Impact of copper oxide nanoparticles (CuO NPs) exposure on embryo development and expression of genes related to the innate immune system of zebrafish (Danio rerio)

Comparative Biochemistry and Physiology, Part C 223 (2019) 78–87

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part C journal homepage: www.elsevier.com/locate/cbpc

Impact of copper oxide nanoparticles (CuO NPs) exposure on embryo development and expression of genes related to the innate immune system of zebrafish (Danio rerio)

T

⁎

Feyza Icoglu Aksakal , Abdulkadir Ciltas Department of Agricultural Biotechnology, Faculty of Agriculture, Ataturk University, 25240 Erzurum, Turkey

A R T I C LE I N FO

A B S T R A C T

Keywords: CuO NPs Innate immune system Raman spectroscopy RT-PCR

CuO NPs are nanomaterials with catalytic activity and unique thermo-physical properties used in different fields such as sensors, catalysts, surfactants, batteries, antimicrobials and solar energy transformations. Because of its wide field of use, these nanoparticles accumulate in the aquatic environment and thus lead to toxic effects on aquatic organisms. The toxicological findings about CuO NPs are controversial and these effects of CuO NPs on aquatic organisms have not been elucidated in detail. Therefore, the aim of this study was to investigate the toxic effect of CuO NPs on zebrafish embryos using different parameters including molecular and morphologic. For this purpose, zebrafish embryos at 4 h after post fertilization (hpf) were exposed to different concentrations of CuO NPs (0.5, 1, 1.5 mg/L) until 96 hpf. Mortality, hatching, heartbeat, malformation rates were examined during the exposure period. In addition, Raman spectroscopy was used to determine whether CuO NPs entered into the tissues of zebrafish larvae or not. Moreover, the alterations in the expression of genes related to the antioxidant system and innate immune system were examined in the embryos exposed to CuO NPs during 96 h. The results showed that CuO NPs was not able to enter into the zebrafish embryos/larvae tissues but caused an increased the mortality rate, a delayed hatching, and a decreased heartbeat rate. Moreover, CuO NPs caused several types of abnormalities such as head and tail malformations, vertebral deformities, yolk sac edema, and pericardial edema. RT-PCR results showed that the transcription of mtf-1, hsp70, nfkb and il-1β, tlr-4, tlr-22, trf, cebp was changed by the application of CuO NPs. In conclusion, short-term exposure to CuO NPs has toxic effects on the development of zebrafish embryos.

1. Introduction Nanoparticles are natural or synthetic materials have a size between 1 and 100 nm and can form amorphous and semi-crystalline structures (Adam et al., 2015). With the rapid development of nanotechnology, nanoparticles have been used in the production of numerous materials such as consumer and textile products, pigments, biomedical materials and cosmetics (Hou et al., 2015; Maisano et al., 2015; Magro et al., 2019a). Metal-based nanoparticles are among the most commonly used nanoparticles due to their physicochemical properties (Lu et al., 2017; Magro et al., 2019a; Magro et al., 2019b). For example, CuO NPs have many superior physicochemical properties, including biocidal and antimicrobial activity (Maisano et al., 2015; Grigore et al., 2016; Katsumiti et al., 2018). Therefore, it is one of the most widely used nanoparticles in biomedical applications. In addition, these nanoparticles are used in the construction of sensors, catalysts, surfactants,

⁎

superconducting materials (Wu et al., 2017; Katsumiti et al., 2018). Indeed, the extensive use of these nanoparticles inevitably causes them to be released into the aquatic environment through wastewater and their interaction with aquatic organism leads to a threat to the food chain (Hou et al., 2015; Sun et al., 2016; Lu et al., 2017). CuO NPs can lead to acute and chronic toxicity on aquatic organisms (Vale et al., 2016). Therefore, the potential environmental impact of these nanoparticles should be carefully evaluated to use safely. In the literature, toxic effects of Cu NPs on aquatic species, including fish, algae, and crustaceans, have been reported (Maisano et al., 2015; Sorensen et al., 2016; Sun et al., 2016; Lu et al., 2017; Wu et al., 2017). For example, Thit et al. (2017) and Xiao et al. (2018) revealed that CuO NPs treatment led to a dose-dependent decrease in the survival rate of Daphnia magna. Song et al. (2015) demonstrated that exposure to CuO NPs affect the structure of the gill filament and cause oxidative stress in the liver of rainbow trout. Severe abnormalities of zebrafish induced by

Corresponding author. E-mail address: fi[email protected] (F.I. Aksakal).

https://doi.org/10.1016/j.cbpc.2019.05.016 Received 2 May 2019; Received in revised form 22 May 2019; Accepted 29 May 2019 Available online 31 May 2019 1532-0456/ © 2019 Elsevier Inc. All rights reserved.

Comparative Biochemistry and Physiology, Part C 223 (2019) 78–87

F.I. Aksakal and A. Ciltas

27.6–28.3 °C, 7.1–7.3 and 6.5–6.9 mg/L, respectively. The solutions were renewed every day and dead embryos were promptly discarded from the Petri dishes during the observation. For each experimental group, 250 embryos were used and the experiments were repeated triplicate.

CuO NPs were demonstrated by Sun and his colleagues (Sun et al., 2016). Moreover, mortality in zebrafish induced by 50 ppm of CuO NPs treatment was observed (Sun et al., 2016). Furthermore, a decreased hatching rate of zebrafish induced by CuO NPs was reported (Hua et al., 2014; Vicario-Pares et al., 2014). In the evaluation of acute and chronic toxicity of these nanoparticles, zebrafish is a suitable vertebrate model since it has transparent embryos, high fecundity, small size, easy maintenance, and rapid embryonic development cycle. Moreover, zebrafish have similar to human at gene functions and metabolism level (Krishnaraj et al., 2016; Sun and Liu, 2017). Therefore zebrafish have been used in a large number of eco-toxicological studies (Piccinetti et al., 2014; MacRae and Peterson, 2015; Chemello et al., 2016; Randazzo et al., 2017; Aksakal and Ciltas, 2018a, 2018b). The toxicological researches about CuO NPs on living organisms indicated that these nanoparticles have differential toxicities depending the variety, size, agglomeration, dissolution, concentration and application method of nanoparticles (Hua et al., 2014; Keller et al., 2017; Samei et al., 2019). However, despite a large number of studies on the size, morphology, and solubility of nanoparticles, there is no consensus on the effect of the factors listed above on aquatic toxicity (Xiang et al., 2015). In addition to type, morphology, and concentration of CuO NPs, their coating can affect their toxicities. For instance, von Moos et al. (2015) stated that much more toxicity was observed in the presence of coated CuO NPs in the cytosolic membrane structures in the Chlamydomonas reinhardtii. Although several studies on the toxic effects of CuO NPs on fish and other aquatic organisms have been conducted, their findings are contradictory. Therefore, the current study was performed to elucidate the underlying mechanisms of the toxic effects of CuO NPs by assessing the morphologic, biochemical and molecular parameters including developmental toxicity and gene expressions.

