- Email: [email protected]
Impact of indomethacin on neuroinflammation and hippocampal neurogenesis in aged mice
Neuroscience Letters 572 (2014) 7–12
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
Impact of indomethacin on neuroinflammation and hippocampal neurogenesis in aged mice Marcus Boehme a,1 , Madlen Guenther a,1 , Anna Stahr a,b , Marie Liebmann a,c , Nadine Jaenisch a , Otto W. Witte a,d , Christiane Frahm a,∗ a
Hans-Berger Department of Neurology, University Hospital Jena, Friedrich-Schiller University, Jena, Germany Institute of Anatomy II, Heinrich-Heine-University, Medical Faculty, Düsseldorf, Germany c Department of Neurology, University of Münster, Münster, Germany d Center for Sepsis Control and Care, University Hospital Jena, Jena, Germany b
h i g h l i g h t s • • • • •
Effect of indomethacin on age-related neuroinflammation and neurogenesis was investigated in 24-month-old mice. Transcript expression of inflammatory mediators was upregulated in aged brains. Indomethacin decreased hippocampal COX-1 and COX-2 transcript expression. Gfap and Iba1 transcript expression were reduced by indomethacin in the aged hippocampus. Neurogenesis was unaffected by indomethacin.
a r t i c l e
i n f o
Article history: Received 21 January 2014 Received in revised form 24 April 2014 Accepted 26 April 2014 Available online 4 May 2014 Keywords: Aging Cytokines Inflammation Neurogenesis
a b s t r a c t Age-induced neuroinflammation could be a contributing factor to the restricted neurogenesis in aged mice. Indomethacin, a common non-steroidal anti-inflammatory drug, has been demonstrated to partially restore neurogenesis under pathophysiological inflammation-associated conditions in adult C57BL/6 mice. This study investigated whether indomethacin is able to decrease age-related neuroinflammation in the hippocampus (24-month-old mice) and thereby stimulate neurogenesis. During hippocampal aging, the transcript expression of pro-inflammatory cytokines (Tnf␣, Il-1␣, Il-1), the chemokine Mip-1␣, and markers for activated astrocytes (Gfap, Lcn2, but not Vim and Serpina3n) and microglia (Iba1, F4/80, Cd68, Cd86) significantly increased. Treatment with indomethacin significantly decreased COX-1 and COX-2 transcript expression. Of the age-related inflammatory mediators, only Gfap and Iba1 were affected by indomethacin treatment in the hippocampus, with a significantly reduced transcript expression being detected for both markers. Neurogenesis was unaffected by indomethacin. Thus, our data reveal that administration of indomethacin to aged mice is not able to effectively decrease neuroinflammation and promote neurogenesis. © 2014 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Abbreviations: BrdU, bromodeoxyuridine; Cd68, cluster of differentiation 68; Cd86, cluster of differentiation 86; COX, cyclooxygenase; CTR, control; DCX, doublecortin; Gfap, glial fibrillary acidic protein; Iba1, ionized calcium-binding adaptor molecule 1; Il-1␣, interleukin 1␣; Il-1, interleukin 1; INDO, indomethacin; Lcn2, lipocalin 2; Mip-1␣, macrophage inflammatory protein 1␣; qPCR, quantitative polymerase chain reaction; Serpina3n, serine (or cysteine) peptidase inhibitor, clade A, member 3N; Tnf␣, tumor necrosis factor ␣; Vim, vimentin. ∗ Corresponding author at: Hans-Berger Department of Neurology, University Hospital Jena, Friedrich-Schiller University, Erlanger Allee 101, 07747 Jena, Germany. Tel.: +49 3641 9 325909; fax: +49 3641 9 325902. E-mail address: [email protected] (C. Frahm). http://dx.doi.org/10.1016/j.neulet.2014.04.043 0304-3940/© 2014 Elsevier Ireland Ltd. All rights reserved.
Aging dramatically reduces basal neurogenesis in the hippocampus [11,13,21]. This has been proposed as a possible explanation for cognitive impairments in aged organisms [6]. The age-related decline in neurogenesis results from a reduced proliferation of neural stem cells as well as from a delayed maturation of newborn neurons [11,13,21]. As a consequence of
1
These authors contributed equally to this work.
8
M. Boehme et al. / Neuroscience Letters 572 (2014) 7–12
aging, the secretion of inflammatory mediators increases in the brain where activated microglia and astrocytes release cytokines and chemokines [22]. While it is accepted that experimentally induced cerebral inflammation (e.g. by lipopolysaccharide or irradiation) inhibits adult hippocampal neurogenesis [2,7,16], it is still unclear to what extent the age-related increased inflammatory status is responsible for the suppressed neurogenesis in the aged brain. To investigate the effect of an anti-inflammatory treatment on neurogenesis in aged brains, we utilized the common non-steroidal anti-inflammatory drug indomethacin, which is a non-selective inhibitor of the prostanoid-forming enzymes cyclooxygenase-1/2 (COX-1 and COX-2) [3]. Indomethacin has previously been shown to be effective in different experimental models of cerebral inflammation as well as in models of Alzheimer’s disease [16,17]. This study investigated the age-related expression of various inflammatory mediators (pro-inflammatory cytokines, chemokines, markers for activated microglia and astrocytes) proposed to modify hippocampal neurogenesis. Based on these data, the effect of a transient administration of indomethacin on hippocampal neuroinflammation and neurogenesis in non-pathological aged mice was assessed. We hypothesized that the application of indomethacin would attenuate the inflammatory processes in aged brains and thereby function as a potential stimulator of hippocampal neurogenesis. 2. Materials and methods 2.1. Experimental design Indomethacin was applied for 11 weeks to 22-month-old mice (INDO). As in previous studies [20], indomethacin (Sigma) was dissolved in absolute ethanol (10 mg/ml stock solution), and diluted in drinking water to a final concentration of 10 g/ml. To analyze hippocampal neurogenesis, mice received two daily intraperitoneal injections of bromodeoxyuridine (BrdU) (50 mg/kg body weight) over 6 days during the 6th week of indomethacin application (n = 5). Age-matched controls (n = 10) and adult 5-month-old mice without indomethacin treatment (n = 8) also received injections of BrdU. For quantitative polymerase chain reaction (qPCR) studies, mice were housed under the same conditions without receiving BrdU injections (24 months, INDO (n = 5); 24 months, control (CTR) (n = 7); 5 months, CTR (n = 10)). All animal procedures were performed on male C57BL/6 mice and approved by the local government (Thueringer Landesamt für Lebensmittelsicherheit und Verbraucherschutz (TLLV), Germany) and conformed to international guidelines on the ethical use of animals.
