Impact of intra-subunit interactions on the dimeric arginine kinase activity and structural stability

International Journal of Biological Macromolecules 49 (2011) 822–831

Contents lists available at ScienceDirect

International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac

Impact of intra-subunit interactions on the dimeric arginine kinase activity and structural stability Qing-Yun Wu a,b,1 , Kai-Zhou Jin e,1 , Feng Li d , Zhi-Qian Hu e,∗ , Xiao-Yun Wang c,∗ a State Key Laboratory of Molecular Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, PR China b Graduate University of Chinese Academy of Sciences, Beijing 100049, PR China c College of Life Sciences, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai’an, Shandong 271018, PR China d State Key Laboratory of Biosafety, Nanjing Institute of Environmental Sciences, Ministry of Environmental Protection of China, Nanjing 210042, PR China e Department of General Surgery, Shanghai Chang Zheng Hospital, Second Military Medical University, Shanghai, PR China

a r t i c l e

i n f o

Article history: Received 19 April 2011 Received in revised form 23 July 2011 Accepted 26 July 2011 Available online 5 August 2011 Keywords: Arginine kinase Aggregation Conformational change Domain–domain interactions Structural stability

a b s t r a c t Arginine kinase (AK) catalyzes the reversible phosphorylation of arginine by ATP, yielding the phosphoarginine. In this research, six conserved residues located on the intra-subunit domain–domain interfaces were mutated to explore their roles in the activity and structural stability of dimer AK. The mutations D69A, E70A, E71A and F80A led to pronounced loss of AK activity and structural stability. Although the mutations V75A and F76A had little effect on AK activity and structure, they caused gradually decreased the stability and reactivation of dimer AK. Our results suggested that the mutations might affect the correct positioning of the N-loop and C-loop thus disrupted the efficient recognition and interactions between the N-terminal domain and C-terminal domain which may influence the compact dimer structure, and result in decreased activity and structural stability. © 2011 Elsevier B.V. All rights reserved.

1. Introduction Arginine kinase (ATP: l-arginine phosphotransferase EC 2.7.3.3) (AK) catalyzes the reversible phosphorylation of arginine by ATP, yielding the phosphoarginine [1]. As an analogy of creatine kinase (CK) in vertebrates, AK is widely distributed in invertebrates. Phosphoarginine plays a critical role as an energy reserve because it can be transferred to ATP when energy is needed [1,2]. Thus, AK is a key enzyme that is directly associated with muscle contraction, ATP regeneration and energy transportation in cellular energy metabolism in invertebrates. In contrast to other PKs which are mostly dimieric or octameric [3,4], AKs are typically functional as monomers. Unlike other monomer AKs, the Stichopus japonicus AK is a unique homodimer, sequence analysis indicated that this dimer AK was evolutionarily

Abbreviations: AK, arginine kinase; CK, creatine kinase; DSC, differential scanning calorimetry; PK, phosphogen kinase; IPTG, isopropyl-d-thiogalactopyranoside; ANS, 1-anilinonaphtalene-8-sulfonate; SEC, size exclusion chromatography; GdnHCl, guanidine hydrochloride; Emax , emission maximum wavelength of the intrinsic fluorescence. ∗ Corresponding authors. Tel.: +86538 8242656x8430; fax: +86538 8248696. E-mail addresses: [email protected] (Z.-Q. Hu), [email protected] (X.-Y. Wang). 1 These authors contributed equally to this work. 0141-8130/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.ijbiomac.2011.07.020

close to CK, while its catalytic site was more homologous to that of monomeric AK [5–8]. Domain–domain interactions may be very important to the structure and functions of multidomain proteins. To achieve the native tertiary structures, adjacent domains need to recognize each other through domain–domain interactions and inter-subunit interface(s) [9–12]. As a special dimeric protein, S. japonicus AK is a valuable model to study the subunit dissociation and subunit interactions of oligomeric proteins [6,7]. The crystal structure of S. japonicus AK reveals that it contains two domains in each subunit and the active site is located in the cleft between the two domains (Fig. 1) [13]. The folding of S. japonicus AK involves several important intermediates: a partially active dimeric, an inactive dimeric, a compact monomeric and a partially folded monomeric intermediate [5–8,14,15]. Although the formation of the inactive dimer is not a rate limiting step during the refolding of dimer AK, the appeared of inactive dimer might be responsible for AK aggregation during folding process [6,7,14,15]. The inactive dimer is characterized as containing most of the native secondary structures, a compact tertiary structure, an almost native or slightly modified dimer interface and an unfolded active site [16]. These structural features strongly suggested that the intra-subunit domain–domain interactions might be weakened in the inactive dimer. Nowadays, most research has been focused on the folding process of dimer AK, little is known about the role of the intra-

Q.-Y. Wu et al. / International Journal of Biological Macromolecules 49 (2011) 822–831

823

Fig. 1. The crystal structure (ID Number: 3JU6) and the intra-subunit domain–domain interface of dimer WT and mutant AKs. (A) The crystal structure of dimer AK, the Nterminal, C-terminal domains and linker are indicated by red, green and yellow, respectively. (B) The detail intra-subunit interactions between the N-terminal and C-terminal domains. The hydrogen bond is shown by white dotted lines.