2.4. Embryotoxicity assessment The embryos/larvae were monitored daily using a standard stereo microscope (Imager. A2 Zeiss, Germany) and some endpoints including mortality, hatching, and malformations were recorded. The mortality rate was calculated as a percentage of the number of dead embryos/ larvae to the total number of embryos/larvae. The hatching rate was calculated with the ratio of hatched embryos to the embryos/larvae that remained total alive. Malformations were examined at 48, 72 and 96 hpf and representative embryos at 96 hpf were photographed. For imaging, the larvae were anesthetized with 0.016% tricaine (Sigma Aldrich). The rate of malformation was calculated from the ratio of the total number of embryos to the number of the embryo with malformations. To assess the specific malformations, 20 embryos were tested at each concentration and after exposure the developmental abnormalities were observed. The criterion for larval deformity is the appearance of spinal curvature, pericardial edema, yolk sac edema, head malformation, tail deformity or short tail. The heartbeat rates of the zebrafish embryos were measured at the 48 and 72 hpf by counting the number of heartbeat in 20 s using video recording. 2.5. Preparation of Raman analysis Raman spectra of powder CuO NPs, control and CuO NPs treated 96hpf zebrafish larvae were collected by WITech alpha 300R Raman microscopy (Witec Inc., Ulm, Germany). To obtain the spectrum of CuO NPs, 20 mg powdered nanoparticle was spread over a glass to form a flat layer on the glass, under the 100 X objective, 532 nm laser wavelength, 50 mW laser power, 600 g/mm grating and 25 s collection time spectra were gathered. On the other hand, 96-hpf control and CuO NPs-treated zebrafish larvae were placed in 4% paraformaldehyde (PFA) solution on dry ice and stored in a freezer (+4 °C) for 24 h. After that, the larvae were washed with phosphate buffer solution (PBS) for 15 min two times, embedded in OCT medium (Leica) and the medium was allowed to freeze at −30 °C. 10 μm thick sections were taken from the samples by using the cryostat (Leica CM1950). 3 (3 × 3 parallel = 9 samples) samples were taken from each application group. The spectrums were collected from two different regions including head and tail for five times by Raman microspectroscopy. The spectra were again collected under 100 X objective, at 532 nm laser wavelength, 50 mW laser power, 600 g/mm grating and 25 s collection time. In the obtained spectra, the bands resulting from cosmic rays were removed by using Witec Project 4 and the noise in the spectra was removed by using the Savitzky-Golay method. Spectra obtained from control and tissue of zebrafish larvae treated with CuO NP were presented as graphs in comparison with pure nanoparticle spectra.

2. Materials and methods 2.1. Characterization and preparation of CuO NPs CuO NPs were purchased from the Sigma aldrich (Lot: MKBN9141V). For stock solution, 2.5 mg/L CuO NPs was dissolved in 10 ml ultrapure water and sonicated in the sonicator for 30 min. To prepare 0.5, 1, and 1.5 mg/L nanoparticle solutions, the stock solution was diluted in E3 medium and then sonicated for 30 min. The morphology and size of the CuO NPs were monitored using a scanning electronic microscope (SEM, Zeiss Sigma 300) and transmission electron microscope (TEM, Hitachi HT7700). 2.2. Embryo collection AB strain zebrafish (Danio rerio) were used in this study. They were cultured in 10-liter glass tanks for 7 days at 28 °C and fed with brine shrimps twice daily. The light-dark cycle was 14-h/10-h. The maintenance of zebrafish embryos was done as described in our previous studies (Aksakal and Ciltas, 2018a, 2018b). 2.3. Embryo exposure

2.6. Gene expression The CuO NPs concentrations used in this study were designed using previous studies and pre-experimental data (Song et al., 2015; Sun et al., 2016). The experiments were performed in accordance with the Code of Ethics of the World Medical Association (Declaration of Helsinki) for animal experiments and were approved by the local animal ethics committee at the Ataturk University (Erzurum, Turkey). Zebrafish embryos were treated with CuO NPs at concentrations of 0.5, 1 and 1.5 mg/L for 96 h. 50 embryos at about 4 hpf were transferred into petri dishes contained 50 ml E3 + CuO NPs solution and maintained at 28 ± 0.5 °C in an incubator. Water quality was controlled daily and water temperature, pH and dissolved oxygen were determined as

For each experimental group, total RNA was isolated from 60 zebrafish larvae using the RNeasy mini kit (Qiagen, Basel, Switzerland). During the RNA isolation, DNase I treatment step was applied to remove genomic DNA. The quality and quantity of the obtained RNA were assessed by Nanodrop ND-100 spectrophotometer. cDNA was synthesized via reverse transcription using the RT2 First Strand cDNA Synthesis Kit according to the manufacturer's protocol. Gene expression was performed by Quantitative Real-time PCR using the SYBR Green PCR master mix, cDNA and the gene-specific primers (Table 1). RT-PCR reactions were carried out with denaturation for 79

Comparative Biochemistry and Physiology, Part C 223 (2019) 78–87

F.I. Aksakal and A. Ciltas

Table 1 Primer sequence of this study. Gene

Short

Primer (5′–3′)