Table 1 Specific primers for qPCR. Gene
Primer sequence (5 –3 )
fw: TTCTGCTGTGGAAATGCAAG rv: GAGAAACATGGCCCGAAGT fw: AGCAACTAATGCTGAAAGCACA Cd86 rv: CGGAATAGTCTATAGCCCTCCA fw: ACTATGGGGTTGAGGCACTG COX-1 rv: GCCACATGCAGAACATGATAG fw: GGGTGTGAAGGGAAATAAGGA COX-2 rv: GGGCAAAGAATGCAAACATC fw: ACTATTGGGAGCTACTTCTGCACT F4/80 rv: TAGGAGCCTGGTACATTGGTG fw: AGAAAGGTTGAATCGCTGGA Gfap rv: GCCACTGCCTCGTATTGAGT fw: TGGAAGAACCAAGGAGCTGT Lcn2 rv: GGTGGGGACAGAGAAGATGA Serpina3n fw: TGCGAAACTGTACCCTCTGA rv: TCATTTGGGGTTGGCTATCT Vimentin fw: TGAAGGAAGAGATGGCTCGT rv: GGTGTCAACCAGAGGAAGTGA
Cd68
GenBank accession number NM 009853.1 NM 019388.3 NM 008969.3 NM 011198.3 NM 010130.4 NM 010277.3 NM 008491.1 NM 009252.2 X56397.1
2.2. Immunohistochemistry Mice were deeply anesthetized and transcardially perfused with 4% paraformaldehyde. Every 6th free-floating section was used for immunohistochemistry, as previously described in detail [14]. Slices were treated with a rat primary antibody against BrdU (1:500, AbD Serotec), followed by a biotinylated secondary antibody (donkey anti-rat, 1:500, Dianova Inc.). For triple-labeling immunofluorescence, every 6th section was incubated with the following primary antibodies: rat anti-BrdU (as above), goat anti-doublecortin (DCX) (1:80, Santa Cruz Biotechnology), and mouse anti-NeuN (1:500, Chemicon). Slices were further processed with secondary antibodies – Rhodamine anti-rat (1:500, Dianova Inc.), Alexa 488 anti-goat (1:500, Molecular Probes), and Cy5 anti-mouse (1:500, Dianova Inc.) – as previously described [14], followed by incubation in copper(II) sulfate (Sigma) to mask the age-related accumulation of lipofuscin. BrdU+ cells were quantified throughout the subgranular and granular cell layer of the entire rostro-caudal extent of the dentate gyrus using an Axioplan 2 microscope (Carl Zeiss). The resulting numbers were multiplied by a factor of six to attain the estimated total number of BrdU+ cells. For phenotyping of BrdU+ cells, random fields of dentate gyrus containing BrdU+ cells were selected and z-stacks were scanned by confocal laser microscopy (LSM510, Carl Zeiss). Phenotypes of 30 BrdU+ cells per dentate gyrus were determined in adult mice.
Fig. 1. Age-related transcript expression of inflammatory mediators. All investigated genes were significantly upregulated in the hippocampus during aging, except vimentin and Serpina3n. Transcript expression is presented as ratio of 24- vs. 5-month-old mice ± s.e.m. Mann–Whitney-U test, * p ≤ 0.05, n = 7–10.
M. Boehme et al. / Neuroscience Letters 572 (2014) 7–12
9
BrdU incorporation into the dentate gyrus of aged mice was sparse and therefore all available cells were analyzed. The percentage of co-labeled cells (BrdU immunoreactivity with DCX or NeuN) was calculated. Statistical analysis of the number of BrdU+ cells in the hippocampus (during aging and after indomethacin treatment) was performed by the Mann–Whitney-U test (p ≤ 0.05). The percentage data of co-labeled cells (BrdU+ /DCX+ , BrdU+ /NeuN+ ) following indomethacin application underwent log2-transformation and were further analyzed by the Mann–Whitney-U test (p ≤ 0.05). 2.3. Analysis of microglial cell number and morphology Sections were processed for immunohistochemistry by using a rabbit primary antibody against Iba1 (1:1000, Wako) followed by a biotinylated secondary antibody (donkey anti-rabbit, 1:500, Dianova Inc.). Number and morphology of microglial cells were analyzed in the subgranular and granular cell layer of the dentate gyrus. Cells were counted in each hemisphere in the septal and temporal part of the hippocampus (frame of 300 × 150 m). The ImageJ-based Sholl Analysis Tool [8] was used to analyze the structural complexity of microglial cells in order to evaluate their state of activation. Selected microglial cells were skeletonized based on binary images. The area of cell somata, total number of intersections and the average length of the processes were assessed. The analysis included 5 aged controls and 4 aged indomethacin treated mice. 24 Cells of each mouse were selected [12 of each hemisphere, 6 within the septal (Bregma −1.4 to −1,8) and 6 within the temporal hippocampus (Bregma −3,4 to −3,6)]. Data were statistically analyzed by Mann–Whitney-U test (p ≤ 0.05).
Fig. 2. Effect of indomethacin on COX-1 and COX-2 expression in 24-month-old mice hippocampi. Transcript expression of COX-1 and COX-2 was significantly decreased following indomethacin treatment vs. CTR. Transcript expression is shown as % ± s.e.m. (CTR set to 100%). Mann–Whitney-U test, * p ≤ 0.05, n = 5–7.
2.4. qPCR RNA isolation from whole hippocampi, reverse transcription, and qPCR were performed as previously described [24]. Specific primers (for sequences see Table 1 and [22]) were used. We have previously confirmed Gapdh as a suitable housekeeping gene in aged mice [23]. Transcript ratios were calculated using the Pfaffl equation [19]. Statistical analysis was performed by the Mann–Whitney-U test (p ≤ 0.05). Transcript expression of inflammatory mediators during hippocampal aging is presented as ratios 24 vs. 5 months ± s.e.m. Changes in transcript expression following indomethacin treatment in 24-month-old mice are presented as % ± s.e.m. (vs. CTR set to 100%).
Fig. 3. Effect of indomethacin on pro-inflammatory mediators in 24-month-old mice hippocampi. Gfap and Iba1 showed a significantly decreased transcript expression after indomethacin treatment, whereas all other analyzed genes were not significantly altered. Transcript expression is presented as % ± s.e.m. (CTR were set to 100%). Mann–Whitney-U test, * p ≤ 0.05, n = 5–7.
