downregulate the T cell–mediated immune response. A more comprehensive understanding of the role of these locally produced immunosuppressive cytokines in regulating antitumour immunity may lead to the development of new therapeutic approaches for the treatment of cancer.

References 1. Whiteside TL, Miescher S, Hurlimann J, Moretta L, Von Fliedner V. Separation, phenotyping and limiting dilution analysis of T-lymphocytes infiltrating human solid tumors. Int J Cancer 1986;37:803-811. 2. Culliton BJ. Fighting cancer with designer cells. Science 1989;244:1430-1433. 3. Dellon AL, Elfenbein GJ, Orlando JC. Impairment of thymus-derived lymphoid cell function in patients with basal cell carcinoma. J Surg Oncol 1984;25:92-97. 4. McCabe M, Nowak M, Maguire D, Robertson P. Immunosuppression by human skin cancers. Aust J Exper Biol Med Sci 1984;62:539-545. 5. Fiorentino DF, Bond MW, Mosmann TR. Two types of mouse T helper cell IV. Th2 clones secrete a factor that inhibits cytokine production by Th1 clones. J Exper Med 1989;170:2081-2095. 6. De Waal Malefyt R, Haanen J, Spits H, Roncarolo MG, Te Velde A, Figdor C, Johnson K, Kastelein R, Yssel H, De Vries JE. Interleukin 10 (IL-10) and viral IL-10 strongly reduce antigen-specific human T cell proliferation by diminishing the antigen-presenting capacity of monocytes via downregulation of class II major histocompatibility complex expression. J Exper Med 1991;174:915-924. 7. Mosmann TR, Moore KW. The role of IL-10 in crossregulation of Th1 and Th2 responses. Immunol 18

Today 1991;12:A49-53. 8. Luscher U, Filgueira L, Juretic A, Zuber M, Luscher NJ, Heberer M, Spagnoli GC. The pattern of cytokine gene expression in freshly excised human metastatic melanoma suggests a state of reversible anergy of tumor-infiltrating lymphocytes. Int J Cancer 1994;57: 612-619. 9. Fiorentino DF, Zlotnik A, Vieira P, Mosmann TR, Howord M, Moore KW, O’Garra A. IL-10 acts on the antigen presenting cell to inhibit cytokine production by Th1 cells. J Immunol 1991;146:3444-3451. 10. De Waal Malefyt R, Abrams J, Bennett B, Figdor CG, De Vries J. IL-10 inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. J Exper Med 1991;174:1209-1220. 11. De Waal Malefyt R, Yssel H, Roncarolo MG, Spits H, De Vries JE. Interleukin-10. Curr Opin Immunol 1992;4:314-320. 12. Fiorentino DF, Zlotnik A, Mosmann T, Howard M, O’Garra A. IL-10 inhibits cytokine production by activated macrophages. J Immunol 1991;147:3815-3822. 13. Taga K, Tosato G. IL-10 inhibits human T cell proliferation and IL-2 production. J Immunol 1992;148: 1143-1148. 14. Ho ASY, Moore KW. Interleukin-10 and its receptor. Ther Immunol 1994;1:173-185. 15. Hsieh CS, Heimberger AB, Gold JS, O’Garra A, Murphy KM. Differential regulation of T helper phenotype development by interleukins 4 and 10 in an αβ T cell receptor transgenic system. Proc Nat Acad Sci USA 1992;89:6065-6069. 16. Kekow J, Wachsman W, McCutchan JA, Cronin M, Carson DA, Lotz M. Transforming growth factor beta and noncytopathic mechanisms of immunodeficiency in human immunodeficiency virus infection. Proc Natl Acad Sci USA 1990;87:8321-8325. 17. Chandler SW, Rassekh CH, Rodman SM, Ducatman BS. Immunohistochemical localization of interleukin-10 in human oral and pharyngeal carcinoma. Laryngoscope 2002;112:808-815. 18. Young MR, Wright MA, Lozano Y. Mechanisms of immune suppression in patients with head and neck cancer: influence on the immune infiltrate of the cancer. Int J Cancer 1996;67:333-338. 19. Diaz MF, Kumar A, Karimi S, Kryworuchko M, Daftarian MP, Creery WD, Filion LG, Cameron W. Expression of IL-10, IL-4 and interferon-gamma in unstimulated and mitogen-stimulated peripheral blood Asian J Oral Maxillofac Surg Vol 17, No 1, 2005

Suzuki, Kubota, Shimizu, et al

20.