Metal transcription factor 1

mtf-1

Heat shock protein70

hsp70

Forward: GATTGAGCTTCTCCGTCAGG Reverse: TCCTCGTCTTCCTCTTCTCG Forward: GGAAAAGAGGGAAGCTTTGG Reverse: ACGTTCCATGTTTCCAGACC Forward: AGAGAGCGCTTGCGTCCTT Reverse: TTGCCTTTGGTTTTTCGGTAA Forward: CATTTGCAGGCCGTCACA Reverse: GGACATGCTGAAGCGCACTT Forward: GCGACGCGAGAGGAACA Reverse: TGCGCATTTTGGCTTTGTC Forward: TGGACGGCAGCAGGAAAA Reverse: GCAGGCTCTCTGGCGAAGT Forward: GGGAAGTCAATCGCCTCCA Reverse: ACGGCTGCCCATTATTCCT Forward: CCAGCTCTCGCCGTACCA Reverse: TTGGGCCAGCGGATGT Forward: TGCTGTTTTCCCCTCCATTG Reverse: TTCTGTCCCATGCCAACCA

Nuclear factor kβ

nfkβ

Interleukin-1

il-1β

CCAAT/enhancer binding protein (C/EBP)β

cebp

Transferrin

trf

Toll like receptor4

tlr-4

Toll like receptor22

tlr-22

Actin

actb

Ref. (Griffitt et al., 2007) (Griffitt et al., 2007) (Oyarbide et al., 2015) (Oyarbide et al., 2015) (Krishnaraj et al., 2016) (Oyarbide et al., 2015) (Krishnaraj et al., 2016) (Oyarbide et al., 2015) (Oyarbide et al., 2015)

CuO NPs treated embryos started to hatch at 48 hpf. The hatching rate decreased significantly in a dose-dependent manner between 48 and 72 hpf. When compared to the control group, the hatching rate in the highest concentration (1.5 mg/L CuO NP) group was decreased by about 20%. The heartbeat rates at 48 hpf and 72 hpf in control and CuO NPs treated zebrafish embryos/larvae were given in Fig. 3a. The results showed that 1 and 1.5 mg/L CuO NPs application caused a statistically significant decrease in the heartbeat rate at 48 and 72 hpf compared to the control groups. In the present study, the most common abnormalities including pericardial edema, yolk sac edema, vertebral deformation, head and tail anomalies were recorded in all CuO NPs treated groups at 48, 72, and 96hpf (Fig. 4). The malformation percentage of zebrafish embryos/ larvae increased significantly in a dose-dependent manner (Fig. 3b). The highest body malformation rate was found for the highest concentration of CuO NPs treatment (1.5 mg/L) (Fig. 3b).

10 min at 95 °C and then 40 cycles of 15 s at 95 °C and 1 min at 60 °C. Each reaction was performed three times. β-actin was used as the reference gene and relative gene expression was calculated according to the 2-ΔΔCt methods and was given as fold-change. For relative gene expression analyzes gene globe data analysis software (Qiagen- https:// www.qiagen.com/tr/geneglobe) was used. 2.7. Data analysis The rate of mortality, hatching, malformation, and heartbeat were presented as mean ± standard error (SEM) of three independent replicates. SPSS 20.0 package program was used to calculate the results and one-way analysis of variance (ANOVA) was applied. The statistical meanings were analyzed using Duncan's Multiple Comparison Test at *p < 0.05 error level. In addition, gene expression results were given as mean ± standard deviation (SDM). Student's t-test provided by GenGlobe data analysis software (Qiagen- https://www.qiagen.com/ en/geneglobe) was applied to determine the statistical significance of fold change of expression of genes studied between control groups and treated groups. The statistical meanings are given in *p < 0.05, **p < 0.01 error level.

3.3. Raman spectroscopy analyses Raman spectra were collected from the head and tail regions of control and CuO NPs treated groups in order to determine whether CuO NPs enter the head and tail tissues of zebrafish. The spectra of powder CuO NPs, control and CuO NPs treated groups for head and tail regions were given in Fig. 5a, b. As can be seen from the figure, the characteristic Raman peaks specific to powder CuO NPs were obtained in the wave numbers 280, 330 and 616 cm−1. When compared spectra of the powder nanoparticle with control and the nanoparticle exposed groups, it was clearly detected that neither control group nor CuO NPs treatment groups spectrums did not contain powder CuO NPs-specific bands (Fig. 5a, b).

3. Results 3.1. Characterization of CuO NPs SEM and TEM images of CuO NPs were given in Fig. 1a–b. Both images show that the particles have different shapes and diameters. As can be seen from these images, small particles were mostly spherical, large ones were irregular shapes. The sized of CuO NPs used is ≤50 nm. 3.2. Developmental toxicity of CuO NPs

3.4. Gene expression In order to analyze the possible toxic effect of CuO NPs on embryonic development of zebrafish, parameters such as the rate of hatching and mortality in zebrafish embryos exposed to different concentrations of CuO NPs were measured. The mortality rate was given in Fig. 2a. Compared to the control group, CuO NPs applied to zebrafish embryos/larvae were found to increase the mortality rate in a dose-dependent manner. Compared with the control groups, 5 times higher mortality was observed at the end of 96 hpf in the 1.5 mg/L CuO NP treated groups. There was not a statistically significant difference in mortality rate after 24 hpf. The hatching rates of zebrafish embryos after the CuO NPs treatments were given in Fig. 2b. As shown in Fig. 2b, control groups and the

In order to understand the potential toxic effects of CuO NPs, we determined the expression of some antioxidant and innate immune system genes at 96 hpf in each group. The expression profiles of mtf-1, hsp70 and nfkb genes in 96 hpf larvae for control and CuO NPs treated groups were shown in Fig. 6. The mRNA expressions of mtf-1 were down-regulated CuO NPs treatment groups, compared to the control group. On the other hand, exposure to CuO NPs significantly increased the mRNA expression of hsp70 and nfkb genes when compared with the control. The mRNA expression level of trf, tlr-4, tlr-22 and cebp were decreased at 96 hpf compared to the control groups (Fig. 6). The down80

Comparative Biochemistry and Physiology, Part C 223 (2019) 78–87

F.I. Aksakal and A. Ciltas

a) SEM

b) TEM Fig. 1. SEM (a) and TEM (b) images of CuO NP.