10
M. Boehme et al. / Neuroscience Letters 572 (2014) 7–12
3. Results 3.1. Expression of inflammatory mediators in the aged hippocampus The transcript expression of inflammatory mediators was investigated during hippocampal aging by studying mice ranging from 5 to 24 months of age. During aging, the transcript expression of the pro-inflammatory cytokines Tnf␣ (tumor necrosis factor ␣), Il-1␣ (interleukin 1␣), and Il-1 (interleukin 1) (fold change: 1.7 ± 0.1, 2.1 ± 0.3, and 2.4 ± 0.3, respectively) and the chemokine Mip-1␣ (macrophage inflammatory protein 1␣) (fold change: 2.6 ± 0.4) significantly increased. Of the tested astrocytic markers, Gfap (glial fibrillary acidic protein) and Lcn2 (lipocalin 2) mRNA (fold change: 1.3 ± 0.1 and 3.0 ± 0.5, respectively) exhibited a significant increase in the aged hippocampus, whereas Vim (vimentin) and Serpina3n (serine (or cysteine) peptidase inhibitor, clade A, member 3 N) [27] showed no age-related regulation. All tested microglial markers (Iba1 (ionized calcium-binding adaptor molecule 1), F4/80, Cd68 (cluster of differentiation 68), and Cd86 (cluster of differentiation 86)) (fold change: 1.1 ± 0.1, 1.3 ± 0.1, 1.2 ± 0.1, and 1.8 ± 0.2, respectively) significantly increased their transcript expression during aging (Mann–Whitney-U test, p ≤ 0.05, Fig. 1, n = 7–10). 3.2. Effect of indomethacin on COX-1 and COX-2 expression It has been shown that changes of COX activity begins at the transcriptional level by inhibiting or increasing the expression of COX-1 and COX-2 [15,26]. Therefore, to test the efficacy of the transient indomethacin treatment, hippocampal COX-1 and COX-2 transcript expression was investigated in 24-month-old mice. As expected, indomethacin significantly decreased COX-1 and COX-2 transcript expression by 25.4% and 23.8%, respectively (Mann–Whitney-U test, p ≤ 0.05, Fig. 2, n = 5–7). 3.3. Effect of indomethacin on the expression of inflammatory mediators in the aged hippocampus Following indomethacin treatment, transcript expression of Gfap and Iba1 was significantly decreased by 36.1% and 24.7%, respectively, whereas all other tested inflammatory mediators remained unaffected (Mann–Whitney-U test, p ≤ 0.05, Fig. 3, n = 5–7). 3.4. Effect of indomethacin on microglial cell number and morphology in the aged hippocampus Indomethacin neither changed the number nor the morphology (as a sign of activation) of microglial cells in the subgranular and granular cell layer of the hippocampus (Mann–Whitney-U test, p ≤ 0.05, Fig. 4, n = 4–5). 3.5. Hippocampal neurogenesis in aged mice and the impact of indomethacin As expected, neurogenesis with regard to the number of BrdU+ cells was strongly diminished in aged brains by 75.4% (cells ± s.e.m.: 24 months 223 ± 8 vs. 5 months 909 ± 36, Fig. 5A). The fractions of BrdU+ cells immunoreactive for either DCX or NeuN were both significantly decreased in the hippocampus of aged mice by 93.5% and 57.0%, respectively (BrdU+ /DCX+ : 24 months 1.0 ± 0.7% vs. 5 months 16.1 ± 1.7% (±s.e.m.); BrdU+ /NeuN+ : 24 months 16.4 ± 1.8% vs. 5 months 38.1 ± 1.6% (±s.e.m.), Fig. 5B). Indomethacin applied to aged mice had no impact on neurogenesis with regard to the number of BrdU+ cells and the number of newborn hippocampal
Fig. 4. Effect of indomethacin on microglia number and morphology. Unchanged number of microglia in the dentate gyrus of aged mice treated with indomethacin (A). Sholl analysis as a morphometric method was used to evaluate the state of microglial activation in the subgranular and granular cell layer of the hippocampus. All parameters – the soma size, total number of intersections and the average length of processes – remained stable following indomethacin (B). Numbers of microglia and morphometric parameters are shown as mean ± s.e.m. Mann–Whitney-U test, p > 0.05, n = 4–5.
neurons (Fig. 5C and D) (Mann–Whitney-U test, p ≤ 0.05, Fig. 5, n = 5–10). 4. Discussion The effect of brain inflammation on neurogenesis remains a subject of intense debate. Brain inflammation is involved in the pathogenesis of several neurological disorders such as stroke [22] and epilepsy [25]. Stroke and epilepsy stimulate neurogenesis [1,18], however, the precise contribution of inflammation to this phenomenon is not fully understood [4]. In contrast, experimentally induced cerebral inflammation (e.g. by lipopolysaccharide or
M. Boehme et al. / Neuroscience Letters 572 (2014) 7–12
11
Fig. 5. Effect of aging and indomethacin on neurogenesis. In the aged hippocampus the number of BrdU+ cells (A) and the fractions of BrdU+ /DCX+ and BrdU+ /NeuN+ cells. (B) were significantly decreased 24 vs. 5 months CTR. Representative photographs of BrdU immunohistochemically stained slides show lower numbers of labeled cells in 24 vs. 5 months CTR (A) and no effect of indomethacin treatment in aged mice (B). Scale bar, 50 m. Indomethacin had no significant effect on neurogenesis in 24-month-old mice ((C) and (D)). BrdU+ cells are presented as mean ± s.e.m. ((A) and (C)) The fractions of BrdU+ /DCX+ and BrdU+ /NeuN+ cells are presented as % ± s.e.m. Mann–Whitney-U test, * p ≤ 0.05, n = 5–10.
irradiation) inhibits adult hippocampal neurogenesis [2,7,16]. Brain aging is associated with a certain level of neuroinflammation [9,22] and with a considerably reduced neurogenesis [11,13,21]. Our results are in accordance with the aforementioned findings. Specifically, we detected an age-related increase of the proinflammatory cytokines Tnf␣, Il-1␣, and Il-1 and the chemokine Mip-1␣, and of markers for reactive astrocytes (Gfap and Lcn2) and microglial cells (Iba1, F4/80, Cd68, and Cd86). As expected, neurogenesis was strongly diminished in aged brains. Based on our hypothesis that the decline in neurogenesis might be at least partly related to neuroinflammation in aged brains, the present study was designed to determine whether indomethacin can attenuate the age-related expression of selected cerebral inflammatory mediators and thereby promote hippocampal neurogenesis. The non-selective COX inhibitor indomethacin [3] effectively reduces levels of pathophysiologically increased inflammation [16] and exerts a positive impact on neurogenesis in pathophysiological inflammation-associated models [2,12,16]. Therefore, we expected to observe a similarly favorable effect of indomethacin on age-related increased basal cerebral inflammation and decreased neurogenesis when applied to aged mice. The effectiveness of the route of indomethacin application was confirmed by a subsequent decreased COX-1 and COX-2 transcript expression in aged brains. Moreover, following indomethacin treatment, transcript expression of Gfap and Iba1 was significantly decreased. While indomethacin shows effectiveness in reducing Gfap levels
in different types of gliosis [5,10], there are no studies investigating the impact of indomethacin on age-related Gfap or Iba1 expression. All other tested inflammatory mediators with an age-related increase in their transcript expression (Tnf␣, Il-1␣, Il-1, Mip-1␣, Lcn2, F4/80, Cd68, and Cd86) were not significantly altered following indomethacin treatment. Furthermore, there was no impact of indomethacin on neurogenesis in native aged mice with regard to the number of BrdU+ cells and the number of newborn hippocampal neurons. In agreement with this, microglial cells of the dentate gyrus were unchanged in number and morphology following indomethacin. Therefore, although indomethacin has been shown to be effective under pathophysiological inflammatory conditions, our data imply that it fails to effectively attenuate neuroinflammation and does not demonstrate a positive effect on hippocampal neurogenesis in aged mice. Nevertheless, we cannot extrapolate these indomethacin-specific data to generally exclude a negative impact of neuroinflammation on neurogenic processes in aged mice. Alternative pharmacological or non-pharmacological interventions which will effectively decrease the age-related neuroinflammation are required to determine the impact of neuroinflammation on neurogenesis in aged mice.