21.

22.

23.

24.

25.

lymphocytes from HIV-seropositive patients. Clin Exper Immnunol 1995; 102:31-39. Ehlers S, Smith KA. Differentiation of T cell lymphokine gene expression: the in vitro acquisition of T cell memory. J Exper Med 1991;173:25-36. Moore KW, Vieira P, Fiorentino DF, Trounstine ML, Khan TA, Mosmann TR. Homology of cytokine synthesis inhibitory factor (IL-10) to the Epstein Barr virus gene BCRF1. Science 1990;248:1230-1234. Wolf SF, Temple PA, Kobayashi M, Young D, Dicig M, Lowe L, Dzialo R, Fitz L, Ferenz C, Hewick RM, Kelleher K, Herrmann SH, Clark SC, Azzoni L, Chan SH, Trinchieri G, Perussia B. Cloning of cDNA for natural killer cell stimulatory factor, a heterodimeric cytokine with multiple biologic effects on T and natural killer cells. J Immunol 1991;146:3074-3081. Nakagomi H, Pisa P, Pisa EK, Yamamoto Y, Halapi E, Backlin K, Juhlin C, Kiessling R. Lack of interleukin-2 (IL-2) expression and selective expression of IL-10 mRNA in human renal cell carcinoma. Int J Cancer 1995;63:366-371. Becker JC, Czerny C, Brocker EB. Maintenance of clonal anergy by endogenously produced IL-10. Int Immunol 1994;6:1605-1612. Gastl GA, Abrams JS, Nanus DM, Oosterkamp R, Silver J, Liu F, Chen M, Albino AP, Bander NH. Interleukin-10 production by human carcinoma cell lines and its relationship to interleukin-6 expression. Int J Cancer 1993;55:96-101.

Asian J Oral Maxillofac Surg Vol 17, No 1, 2005

26. Smith DR, Kunkel SL, Burdick MD, Wilke CA, Orringer MB, Whyte RI, Strieer RM. Production of interleukin-10 by human bronchogenic carcinoma. Am J Pathol 1994;145:18-25. 27. Pisa P, Halapi E, Pisa EK, Gerdin E, Hising C, Bucht A, Gerdin B, Kiessling R. Selective expression of interleukin 10, interferon-gamma, and granulocyte-macrophage colony-stimulating factor in ovarian cancer biopsies. Proc Natl Acad Sci USA 1992;89:7708-7712. 28. Filgueira L, Zuber M, Merlo A, Caetano V, Schultz E, Harder F, Spagnoli GC, Heberer M. Cytokine gene transcription in renal cell carcinoma. Br J Surg 1993; 80:1322-1325. 29. Yamamura M, Modlin RL, Ohmen JD, Moy RL. Local expression of antiinflammatory cytokines in cancer. J Clin Invest 1993;91:1005-1010. 30. Kim J, Modlin RL, Moy RL, Dubinett SM, McHugh T, Nickoloff BJ, Uyemura K. IL-10 production in cutaneous basal and squamous cell carcinomas. J Immunol 1995; 155:2240-2247. 31. Hsu DH, De Waal Malefyt R, Fiorentino DF, Dang MN, Vieira P, De Vries J, Spits H, Mosmann TR, Moore KW. Expression of interleukin-10 activity by Epstein-Barr virus protein BCRF1. Science 1990;250:830-832. 32. Yao M, Ohshima K, Suzumiya J, Kume T, Shiroshita T, Kikuchi M. Inteleukin-10 expression and cytotoxicT-cell response in Epstein-Barr-virus associated nasopharyngeal carcinoma. Int J Cancer 1997;72: 398-402.

19