decade to demonstrate the toxicity of CuO NPs to aquatic organisms such as daphnia, urchin and fish (Maisano et al., 2015; Xiao et al., 2015; Lu et al., 2017; Kaviani et al., 2019). The possible toxicity of nanoparticles depends on their concentrations, shape, surface charge, functionalization and diameter (Chang et al., 2012). One of the most important points in eco-toxicological studies is the doses used and the relevance of these doses. To obtain information about the toxicity of nanoparticles on living organisms, it is necessary to use the suitable dose in both in vivo and in vitro studies (Oberdorster, 2010). Chang et al. (2012) reported that CuO NPs at 2 mg/L concentration caused acute toxicity and death in zebrafish. In this context, CuO NPs concentrations used in this study were determined as 0.5, 1 and 1.5 mg/L by both

regulation of gene expression was statistically significant for the trf and tlr-4 genes in the 0.5 mg/L CuO NPs treatments groups. The expression of the tlr-4 in the 1 mg/L CuO NPs group also decreased significantly (p < 0.05). On the other hand, the expression level of il-1β was significantly increased all treatment groups relative to control group (Fig. 6). 4. Discussion The increasing applications of CuO NPs in different areas cause detrimental effects on the aquatic ecosystems. As a matter of fact, several eco-toxicological studies have been conducted over the last 81

Comparative Biochemistry and Physiology, Part C 223 (2019) 78–87

F.I. Aksakal and A. Ciltas 40 Control 0.5 mg/L 1 mg/L

Mortality (%)

30

1.5 mg/L

20

10

0

0 0

24

48 Hpf

72

96

a)

100 Control 0.5 mg/L

80

1 mg/L

Hatching rate (%)

1.5 mg/L

60

40

20

0 24

48

72

96

Hpf b)

Fig. 2. Effects of CuO NPs applications on mortality (a) and hatching rate (b) of zebrafish embryos. Mortality and hatching percentage was recorded at 24, 48, 72 and 96 hpf. Asterisks indicate significant differences (p < 0.05) between control and application groups.

literature data and preliminary experiments. In the present study, the toxicity of CuO NPs on zebrafish embryos evaluated by using toxicological endpoints. The application of CuO NPs on zebrafish embryos increased the mortality and malformation rate and decreased the hatching and heartbeat rate. This situation indicated that CuO NPs lead to developmental toxicity on the zebrafish embryos/ larvae. Similar to our findings, Sun et al. (2016) reported that CuO NPs increase mortality in zebrafish embryos and reduced the percentage of hatching in a dose-dependent manner. The increase in the mortality rate caused by CuO NPs may be due to delayed hatching (Chen et al., 2012; Jackson et al., 2013). Hatching is very important in the development of zebrafish embryos and is considered a key point to assess the effect of toxic substances on fish (Suvarchala and Philip, 2016; De la Paz et al., 2017; Sun and Liu, 2017). Delaying hatching in embryos exposed to CuO NPs may be due to the relationship between the nanoparticle and the chorinase (hatching enzyme), the suppression of embryogenesis, and the poor ability of the larvae to break the eggshell. In many fish species, hatching enzymes are secreted from hatching gland cells and are necessary for the breakdown of the eggshell (Olivotto et al., 2004). Hatching of zebrafish embryos takes place several hours after the initiation of hatching gene expression (Olivotto et al., 2004). Hatching retardation of zebrafish embryos by nanoparticles might be due to the blocking the secretory function of hatching gland cells. In addition, it has been reported that various nanoparticles accumulate on the chorion membrane, block the pore

Fig. 3. Heartbeat (a) and malformation (b) rate of zebrafish embryos exposed to CuO NPs. Asterisks indicate significant differences (p < 0.05) between control and application groups.

channels, decreased the oxygen through and delayed hatching accordingly (Cheng et al., 2007; Ghobadian et al., 2015; Sun et al., 2016; Girardi et al., 2017). The decrease in hatching rate of zebrafish embryos after exposure to nanoparticles may also be associated with malformations. Because, exposure to CuO NPs caused various malformations such as body abnormalities, yolk sac edema, pericardial edema, and tail deformation. In addition, the rate of developmental abnormalities increased in a concentration-dependent manner. The heart is the first organ formed at zebrafish embryonic development and the measurement of heart rate during the embryonic period is an important toxicological parameter (Hill et al., 2005; Sun and Liu, 2017). For this reason, the measurement of the heartbeat rate is rather important in the evaluation of cardiac functions. Changes in the heart rate rhythm may occur due to a hidden pathological condition (Sun and Liu, 2017). In this study, CuO NPs treatment decreased the heartbeat rate in a dose-dependent manner. Therefore, exposure to nanoparticles may have altered cardiac function in relation to a decrease in the heart 82

Comparative Biochemistry and Physiology, Part C 223 (2019) 78–87

F.I. Aksakal and A. Ciltas

Fig. 4. Various types of malformations induced by CuO NPs; vertebral deformation (VD), yolk sac edema (YSE), body malformation (BM), pericardial edema (PE).

directly relate to the mechanical intervention of the nanoparticles. On the other hand, the toxicity caused by nanoparticles has been reported to be related to the chorion (Duan et al., 2013). The chorion has pores that control the transport of oxygen/carbon dioxide, and nutrients to the embryo. It has been suggested that nanoparticles accumulate on chorion pores, block chorion pores, inhibit hatching rate, reduce oxygen supply required for embryo development, thus delay embryo development and lead to toxicity (Bai et al., 2010; Duan et al., 2013; Zhao et al., 2013). To demonstrate the toxicity of nanoparticles on zebrafish embryos/

rate in zebrafish embryos. It is well known that cardiac function can be affected in the pericardium and cardiac abnormalities, thus resulting in irregular heart rate and blood flow deficiency. For a comprehensive nanotoxicological study, it is necessary to evaluate the bio-distribution of nanoparticles in the tissues of the target organism. One of the techniques used to examine the distribution of nanoparticles in target tissues is Raman spectroscopy. In the present study, it was determined that CuO NPs was not entered into the zebrafish head and tail regions as a result of Raman spectroscopy analyze. The toxicological effects observed in this case can't be considered to 83