Acknowledgments The study was funded by the research program of the Jena Centre for Systems Biology of Ageing—JenAge (BMBF 0315581), by the
12
M. Boehme et al. / Neuroscience Letters 572 (2014) 7–12
Bernstein Fokus (BMBF 01GQ0923) and by the German Research Foundation (DFG WI830/10-1). References [1] A. Arvidsson, T. Collin, D. Kirik, Z. Kokaia, O. Lindvall, Neuronal replacement from endogenous precursors in the adult brain after stroke, Nat. Med. 8 (2002) 963–970. [2] G.N. Bastos, T. Moriya, F. Inui, T. Katura, N. Nakahata, Involvement of cyclooxygenase-2 in lipopolysaccharide-induced impairment of the newborn cell survival in the adult mouse dentate gyrus, Neuroscience 155 (2008) 454–462. [3] G. Dannhardt, W. Kiefer, Cyclooxygenase inhibitors—current status and future prospects, Eur. J. Med. Chem. 36 (2001) 109–126. [4] S. Das, A. Basu, Inflammation: a new candidate in modulating adult neurogenesis, J. Neurosci. Res. 86 (2008) 1199–1208. [5] V. Dinet, J. Bruban, N. Chalour, A. Maoui, N. An, L. Jonet, A. Buret, F. BeharCohen, C. Klein, J. Treton, F. Mascarelli, Distinct effects of inflammation on gliosis, osmohomeostasis, and vascular integrity during amyloid beta-induced retinal degeneration, Aging Cell 11 (2012) 683–693. [6] E. Drapeau, D. Nora Abrous, Stem cell review series: role of neurogenesis in age-related memory disorders, Aging Cell 7 (2008) 569–589. [7] C.T. Ekdahl, J.H. Claasen, S. Bonde, Z. Kokaia, O. Lindvall, Inflammation is detrimental for neurogenesis in adult brain, Proc. Nat. Acad. Sci. U.S.A. 100 (2003) 13632–13637. [8] T. Ferreira, Y. Ou, S. Li, E. Giniger, D.J. van Meyel, Dendrite architecture organized by transcriptional control of the F-actin nucleator Spire, Development 141 (2014) 650–660. [9] J.P. Godbout, R.W. Johnson, Age and neuroinflammation: a lifetime of psychoneuroimmune consequences, Immunol. Allergy Clin. North Am. 29 (2009) 321–337. [10] J. Goncalves, S. Baptista, T. Martins, N. Milhazes, F. Borges, C.F. Ribeiro, J.O. Malva, A.P. Silva, Methamphetamine-induced neuroinflammation and neuronal dysfunction in the mice hippocampus: preventive effect of indomethacin, Eur. J. Neurosci. 31 (2010) 315–326. [11] V.M. Heine, S. Maslam, M. Joels, P.J. Lucassen, Prominent decline of newborn cell proliferation, differentiation, and apoptosis in the aging dentate gyrus, in absence of an age-related hypothalamus–pituitary–adrenal axis activation, Neurobiol. Aging 25 (2004) 361–375. [12] B.D. Hoehn, T.D. Palmer, G.K. Steinberg, Neurogenesis in rats after focal cerebral ischemia is enhanced by indomethacin, Stroke 36 (2005) 2718–2724.
[13] H.G. Kuhn, H. Dickinson-Anson, F.H. Gage, Neurogenesis in the dentate gyrus of the adult rat: age-related decrease of neuronal progenitor proliferation, J. Neurosci. 16 (1996) 2027–2033. [14] M. Liebmann, A. Stahr, M. Guenther, O.W. Witte, C. Frahm, Astrocytic Cx43 and Cx30 differentially modulate adult neurogenesis in mice, Neurosci. Lett. 545 (2013) 40–45. [15] C. Martinez-Campa, A. Gonzalez, M.D. Mediavilla, C. Alonso-Gonzalez, V. Alvarez-Garcia, E.J. Sanchez-Barcelo, S. Cos, Melatonin inhibits aromatase promoter expression by regulating cyclooxygenases expression and activity in breast cancer cells, Br. J. Cancer 101 (2009) 1613–1619. [16] M.L. Monje, H. Toda, T.D. Palmer, Inflammatory blockade restores adult hippocampal neurogenesis, Science 302 (2003) 1760–1765. [17] E.E. Netland, J.L. Newton, R.E. Majocha, B.A. Tate, Indomethacin reverses the microglial response to amyloid beta-protein, Neurobiol. Aging 19 (1998) 201–204. [18] J.M. Parent, T.W. Yu, R.T. Leibowitz, D.H. Geschwind, R.S. Sloviter, D.H. Lowenstein, Dentate granule cell neurogenesis is increased by seizures and contributes to aberrant network reorganization in the adult rat hippocampus, J. Neurosci. 17 (1997) 3727–3738. [19] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucleic Acids Res. 29 (2001) e45. [20] M. Potter, J. Wax, G.M. Jones, Indomethacin is a potent inhibitor of pristane and plastic disc induced plasmacytomagenesis in a hypersusceptible BALB/c congenic strain, Blood 90 (1997) 260–269. [21] M.S. Rao, B. Hattiangady, A.K. Shetty, The window and mechanisms of major age-related decline in the production of new neurons within the dentate gyrus of the hippocampus, Aging Cell 5 (2006) 545–558. [22] M.W. Sieber, R.A. Claus, O.W. Witte, C. Frahm, Attenuated inflammatory response in aged mice brains following stroke, PLoS One 6 (2011) e26288. [23] M.W. Sieber, M. Guenther, M. Kohl, O.W. Witte, R.A. Claus, C. Frahm, Inter-age variability of bona fide unvaried transcripts Normalization of quantitative PCR data in ischemic stroke, Neurobiol. Aging 31 (2008) 654–664. [24] M.W. Sieber, N. Jaenisch, M. Brehm, M. Guenther, B. Linnartz-Gerlach, H. Neumann, O.W. Witte, C. Frahm, Attenuated inflammatory response in triggering receptor expressed on myeloid cells 2 (TREM2) knock-out mice following stroke, PLoS One 8 (2013) e52982. [25] A. Vezzani, J. French, T. Bartfai, T.Z. Baram, The role of inflammation in epilepsy, Nat. Rev. Neurol. 7 (2011) 31–40. [26] K.K. Wu, Control of cyclooxygenase-2 transcriptional activation by proinflammatory mediators, Prostaglandins Leukot. Essent. Fatty Acids 72 (2005) 89–93. [27] J.L. Zamanian, L. Xu, L.C. Foo, N. Nouri, L. Zhou, R.G. Giffard, B.A. Barres, Genomic analysis of reactive astrogliosis, J. Neurosci. 32 (2012) 6391–6410.
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
Impact of indomethacin on neuroinflammation and hippocampal neurogenesis in aged mice Marcus Boehme a,1 , Madlen Guenther a,1 , Anna Stahr a,b , Marie Liebmann a,c , Nadine Jaenisch a , Otto W. Witte a,d , Christiane Frahm a,∗ a
Hans-Berger Department of Neurology, University Hospital Jena, Friedrich-Schiller University, Jena, Germany Institute of Anatomy II, Heinrich-Heine-University, Medical Faculty, Düsseldorf, Germany c Department of Neurology, University of Münster, Münster, Germany d Center for Sepsis Control and Care, University Hospital Jena, Jena, Germany b
h i g h l i g h t s • • • • •
Effect of indomethacin on age-related neuroinflammation and neurogenesis was investigated in 24-month-old mice. Transcript expression of inflammatory mediators was upregulated in aged brains. Indomethacin decreased hippocampal COX-1 and COX-2 transcript expression. Gfap and Iba1 transcript expression were reduced by indomethacin in the aged hippocampus. Neurogenesis was unaffected by indomethacin.
a r t i c l e
i n f o
Article history: Received 21 January 2014 Received in revised form 24 April 2014 Accepted 26 April 2014 Available online 4 May 2014 Keywords: Aging Cytokines Inflammation Neurogenesis
a b s t r a c t Age-induced neuroinflammation could be a contributing factor to the restricted neurogenesis in aged mice. Indomethacin, a common non-steroidal anti-inflammatory drug, has been demonstrated to partially restore neurogenesis under pathophysiological inflammation-associated conditions in adult C57BL/6 mice. This study investigated whether indomethacin is able to decrease age-related neuroinflammation in the hippocampus (24-month-old mice) and thereby stimulate neurogenesis. During hippocampal aging, the transcript expression of pro-inflammatory cytokines (Tnf␣, Il-1␣, Il-1), the chemokine Mip-1␣, and markers for activated astrocytes (Gfap, Lcn2, but not Vim and Serpina3n) and microglia (Iba1, F4/80, Cd68, Cd86) significantly increased. Treatment with indomethacin significantly decreased COX-1 and COX-2 transcript expression. Of the age-related inflammatory mediators, only Gfap and Iba1 were affected by indomethacin treatment in the hippocampus, with a significantly reduced transcript expression being detected for both markers. Neurogenesis was unaffected by indomethacin. Thus, our data reveal that administration of indomethacin to aged mice is not able to effectively decrease neuroinflammation and promote neurogenesis. © 2014 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Abbreviations: BrdU, bromodeoxyuridine; Cd68, cluster of differentiation 68; Cd86, cluster of differentiation 86; COX, cyclooxygenase; CTR, control; DCX, doublecortin; Gfap, glial fibrillary acidic protein; Iba1, ionized calcium-binding adaptor molecule 1; Il-1␣, interleukin 1␣; Il-1, interleukin 1; INDO, indomethacin; Lcn2, lipocalin 2; Mip-1␣, macrophage inflammatory protein 1␣; qPCR, quantitative polymerase chain reaction; Serpina3n, serine (or cysteine) peptidase inhibitor, clade A, member 3N; Tnf␣, tumor necrosis factor ␣; Vim, vimentin. ∗ Corresponding author at: Hans-Berger Department of Neurology, University Hospital Jena, Friedrich-Schiller University, Erlanger Allee 101, 07747 Jena, Germany. Tel.: +49 3641 9 325909; fax: +49 3641 9 325902. E-mail address: [email protected] (C. Frahm). http://dx.doi.org/10.1016/j.neulet.2014.04.043 0304-3940/© 2014 Elsevier Ireland Ltd. All rights reserved.
Aging dramatically reduces basal neurogenesis in the hippocampus [11,13,21]. This has been proposed as a possible explanation for cognitive impairments in aged organisms [6]. The age-related decline in neurogenesis results from a reduced proliferation of neural stem cells as well as from a delayed maturation of newborn neurons [11,13,21]. As a consequence of
1
These authors contributed equally to this work.
8
M. Boehme et al. / Neuroscience Letters 572 (2014) 7–12
aging, the secretion of inflammatory mediators increases in the brain where activated microglia and astrocytes release cytokines and chemokines [22]. While it is accepted that experimentally induced cerebral inflammation (e.g. by lipopolysaccharide or irradiation) inhibits adult hippocampal neurogenesis [2,7,16], it is still unclear to what extent the age-related increased inflammatory status is responsible for the suppressed neurogenesis in the aged brain. To investigate the effect of an anti-inflammatory treatment on neurogenesis in aged brains, we utilized the common non-steroidal anti-inflammatory drug indomethacin, which is a non-selective inhibitor of the prostanoid-forming enzymes cyclooxygenase-1/2 (COX-1 and COX-2) [3]. Indomethacin has previously been shown to be effective in different experimental models of cerebral inflammation as well as in models of Alzheimer’s disease [16,17]. This study investigated the age-related expression of various inflammatory mediators (pro-inflammatory cytokines, chemokines, markers for activated microglia and astrocytes) proposed to modify hippocampal neurogenesis. Based on these data, the effect of a transient administration of indomethacin on hippocampal neuroinflammation and neurogenesis in non-pathological aged mice was assessed. We hypothesized that the application of indomethacin would attenuate the inflammatory processes in aged brains and thereby function as a potential stimulator of hippocampal neurogenesis. 2. Materials and methods 2.1. Experimental design Indomethacin was applied for 11 weeks to 22-month-old mice (INDO). As in previous studies [20], indomethacin (Sigma) was dissolved in absolute ethanol (10 mg/ml stock solution), and diluted in drinking water to a final concentration of 10 g/ml. To analyze hippocampal neurogenesis, mice received two daily intraperitoneal injections of bromodeoxyuridine (BrdU) (50 mg/kg body weight) over 6 days during the 6th week of indomethacin application (n = 5). Age-matched controls (n = 10) and adult 5-month-old mice without indomethacin treatment (n = 8) also received injections of BrdU. For quantitative polymerase chain reaction (qPCR) studies, mice were housed under the same conditions without receiving BrdU injections (24 months, INDO (n = 5); 24 months, control (CTR) (n = 7); 5 months, CTR (n = 10)). All animal procedures were performed on male C57BL/6 mice and approved by the local government (Thueringer Landesamt für Lebensmittelsicherheit und Verbraucherschutz (TLLV), Germany) and conformed to international guidelines on the ethical use of animals.