Comparative Biochemistry and Physiology, Part C 223 (2019) 78–87

F.I. Aksakal and A. Ciltas

a) head

b) tail Fig. 5. Raman spectrum of head and tail of zebrafish larvae exposed to CuO NPs.

is induced by reactive oxygen derivatives and can be inhibited by antioxidants (Campo et al., 2008). The increase in nfkb gene expression indicated that CuO NPs increased oxidative stress in zebrafish embryos/ larvae. This may be due to the low amount of oxygen inside the membrane as a result of CuO NPs accumulation on the chorion membrane at the first 48 h. Numerous studies have demonstrated that various toxic substances, including nanoparticles, have a detrimental effect on the development of non-target organisms by disrupting the immune system (Jin et al., 2010; Jovanovic and Palic, 2012; Mu et al., 2015; Zhang et al., 2016). Besides, the studies about the toxicological effect of nanoparticles have indicated that these substances lead to induction or suppression in the expression of immune system-related genes in fish (Jovanovic et al., 2011; Velazquez-Carriles et al., 2018). Therefore, in this study, to investigate the immunotoxic effects of CuO NPs on zebrafish embryo, the expressions of innate immune response genes such as il-1β, tlr-4, tlr-22, trf, and cebp were analyzed. Our results showed that CuO NPs treatment increased the transcription of the il-1β gene that is

larvae, gene expression assays can provide mechanistic information. Based on this knowledge, we investigated the expression of genes related to oxidative stress such as mtf-1 and hsp70 in zebrafish larvae to determine if CuO NPs induce oxidative stress responses at the gene level. Krishnaraj et al. (2016) stated that mtf-1 has a significant role in the regulation of detoxification. On the other hand, hsp70 has been reported to play a critical role in cell defense when cells are exposed to environmental stress factors such as pesticides, heavy metals, and nanoparticles (Vale et al., 2016). In our study, a decrease in mtf-1 gene expression and an increase in hsp70 gene expression was determined in a dose-dependent manner. These results are in parallel with the results of a similar study on adult zebrafish liver by using silver nanoparticles (Krishnaraj et al., 2016). When compared with the control group, exposure to CuO NPs increased the nfkb gene expression. It is well known that the nfkb transcription factor complex is a cellular sensor that responds to oxidative stress (Helenius et al., 1996). The oxidative stress in cells can activate nfkb and create damage in DNA (Ye et al., 2016). nfkb 84

Comparative Biochemistry and Physiology, Part C 223 (2019) 78–87

F.I. Aksakal and A. Ciltas 3

1.5

2.5

2

Fold Change

Fold Change

1

1.5

1 0.5

0.5

0

0 Control

0.5 mg/L

1 mg/L

1.5 mg/L

Control

0.5 mg/L

1 mg/L

1.5 mg/L

NFKB MTF-1

1.5 3

2.5

Fold Change

1

Fold Change

2

1.5

0.5

1

0.5

0

0 Control

0.5 mg/L

1 mg/L

1.5 mg/L

Control

0.5 mg/L

1 mg/L

1.5 mg/L

TRF

HSP70

Fig. 6. Expression of genes related to oxidative stress (mtf-1, hsp70, nfkb and innate immune system (tlr4, tlr22, cebp, trf and il-1β) of zebrafish larvae after exposure to CuO NPs. Asterisks indicate significant differences (*p < 0.05 and **p < 0.01) between control and application groups.

stress suppresses the immune system. Similar to our results, Yeo and Kim (2010) and Krishnaraj et al. (2016) reported that the expression of these genes decreased due to stress in zebrafish treated with silver and titanium dioxide nanoparticles. In summary, obtained results in this study revealed that CuO NPs cause not only developmental toxicity but also immunotoxicity in zebrafish embryos. To better understand and evaluate these toxicities on aquatic organisms, metabolomic analyses are suggested.

associated with the innate immune system, and decreased the transcription of the tlr-4, tlr-22, trf, and cebp genes. The innate immune system, which contains a large number of molecules dissolved in body fluids, is the first line of defense against infection by toxic substances in the early life stages of zebrafish (Trede et al., 2004; Mu et al., 2015) and the il-1β gene plays a vital role in the aggregation of phagocytes in the region of infection (Jin et al., 2010). This gene also activates macrophages and neutrophils, allowing them to accumulate in the damaged area (Dinarello, 1996). The increase that occurred in the il-1β expression demonstrates that an immune response formed in the 96-hour zebrafish. On the other hand, the reduction in the expression levels of other genes associated with the innate immune system due to the nanoparticle treatment indicated that the larvae are stressed and this

Declaration of Competing Interest The authors declare that they have no conflict of interest. 85

Comparative Biochemistry and Physiology, Part C 223 (2019) 78–87

F.I. Aksakal and A. Ciltas

1.5

4.5

4

3.5 1 Fold Change

3

2.5

2 0.5

1.5

1

0.5

0

0 Control

0.5 mg/L

1 mg/L

Control

1.5 mg/L

0.5 mg/L

1 mg/L

1.5 mg/L

1 mg/L

1.5 mg/L

IL-1B

TLR4

1.3

1.5

1

Fold Change

1

0.5 0.5

0

0 Control

1 mg/L

0.5 mg/L

Control

1.5 mg/L

0.5 mg/L

CEBP

Fig. 6. (continued)