Table 1 Specific primers for qPCR. Gene
Primer sequence (5 –3 )
fw: TTCTGCTGTGGAAATGCAAG rv: GAGAAACATGGCCCGAAGT fw: AGCAACTAATGCTGAAAGCACA Cd86 rv: CGGAATAGTCTATAGCCCTCCA fw: ACTATGGGGTTGAGGCACTG COX-1 rv: GCCACATGCAGAACATGATAG fw: GGGTGTGAAGGGAAATAAGGA COX-2 rv: GGGCAAAGAATGCAAACATC fw: ACTATTGGGAGCTACTTCTGCACT F4/80 rv: TAGGAGCCTGGTACATTGGTG fw: AGAAAGGTTGAATCGCTGGA Gfap rv: GCCACTGCCTCGTATTGAGT fw: TGGAAGAACCAAGGAGCTGT Lcn2 rv: GGTGGGGACAGAGAAGATGA Serpina3n fw: TGCGAAACTGTACCCTCTGA rv: TCATTTGGGGTTGGCTATCT Vimentin fw: TGAAGGAAGAGATGGCTCGT rv: GGTGTCAACCAGAGGAAGTGA
Cd68
GenBank accession number NM 009853.1 NM 019388.3 NM 008969.3 NM 011198.3 NM 010130.4 NM 010277.3 NM 008491.1 NM 009252.2 X56397.1
2.2. Immunohistochemistry Mice were deeply anesthetized and transcardially perfused with 4% paraformaldehyde. Every 6th free-floating section was used for immunohistochemistry, as previously described in detail [14]. Slices were treated with a rat primary antibody against BrdU (1:500, AbD Serotec), followed by a biotinylated secondary antibody (donkey anti-rat, 1:500, Dianova Inc.). For triple-labeling immunofluorescence, every 6th section was incubated with the following primary antibodies: rat anti-BrdU (as above), goat anti-doublecortin (DCX) (1:80, Santa Cruz Biotechnology), and mouse anti-NeuN (1:500, Chemicon). Slices were further processed with secondary antibodies – Rhodamine anti-rat (1:500, Dianova Inc.), Alexa 488 anti-goat (1:500, Molecular Probes), and Cy5 anti-mouse (1:500, Dianova Inc.) – as previously described [14], followed by incubation in copper(II) sulfate (Sigma) to mask the age-related accumulation of lipofuscin. BrdU+ cells were quantified throughout the subgranular and granular cell layer of the entire rostro-caudal extent of the dentate gyrus using an Axioplan 2 microscope (Carl Zeiss). The resulting numbers were multiplied by a factor of six to attain the estimated total number of BrdU+ cells. For phenotyping of BrdU+ cells, random fields of dentate gyrus containing BrdU+ cells were selected and z-stacks were scanned by confocal laser microscopy (LSM510, Carl Zeiss). Phenotypes of 30 BrdU+ cells per dentate gyrus were determined in adult mice.
Fig. 1. Age-related transcript expression of inflammatory mediators. All investigated genes were significantly upregulated in the hippocampus during aging, except vimentin and Serpina3n. Transcript expression is presented as ratio of 24- vs. 5-month-old mice ± s.e.m. Mann–Whitney-U test, * p ≤ 0.05, n = 7–10.
M. Boehme et al. / Neuroscience Letters 572 (2014) 7–12
9
BrdU incorporation into the dentate gyrus of aged mice was sparse and therefore all available cells were analyzed. The percentage of co-labeled cells (BrdU immunoreactivity with DCX or NeuN) was calculated. Statistical analysis of the number of BrdU+ cells in the hippocampus (during aging and after indomethacin treatment) was performed by the Mann–Whitney-U test (p ≤ 0.05). The percentage data of co-labeled cells (BrdU+ /DCX+ , BrdU+ /NeuN+ ) following indomethacin application underwent log2-transformation and were further analyzed by the Mann–Whitney-U test (p ≤ 0.05). 2.3. Analysis of microglial cell number and morphology Sections were processed for immunohistochemistry by using a rabbit primary antibody against Iba1 (1:1000, Wako) followed by a biotinylated secondary antibody (donkey anti-rabbit, 1:500, Dianova Inc.). Number and morphology of microglial cells were analyzed in the subgranular and granular cell layer of the dentate gyrus. Cells were counted in each hemisphere in the septal and temporal part of the hippocampus (frame of 300 × 150 m). The ImageJ-based Sholl Analysis Tool [8] was used to analyze the structural complexity of microglial cells in order to evaluate their state of activation. Selected microglial cells were skeletonized based on binary images. The area of cell somata, total number of intersections and the average length of the processes were assessed. The analysis included 5 aged controls and 4 aged indomethacin treated mice. 24 Cells of each mouse were selected [12 of each hemisphere, 6 within the septal (Bregma −1.4 to −1,8) and 6 within the temporal hippocampus (Bregma −3,4 to −3,6)]. Data were statistically analyzed by Mann–Whitney-U test (p ≤ 0.05).
Fig. 2. Effect of indomethacin on COX-1 and COX-2 expression in 24-month-old mice hippocampi. Transcript expression of COX-1 and COX-2 was significantly decreased following indomethacin treatment vs. CTR. Transcript expression is shown as % ± s.e.m. (CTR set to 100%). Mann–Whitney-U test, * p ≤ 0.05, n = 5–7.
2.4. qPCR RNA isolation from whole hippocampi, reverse transcription, and qPCR were performed as previously described [24]. Specific primers (for sequences see Table 1 and [22]) were used. We have previously confirmed Gapdh as a suitable housekeeping gene in aged mice [23]. Transcript ratios were calculated using the Pfaffl equation [19]. Statistical analysis was performed by the Mann–Whitney-U test (p ≤ 0.05). Transcript expression of inflammatory mediators during hippocampal aging is presented as ratios 24 vs. 5 months ± s.e.m. Changes in transcript expression following indomethacin treatment in 24-month-old mice are presented as % ± s.e.m. (vs. CTR set to 100%).
Fig. 3. Effect of indomethacin on pro-inflammatory mediators in 24-month-old mice hippocampi. Gfap and Iba1 showed a significantly decreased transcript expression after indomethacin treatment, whereas all other analyzed genes were not significantly altered. Transcript expression is presented as % ± s.e.m. (CTR were set to 100%). Mann–Whitney-U test, * p ≤ 0.05, n = 5–7.