References

mechanism of CuO and ZnO nanoparticles. Materials. 5, 2850–2871. https://doi.org/ 10.3390/ma5122850. Chemello, G., Piccinetti, C., Randazzo, B., Carnevali, O., Maradonna, F., Magro, M., Bonaiuto, E., Vianello, F., Radaelli, G., Fifi, A.P., Gigliotti, F., Olivotto, I., 2016. Oxytetracycline delivery in adult female zebrafish by iron oxide nanoparticles. Zebrafish. 13, 495–503. https://doi.org/10.1089/zeb.2016.1302. Chen, L.Q., Hu, P.P., Zhang, L., Huang, S.Z., Luo, L.F., Huang, C.Z., 2012. Toxicity of graphene oxide and multi-walled carbon nanotubes against human cells and zebrafish. Sci. Chin-Chem. 55, 2209–2216. https://doi.org/10.1007/s11426-012-4620-z. Cheng, J., Flahaut, E., Cheng, S.H., 2007. Effect of carbon nanotubes on developing zebrafish (Danio rerio) embryos. Environ. Toxicol. Chem. 26, 708–716. https://doi. org/10.1897/06-272R.1. De la Paz, J.F., Beiza, N., Paredes-Zuniga, S., Hoare, M.S., Allende, M.L., 2017. Triazole fungicides inhibit zebrafish hatching by blocking the secretory function of hatching gland cells. Int. J. Mol. Sci. 18. https://doi.org/10.3390/ijms18040710. Dinarello, C.A., 1996. Biologic basis for interleukin-1 in disease. Blood. 87, 2095–2147. Duan, J.C., Yu, Y.B., Shi, H.Q., Tian, L.W., Guo, C.X., Huang, P.L., Zhou, X.Q., Peng, S.Q., Sun, Z.W., 2013. Toxic effects of silica nanoparticles on zebrafish embryos and larvae. PLoS One 8. https://doi.org/10.1371/journal.pone.0074606. Ghobadian, M., Nabiuni, M., Parivar, K., Fathi, M., Pazooki, J., 2015. Toxic effects of

Adam, N., Schmitt, C., De Bruyn, L., Knapen, D., Blust, R., 2015. Aquatic acute species sensitivity distributions of ZnO and CuO nanoparticles. Sci. Total Environ. 526, 233–242. Aksakal, F.I., Ciltas, A., 2018a. Developmental toxicity of penconazole in Zebrfish (Danio rerio) embryos. Chemosphere 200, 8–15. Aksakal, F.I., Ciltas, A., 2018b. The impact of ultraviolet B (UV-B) radiation in combination with different temperatures in the early life stage of zebrafish (Danio rerio). Photochem. Photobiol. Sci. 17, 35–41. Bai, W., Zhang, Z.Y., Tian, W.J., He, X., Ma, Y.H., Zhao, Y.L., Chai, Z.F., 2010. Toxicity of zinc oxide nanoparticles to zebrafish embryo: a physicochemical study of toxicity mechanism. J. Nanopart. Res. 12, 1645–1654. https://doi.org/10.1007/s11051-0099740-9. Campo, G.M., Avenoso, A., Campo, S., D'Ascola, A., Traina, P., Sama, D., Calatroni, A., 2008. NF-kB and caspases are involved in the hyaluronan and chondroitin-4-sulphate-exerted antioxidant effect in fibroblast cultures exposed to oxidative stress. J. Appl. Toxicol. 28, 509–517. https://doi.org/10.1002/jat.1302. Chang, Y.-N., Zhang, M., Xia, L., Zhang, J., Xing, G., 2012. The toxic effects and