10
M. Boehme et al. / Neuroscience Letters 572 (2014) 7–12
3. Results 3.1. Expression of inflammatory mediators in the aged hippocampus The transcript expression of inflammatory mediators was investigated during hippocampal aging by studying mice ranging from 5 to 24 months of age. During aging, the transcript expression of the pro-inflammatory cytokines Tnf␣ (tumor necrosis factor ␣), Il-1␣ (interleukin 1␣), and Il-1 (interleukin 1) (fold change: 1.7 ± 0.1, 2.1 ± 0.3, and 2.4 ± 0.3, respectively) and the chemokine Mip-1␣ (macrophage inflammatory protein 1␣) (fold change: 2.6 ± 0.4) significantly increased. Of the tested astrocytic markers, Gfap (glial fibrillary acidic protein) and Lcn2 (lipocalin 2) mRNA (fold change: 1.3 ± 0.1 and 3.0 ± 0.5, respectively) exhibited a significant increase in the aged hippocampus, whereas Vim (vimentin) and Serpina3n (serine (or cysteine) peptidase inhibitor, clade A, member 3 N) [27] showed no age-related regulation. All tested microglial markers (Iba1 (ionized calcium-binding adaptor molecule 1), F4/80, Cd68 (cluster of differentiation 68), and Cd86 (cluster of differentiation 86)) (fold change: 1.1 ± 0.1, 1.3 ± 0.1, 1.2 ± 0.1, and 1.8 ± 0.2, respectively) significantly increased their transcript expression during aging (Mann–Whitney-U test, p ≤ 0.05, Fig. 1, n = 7–10). 3.2. Effect of indomethacin on COX-1 and COX-2 expression It has been shown that changes of COX activity begins at the transcriptional level by inhibiting or increasing the expression of COX-1 and COX-2 [15,26]. Therefore, to test the efficacy of the transient indomethacin treatment, hippocampal COX-1 and COX-2 transcript expression was investigated in 24-month-old mice. As expected, indomethacin significantly decreased COX-1 and COX-2 transcript expression by 25.4% and 23.8%, respectively (Mann–Whitney-U test, p ≤ 0.05, Fig. 2, n = 5–7). 3.3. Effect of indomethacin on the expression of inflammatory mediators in the aged hippocampus Following indomethacin treatment, transcript expression of Gfap and Iba1 was significantly decreased by 36.1% and 24.7%, respectively, whereas all other tested inflammatory mediators remained unaffected (Mann–Whitney-U test, p ≤ 0.05, Fig. 3, n = 5–7). 3.4. Effect of indomethacin on microglial cell number and morphology in the aged hippocampus Indomethacin neither changed the number nor the morphology (as a sign of activation) of microglial cells in the subgranular and granular cell layer of the hippocampus (Mann–Whitney-U test, p ≤ 0.05, Fig. 4, n = 4–5). 3.5. Hippocampal neurogenesis in aged mice and the impact of indomethacin As expected, neurogenesis with regard to the number of BrdU+ cells was strongly diminished in aged brains by 75.4% (cells ± s.e.m.: 24 months 223 ± 8 vs. 5 months 909 ± 36, Fig. 5A). The fractions of BrdU+ cells immunoreactive for either DCX or NeuN were both significantly decreased in the hippocampus of aged mice by 93.5% and 57.0%, respectively (BrdU+ /DCX+ : 24 months 1.0 ± 0.7% vs. 5 months 16.1 ± 1.7% (±s.e.m.); BrdU+ /NeuN+ : 24 months 16.4 ± 1.8% vs. 5 months 38.1 ± 1.6% (±s.e.m.), Fig. 5B). Indomethacin applied to aged mice had no impact on neurogenesis with regard to the number of BrdU+ cells and the number of newborn hippocampal
Fig. 4. Effect of indomethacin on microglia number and morphology. Unchanged number of microglia in the dentate gyrus of aged mice treated with indomethacin (A). Sholl analysis as a morphometric method was used to evaluate the state of microglial activation in the subgranular and granular cell layer of the hippocampus. All parameters – the soma size, total number of intersections and the average length of processes – remained stable following indomethacin (B). Numbers of microglia and morphometric parameters are shown as mean ± s.e.m. Mann–Whitney-U test, p > 0.05, n = 4–5.
neurons (Fig. 5C and D) (Mann–Whitney-U test, p ≤ 0.05, Fig. 5, n = 5–10). 4. Discussion The effect of brain inflammation on neurogenesis remains a subject of intense debate. Brain inflammation is involved in the pathogenesis of several neurological disorders such as stroke [22] and epilepsy [25]. Stroke and epilepsy stimulate neurogenesis [1,18], however, the precise contribution of inflammation to this phenomenon is not fully understood [4]. In contrast, experimentally induced cerebral inflammation (e.g. by lipopolysaccharide or
M. Boehme et al. / Neuroscience Letters 572 (2014) 7–12
11
Fig. 5. Effect of aging and indomethacin on neurogenesis. In the aged hippocampus the number of BrdU+ cells (A) and the fractions of BrdU+ /DCX+ and BrdU+ /NeuN+ cells. (B) were significantly decreased 24 vs. 5 months CTR. Representative photographs of BrdU immunohistochemically stained slides show lower numbers of labeled cells in 24 vs. 5 months CTR (A) and no effect of indomethacin treatment in aged mice (B). Scale bar, 50 m. Indomethacin had no significant effect on neurogenesis in 24-month-old mice ((C) and (D)). BrdU+ cells are presented as mean ± s.e.m. ((A) and (C)) The fractions of BrdU+ /DCX+ and BrdU+ /NeuN+ cells are presented as % ± s.e.m. Mann–Whitney-U test, * p ≤ 0.05, n = 5–10.
irradiation) inhibits adult hippocampal neurogenesis [2,7,16]. Brain aging is associated with a certain level of neuroinflammation [9,22] and with a considerably reduced neurogenesis [11,13,21]. Our results are in accordance with the aforementioned findings. Specifically, we detected an age-related increase of the proinflammatory cytokines Tnf␣, Il-1␣, and Il-1 and the chemokine Mip-1␣, and of markers for reactive astrocytes (Gfap and Lcn2) and microglial cells (Iba1, F4/80, Cd68, and Cd86). As expected, neurogenesis was strongly diminished in aged brains. Based on our hypothesis that the decline in neurogenesis might be at least partly related to neuroinflammation in aged brains, the present study was designed to determine whether indomethacin can attenuate the age-related expression of selected cerebral inflammatory mediators and thereby promote hippocampal neurogenesis. The non-selective COX inhibitor indomethacin [3] effectively reduces levels of pathophysiologically increased inflammation [16] and exerts a positive impact on neurogenesis in pathophysiological inflammation-associated models [2,12,16]. Therefore, we expected to observe a similarly favorable effect of indomethacin on age-related increased basal cerebral inflammation and decreased neurogenesis when applied to aged mice. The effectiveness of the route of indomethacin application was confirmed by a subsequent decreased COX-1 and COX-2 transcript expression in aged brains. Moreover, following indomethacin treatment, transcript expression of Gfap and Iba1 was significantly decreased. While indomethacin shows effectiveness in reducing Gfap levels
in different types of gliosis [5,10], there are no studies investigating the impact of indomethacin on age-related Gfap or Iba1 expression. All other tested inflammatory mediators with an age-related increase in their transcript expression (Tnf␣, Il-1␣, Il-1, Mip-1␣, Lcn2, F4/80, Cd68, and Cd86) were not significantly altered following indomethacin treatment. Furthermore, there was no impact of indomethacin on neurogenesis in native aged mice with regard to the number of BrdU+ cells and the number of newborn hippocampal neurons. In agreement with this, microglial cells of the dentate gyrus were unchanged in number and morphology following indomethacin. Therefore, although indomethacin has been shown to be effective under pathophysiological inflammatory conditions, our data imply that it fails to effectively attenuate neuroinflammation and does not demonstrate a positive effect on hippocampal neurogenesis in aged mice. Nevertheless, we cannot extrapolate these indomethacin-specific data to generally exclude a negative impact of neuroinflammation on neurogenic processes in aged mice. Alternative pharmacological or non-pharmacological interventions which will effectively decrease the age-related neuroinflammation are required to determine the impact of neuroinflammation on neurogenesis in aged mice.