86

Comparative Biochemistry and Physiology, Part C 223 (2019) 78–87

F.I. Aksakal and A. Ciltas

Olivotto, I., Yasumasu, S., Gioacchini, G., Maradonna, F., Cionna, C., Carnevali, O., 2004. Cloning and expression of high choriolytic enzyme, a component of the hatching enzyme system, during embryonic development of the marine ornamental fish Chrysiptera parasema. Mar. Biol. 145, 1235–1241. https://doi.org/10.1007/s00227004-1404-9. Oyarbide, U., Iturria, I., Rainieri, S., Pardo, M.A., 2015. Use of gnotobiotic zebrafish to study Vibrio anguillarum pathogenicity. Zebrafish. 12, 71–80. https://doi.org/10. 1089/zeb.2014.0972. Piccinetti, C.C., Montis, C., Bonini, M., Laura, R., Guerrera, M.C., Radaelli, G., Vianello, F., Santinelli, V., Maradonna, F., Nozzi, V., Miccoli, A., Olivotto, I., 2014. Transfer of silica-coated magnetic (Fe3O4) nanoparticles through food: a molecular and morphological study in zebrafish. Zebrafish. 11, 567–579. https://doi.org/10.1089/zeb. 2014.1037. Randazzo, B., Chemello, G., Tortarolo, I., Chiarello, G.L., Zalas, M., Santini, A., Liberatore, M., Liberatore, M., Selli, E., Olivotto, I., 2017. A novel photocatalytic purification system for fish culture. Zebrafish 14, 411–421. https://doi.org/10.1089/zeb.2017. 1448. Samei, M., Sarrafzadeh, M.H., Faramarzi, M.A., 2019. The impact of morphology and size of zinc oxide nanoparticles on its toxicity to the freshwater microalga, Raphidocelis subcapitata. Environ. Sci. Pollut. R. 26, 2409–2420. https://doi.org/10.1007/s11356018-3787-z. Song, L., Vijver, M.G., Peijnenburg, W.J.G.M., Galloway, T.S., Tyler, C.R., 2015. A comparative analysis on the in vivo toxicity of copper nanoparticles in three species of freshwater fish. Chemosphere. 139, 181–189. https://doi.org/10.1016/j. chemosphere.2015.06.021. Sorensen, S.N., Lutzhoft, H.C.H., Rasmussen, R., Baun, A., 2016. Acute and chronic effects from pulse exposure of D. magna to silver and copper oxide nanoparticles. Aquat. Toxicol. 180, 209–217. https://doi.org/10.1016/j.aquatox.2016.10.004. Sun, G.J., Liu, K.C., 2017. Developmental toxicity and cardiac effects of butyl benzyl phthalate in zebrafish embryos. Aquat. Toxicol. 192, 165–170. https://doi.org/10. 1016/j.aquatox.2017.09.020. Sun, Y., Zhang, G., He, Z.Z., Wang, Y.J., Cui, J.L., Li, Y.H., 2016. Effects of copper oxide nanoparticles on developing zebrafish embryos and larvae. Int. J. Nanomedicine 11, 905–918. https://doi.org/10.2147/IJN.S100350. Suvarchala, G., Philip, G.H., 2016. Toxicity of 3,5,6-trichloro-2-pyridinol tested at multiple stages of zebrafish (Danio rerio) development. Environ. Sci. Pollut. R. 23, 15515–15523. https://doi.org/10.1007/s11356-016-6684-3. Thit, A., Huggins, K., Selck, H., Baun, A., 2017. Acute toxicity of copper oxide nanoparticles to Daphnia magna under different test conditions. Toxicol. Environ. Chem. 99, 665–679. https://doi.org/10.1080/02772248.2016.1249368. Trede, N.S., Langenau, D.M., Traver, D., Look, A.T., Zon, L.I., 2004. The use of zebrafish to understand immunity. Immunity. 20, 367–379. https://doi.org/10.1016/S10747613(04)00084-6. Vale, G., Mehennaoui, K., Cambier, S., Libralato, G., Jomini, S., Domingos, R.F., 2016. Manufactured nanoparticles in the aquatic environment-biochemical responses on freshwater organisms: a critical overview. Aquat. Toxicol. 170, 162–174. https://doi. org/10.1016/j.aquatox.2015.11.019. Velazquez-Carriles, C., Macias-Rodriguez, M.E., Carbajal-Arizaga, G.G., Silva-Jara, J., Angulo, C., Reyes-Becerril, M., 2018. Immobilizing yeast beta-glucan on zinc-layered hydroxide nanoparticle improves innate immune response in fish leukocytes. Fish Shellfish Immun. 82, 504–513. https://doi.org/10.1016/j.fsi.2018.08.055. Vicario-Pares, U., Castanaga, L., Lacave, J.M., Oron, M., Reip, P., Berhanu, D., ValsamiJones, E., Cajaraville, M.P., Orbea, A., 2014. Comparative toxicity of metal oxide nanoparticles (CuO, ZnO and TiO2) to developing zebrafish embryos. J. Nanopart. Res. 16. https://doi.org/10.1007/s11051-014-2550-8. von Moos, N., Maillard, L., Slaveykova, V.I., 2015. Dynamics of sub-lethal effects of nanoCuO on the microalga Chlamydomonas reinhardtii during short-term exposure. Aquat. Toxicol. 161, 267–275. https://doi.org/10.1016/j.aquatox.2015.02.010. Wu, F., Bortvedt, A., Harper, B.J., Crandon, L.E., Harper, S.L., 2017. Uptake and toxicity of CuO nanoparticles to Daphnia magna varies between indirect dietary and direct waterborne exposures. Aquat. Toxicol. 190, 78–86. https://doi.org/10.1016/j. aquatox.2017.06.021. Xiang, L., Zhao, H.M., Li, Y.W., Huang, X.P., Wu, X.L., Zhai, T., Yuan, Y., Cai, Q.Y., Mo, C.H., 2015. Effects of the size and morphology of zinc oxide nanoparticles on the germination of Chinese cabbage seeds. Environ. Sci. Pollut. R. 22, 10452–10462. https://doi.org/10.1007/s11356-015-4172-9. Xiao, Y.L., Vijver, M.G., Chen, G.C., Peijnenburg, W.J.G.M., 2015. Toxicity and accumulation of Cu and ZnO nanoparticles in Daphnia magna. Environ. Sci. Technol. 49, 4657–4664. https://doi.org/10.1021/acs.est.5b00538. Xiao, Y.L., Peijnenburg, W.J.G.M., Chen, G.C., Vijver, M.G., 2018. Impact of water chemistry on the particle-specific toxicity of copper nanoparticles to Daphnia magna. Sci. Total Environ. 610, 1329–1335. Ye, X.Z., Jiang, R., Zhang, Q.Q., Wang, R.F., Yang, C.H., Ma, J., Du, H., 2016. Increased 8hydroxy-2′-deoxyguanosine in leukocyte DNA from patients with type 2 diabetes and microangiopathy. J. Int. Med. Res. 44, 472–482. https://doi.org/10.1177/ 0300060515621530. Yeo, M.K., Kim, H.E., 2010. Gene expression in zebrafish embryos following exposure to TiO2 nanoparticles. Mol. Cell. Toxicol. 6, 97–104. https://doi.org/10.1007/s13273010-0013-6. Zhang, Q.F., Li, Y.W., Liu, Z.H., Chen, Q.L., 2016. Exposure to mercuric chloride induces developmental damage, oxidative stress and immunotoxicity in zebrafish embryoslarvae. Aquat. Toxicol. 181, 76–85. https://doi.org/10.1016/j.aquatox.2016.10.029. Zhao, X.S., Wang, S.T., Wu, Y., You, H., Lv, L.N., 2013. Acute ZnO nanoparticles exposure induces developmental toxicity, oxidative stress and DNA damage in embryo-larval zebrafish. Aquat. Toxicol. 136, 49–59.

magnesium oxide nanopartides on early developmental and larval stages of zebrafish (Danio rerio). Ecotox. Environ. Safe. 122, 260–267. https://doi.org/10.1016/j. ecoenv.2015.08.009. Girardi, F.A., Bruch, G.E., Peixoto, C.S., Dal Bosco, L., Sahoo, S.K., Goncalves, C.O.F., Santos, A.P., Furtado, C.A., Fantini, C., Barros, D.M., 2017. Toxicity of single-wall carbon nanotubes functionalized with polyethylene glycol in zebrafish (Danio rerio) embryos. J. Appl. Toxicol. 37, 214–221. https://doi.org/10.1002/jat.3346. Griffitt, R.J., Weil, R., Hyndman, K.A., Denslow, N.D., Powers, K., Taylor, D., Barber, D.S., 2007. Exposure to copper nanoparticles causes gill injury and acute lethality in zebrafish (Danio rerio). Environ. Sci. Technol. 41, 8178–8186. https://doi.org/10. 1021/es071235e. Grigore, M.E., Biscu, E.R., Holban, A.M., Gestal, M.C., Grumezescu, A.M., 2016. Methods of synthesis, properties and biomedical applications of CuO nanoparticles. Pharmaceuticals. 9. https://doi.org/10.3390/ph9040075. Helenius, M., Hanninen, M., Lehtinen, S.K., Salminen, A., 1996. Aging induced up regulation of nuclear binding activities of oxidative stress responsive NF-kB transcription factor in mouse cardiac muscle. J. Mol. Cell. Cardiol. 28, 487–498. https://doi.org/ 10.1006/jmcc.1996.0045. Hill, A.J., Teraoka, H., Heideman, W., Peterson, R.E., 2005. Zebrafish as a model vertebrate for investigating chemical toxicity. Toxicol. Sci. 86, 6–19. https://doi.org/10. 1093/toxsci/kfi110. Hou, J., Miao, L.Z., Wang, C., Wang, P.F., Ao, Y.H., Lv, B.W., 2015. Effect of CuO nanoparticles on the production and composition of extracellular polymeric substances and physicochemical stability of activated sludge flocs. Bioresour. Technol. 176, 65–70. https://doi.org/10.1016/j.biortech.2014.11.020. Hua, J., Vijver, M.G., Ahmad, F., Richardson, M.K., Peijnenburg, W.J.G.M., 2014. Toxicity of different-sized copper nano-and submicron particles and their shed copper ions to zebrafish embryos. Environ. Toxicol. Chem. 33, 1774–1782. https://doi.org/10. 1002/etc.2615. Jackson, P., Jacobsen, N.R., Baun, A., Birkedal, R., Kuhnel, D., Jensen, K.A., Vogel, U., Wallin, H., 2013. Bioaccumulation and ecotoxicity of carbon nanotubes. Chem. Cent. J. 7. https://doi.org/10.1186/1752-153X-7-154. Jin, Y.X., Chen, R.J., Liu, W.P., Fu, Z.W., 2010. Effect of endocrine disrupting chemicals on the transcription of genes related to the innate immune system in the early developmental stage of zebrafish (Danio rerio). Fish Shellfish Immun. 28, 854–861. https://doi.org/10.1016/j.fsi.2010.02.009. Jovanovic, B., Palic, D., 2012. Immunotoxicology of non-functionalized engineered nanoparticles in aquatic organisms with special emphasis on fish-review of current knowledge, gap identification, and call for further research. Aquat. Toxicol. 118, 141–151. Jovanovic, B., Anastasova, L., Rowe, E.W., Zhang, Y.J., Clapp, A.R., Palic, D., 2011. Effects of nanosized titanium dioxide on innate immune system of fathead minnow (Pimephales promelas Rafinesque, 1820). Ecotox. Environ. Safe. 74, 675–683. https:// doi.org/10.1016/j.ecoenv.2010.10.017. Katsumiti, A., Thorley, A.J., Arostegui, I., Reip, P., Valsami-Jones, E., Tetley, T.D., Cajaraville, M.P., 2018. Cytotoxicity and cellular mechanisms of toxicity of CuO NPs in mussel cells in vitro and comparative sensitivity with human cells. Toxicol. in Vitro 48, 146–158. https://doi.org/10.1016/j.tiv.2018.01.013. Kaviani, E.F., Naeemi, A.S., Salehzadeh, A., 2019. Influence of copper oxide nanoparticle on hematology and plasma biochemistry of Caspian trout (Salmo trutta caspius), following acute and chronic exposure. Pollution. 5, 225–234. Keller, A.A., Adeleye, A.S., Conway, J.R., Garner, K.L., Zhao, L.J., Cherr, G.N., Hong, J., Gardea-Torresdey, J.L., Godwin, H.A., Hanna, S., Ji, Z.X., Kaweeteerawat, C., Lin, S.J., Lenihan, H.S., Miller, R.J., Nel, A.E., Peralta-Videa, J.R., Walker, S.L., Taylor, A.A., Torres-Duarte, C., Zink, J.I., Zuverza-Mena, N., 2017. Comparative environmental fate and toxicity of copper nanomaterials. Nanoimpact. 7, 28–40. https://doi. org/10.1016/j.impact.2017.05.003. Krishnaraj, C., Harper, S.L., Yun, S.I., 2016. In Vivo toxicological assessment of biologically synthesized silver nanoparticles in adult zebrafish (Danio rerio). J. Hazard. Mater. 301, 480–491. https://doi.org/10.1016/j.jhazmat.2015.09.022. Lu, G.H., Yang, H.H., Xia, J., Zong, Y.C., Liu, J.C., 2017. Toxicity of Cu and Cr nanoparticles to Daphnia magna. Water Air Soil Pollut. 228, 18. MacRae, C.A., Peterson, R.T., 2015. Zebrafish as tools for drug discovery. Nat. Rev. Drug Discov. 14, 721–731. https://doi.org/10.1038/nrd4627. Magro, M., Baratella, D., Bonaiuto, E., Roger, J.D., Chemello, G., Pasquaroli, S., Mancini, L., Olivotto, I., Zoppellaro, G., Ugolotti, J., Aparicio, C., Fifi, A.P., Cozza, G., Miotto, G., Radaelli, G., Bertotto, D., Zboril, R., Vianello, F., 2019a. Stealth iron oxide nanoparticles for organotropic drug targeting. Biomacromolecules. 20, 1375–1384. Magro, M., Bramuzzo, S., Baratella, D., Ugolotti, J., Zoppellaro, G., Chemello, G., Olivotto, I., Ballarin, C., Radaelli, G., Arcaro, B., De Liguoro, M., Coppellotti, O., Guidolin, L., de Almeida Roger, J., Bonaiuto, E., Zboril, R., Vianello, F., 2019b. Selfassembly of chlorin-e6 on gamma-Fe2O3 nanoparticles: application for larvicidal activity against Aedes aegypti. J. Photochem. Photobiol. B 194, 21–31. Maisano, M., Cappello, T., Catanese, E., Vitale, V., Natalotto, A., Giannetto, A., Barreca, D., Brunelli, E., Mauceri, A., Fasulo, S., 2015. Developmental abnormalities and neurotoxicological effects of CuO NPs on the black sea urchin Arbacia lixula by embryotoxicity assay. Mar. Environ. Res. 111, 121–127. https://doi.org/10.1016/j. marenvres.2015.05.010. Mu, X.Y., Chai, T.T., Wang, K., Zhang, J., Zhu, L.Z., Li, X.F., Wang, C.J., 2015. Occurrence and origin of sensitivity toward difenoconazole in zebrafish (Danio reio) during different life stages. Aquat. Toxicol. 160, 57–68. https://doi.org/10.1016/j.aquatox. 2015.01.001. Oberdorster, G., 2010. Safety assessment for nanotechnology and nanomedicine: concepts of nanotoxicology. J. Intern. Med. 267, 89–105. https://doi.org/10.1111/j.13652796.2009.02187.x.

87