Acknowledgments The study was funded by the research program of the Jena Centre for Systems Biology of Ageing—JenAge (BMBF 0315581), by the
12
M. Boehme et al. / Neuroscience Letters 572 (2014) 7–12
Bernstein Fokus (BMBF 01GQ0923) and by the German Research Foundation (DFG WI830/10-1). References [1] A. Arvidsson, T. Collin, D. Kirik, Z. Kokaia, O. Lindvall, Neuronal replacement from endogenous precursors in the adult brain after stroke, Nat. Med. 8 (2002) 963–970. [2] G.N. Bastos, T. Moriya, F. Inui, T. Katura, N. Nakahata, Involvement of cyclooxygenase-2 in lipopolysaccharide-induced impairment of the newborn cell survival in the adult mouse dentate gyrus, Neuroscience 155 (2008) 454–462. [3] G. Dannhardt, W. Kiefer, Cyclooxygenase inhibitors—current status and future prospects, Eur. J. Med. Chem. 36 (2001) 109–126. [4] S. Das, A. Basu, Inflammation: a new candidate in modulating adult neurogenesis, J. Neurosci. Res. 86 (2008) 1199–1208. [5] V. Dinet, J. Bruban, N. Chalour, A. Maoui, N. An, L. Jonet, A. Buret, F. BeharCohen, C. Klein, J. Treton, F. Mascarelli, Distinct effects of inflammation on gliosis, osmohomeostasis, and vascular integrity during amyloid beta-induced retinal degeneration, Aging Cell 11 (2012) 683–693. [6] E. Drapeau, D. Nora Abrous, Stem cell review series: role of neurogenesis in age-related memory disorders, Aging Cell 7 (2008) 569–589. [7] C.T. Ekdahl, J.H. Claasen, S. Bonde, Z. Kokaia, O. Lindvall, Inflammation is detrimental for neurogenesis in adult brain, Proc. Nat. Acad. Sci. U.S.A. 100 (2003) 13632–13637. [8] T. Ferreira, Y. Ou, S. Li, E. Giniger, D.J. van Meyel, Dendrite architecture organized by transcriptional control of the F-actin nucleator Spire, Development 141 (2014) 650–660. [9] J.P. Godbout, R.W. Johnson, Age and neuroinflammation: a lifetime of psychoneuroimmune consequences, Immunol. Allergy Clin. North Am. 29 (2009) 321–337. [10] J. Goncalves, S. Baptista, T. Martins, N. Milhazes, F. Borges, C.F. Ribeiro, J.O. Malva, A.P. Silva, Methamphetamine-induced neuroinflammation and neuronal dysfunction in the mice hippocampus: preventive effect of indomethacin, Eur. J. Neurosci. 31 (2010) 315–326. [11] V.M. Heine, S. Maslam, M. Joels, P.J. Lucassen, Prominent decline of newborn cell proliferation, differentiation, and apoptosis in the aging dentate gyrus, in absence of an age-related hypothalamus–pituitary–adrenal axis activation, Neurobiol. Aging 25 (2004) 361–375. [12] B.D. Hoehn, T.D. Palmer, G.K. Steinberg, Neurogenesis in rats after focal cerebral ischemia is enhanced by indomethacin, Stroke 36 (2005) 2718–2724.
[13] H.G. Kuhn, H. Dickinson-Anson, F.H. Gage, Neurogenesis in the dentate gyrus of the adult rat: age-related decrease of neuronal progenitor proliferation, J. Neurosci. 16 (1996) 2027–2033. [14] M. Liebmann, A. Stahr, M. Guenther, O.W. Witte, C. Frahm, Astrocytic Cx43 and Cx30 differentially modulate adult neurogenesis in mice, Neurosci. Lett. 545 (2013) 40–45. [15] C. Martinez-Campa, A. Gonzalez, M.D. Mediavilla, C. Alonso-Gonzalez, V. Alvarez-Garcia, E.J. Sanchez-Barcelo, S. Cos, Melatonin inhibits aromatase promoter expression by regulating cyclooxygenases expression and activity in breast cancer cells, Br. J. Cancer 101 (2009) 1613–1619. [16] M.L. Monje, H. Toda, T.D. Palmer, Inflammatory blockade restores adult hippocampal neurogenesis, Science 302 (2003) 1760–1765. [17] E.E. Netland, J.L. Newton, R.E. Majocha, B.A. Tate, Indomethacin reverses the microglial response to amyloid beta-protein, Neurobiol. Aging 19 (1998) 201–204. [18] J.M. Parent, T.W. Yu, R.T. Leibowitz, D.H. Geschwind, R.S. Sloviter, D.H. Lowenstein, Dentate granule cell neurogenesis is increased by seizures and contributes to aberrant network reorganization in the adult rat hippocampus, J. Neurosci. 17 (1997) 3727–3738. [19] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucleic Acids Res. 29 (2001) e45. [20] M. Potter, J. Wax, G.M. Jones, Indomethacin is a potent inhibitor of pristane and plastic disc induced plasmacytomagenesis in a hypersusceptible BALB/c congenic strain, Blood 90 (1997) 260–269. [21] M.S. Rao, B. Hattiangady, A.K. Shetty, The window and mechanisms of major age-related decline in the production of new neurons within the dentate gyrus of the hippocampus, Aging Cell 5 (2006) 545–558. [22] M.W. Sieber, R.A. Claus, O.W. Witte, C. Frahm, Attenuated inflammatory response in aged mice brains following stroke, PLoS One 6 (2011) e26288. [23] M.W. Sieber, M. Guenther, M. Kohl, O.W. Witte, R.A. Claus, C. Frahm, Inter-age variability of bona fide unvaried transcripts Normalization of quantitative PCR data in ischemic stroke, Neurobiol. Aging 31 (2008) 654–664. [24] M.W. Sieber, N. Jaenisch, M. Brehm, M. Guenther, B. Linnartz-Gerlach, H. Neumann, O.W. Witte, C. Frahm, Attenuated inflammatory response in triggering receptor expressed on myeloid cells 2 (TREM2) knock-out mice following stroke, PLoS One 8 (2013) e52982. [25] A. Vezzani, J. French, T. Bartfai, T.Z. Baram, The role of inflammation in epilepsy, Nat. Rev. Neurol. 7 (2011) 31–40. [26] K.K. Wu, Control of cyclooxygenase-2 transcriptional activation by proinflammatory mediators, Prostaglandins Leukot. Essent. Fatty Acids 72 (2005) 89–93. [27] J.L. Zamanian, L. Xu, L.C. Foo, N. Nouri, L. Zhou, R.G. Giffard, B.A. Barres, Genomic analysis of reactive astrogliosis, J. Neurosci. 32 (2012) 6391–6410.