subunit domain–domain interactions on AK activity and structural stability. The long loop in the N-terminal domain contributed to the intra-subunit domain–domain interactions by interacting between the region from residue 72–76 and the loop in the C-terminal domain around C283 in CKs [17–19]. Although the TSAC structure of monomeric AK implied that the N-terminal loop was too short to interact with the C-terminal loop [19], the TSAC structure of dimer AK revealed that the region from residue D69 to F80 in the Nterminal loop might indirect interact with the C-terminal domain around C274 by hydration water molecules mediating interactions [13]. The N-loop of dimer AK is also stabilized by the hydrogen bonds between D60 (D62 in monomer AK) and R191 (R193 in monomer AK) and between Y73 (Y75 in monomer AK) and P275 (P272 in monomer AK) [21,22]. Sequence alignment indicates that most residues in this region are fully conserved in dimer AKs and

CKs, suggesting that this region might be important to keep the activity and structural stability of dimer AK. The residues D69, E71, F76 and F80 showed 100% similarity in both CK and AK, while the residues E70 and V75 showed 88% similarity in CK and 95% in AK in the alignment of 30 species cDNA of both AK and CK. The TSAC structure of dimer AK implied that the residues D69, E70, E71 and F80 interacted with the residues A198, R199, G195 and P275. To dissect the roles of intra-subunit interactions in dimer AK activity and structural stability, site-directed mutagenesis of these conserved residues D69, E70, E71, V75, F76 and F80 were performed. This study suggested that mutations D69A, E70A, E71 A and F80A led to distinct loss of activity and structural stability. Although the mutations V75A and F76A had no effect on AK activity and structure, caused gradually decreased the stability and reactivation of AK. All the mutants could not successfully regain their native structures when refolded from GdnHCl-denatured states in vitro. These

824

Q.-Y. Wu et al. / International Journal of Biological Macromolecules 49 (2011) 822–831

results indicated that the indirect or direct intra-subunit interactions might play a crucial role in keeping dimer AK activity and structural stability. 2. Materials and methods 2.1. Cloning, site-directed mutagenesis and expression of the mutant S. japonicus AK pET-28a vector with S. japonicus cDNA (pMD-S. japonicus WT – AK) inserted was used as a template for mutagenesis [23]. Six mutations (D69A, E70A, E71A, V75A, F76A and F80A) were introduced into the template of WT-AK by overlap PCR using mutation primers. The sequences of the mutant primers were as follows: for D69A, 5 - CTTCTTGCCGGGGCTGAAGAAACTTA3 and 5 -TAAGTTTCTTCAGCCCCGGCAAGAAG -3 ; for E70A, 5 - CTTGCCGGGGATGCTGAAACTTACAC-3 and 5 -GTGTAAGTTTCAGCATCCCCGGCAAG-3 ; for E71A, 5 -CCGGGGATGAAGCTACTTACACCGT -3 and 5 - ACGGTGTAAGTAGCTTCATCC CCGG3 ; for V75A, 5 - GAAACTTACACCGCTTTTGCTGATCT-3 and 5 AGATC AGCAAAAGCGGTGTAAGTTTC-3 ; for F76A, 5 - CTTACACCGTGGCTGCTGATCT ATTT-3 and 5 -AAATAGATCAGCAGCCACGGTGTAAG-3 ; for F80A, 5 -GTTTGCTGAT CTAGCTGATCCAGTCA-3 and 5 - TGACTGGATCAGCTAGATCAGCAAAC -3 mutated sequences are underlined. Then the cDNA of the mutants was cloned into expression vector pET-28a, sequenced and transformed into the Escherichia coli BL21 (DE3) codon plus. The WT and mutant AKs fusion proteins with His6 -tag were expressed in E. coli BL21 and purified as described previously [5,23]. The purity was checked by SDS-PAGE. Protein concentration was determined according to Bradford’s method [24]. All protein samples were prepared by dissolving the proteins in the standard buffer (10 mM glycine–NaOH, 1 mM DTT at pH 8.1). The final concentrations of the enzymes were 2.3 ␮M for most experiments unless otherwise indicated. 2.2. Enzyme assay and determination of kinetic parameters AK activity (phosphoarginine synthesis) was assayed as previously described with some modification [25,26]. The assay mixture for AK determination consisted of 100 mM Tris, pH 8.0, 10 mM larginine, 8 mM ATP-Na and 10 mM mercapto-ethanol and 10 ␮L of 0.01 mM AK solution. The reaction was initiated the enzyme solution at 25 ◦ C and lasted for 2 min. The mixture was heated at 100 ◦ C for 2 min to release the inorganic phosphate from the synthesized phosphoarginine. The inorganic phosphate was measured by adding NH4 MoO4 at 660 nm using an Ultrospec4300 pro UV-vis Spectrophotometer. A unit of AK is that amount of enzyme that catalyzes the formation of 1 mmol inorganic phosphate per min. The two-substrate graphical method was used to obtain the kinetic parameters [22]. The activity assays were carried out at the optimum pH (pH 8.1) and temperature (30 ◦ C) with different concentrations of ATP and arginine. All the reactions were carried out at least four times.

2.4. Spectroscopic experiments The temperature for all spectroscopic experiments was controlled by a thermoelectrically controlled cell holder. The aggregation of the proteins was monitored by recording the turbidity at 400 nm with an Ultraspec4300 pro UV/Visible spectrophotometer. Far-UV circular dichroism (CD) spectra were measured on a Jasco 715 spectrophotometer with a cell path-length of 0.1 cm. The intrinsic fluorescence emission spectra were collected on a Hitachi F-4500 spectrofluorimeter using 1-cm path-length cuvettes. For ANS-fluorescence measurements, 10-fold molar excess of ANS was added to the samples. The samples were equilibrated for 30 min in the dark, and then the extrinsic fluorescence was measured. The final protein concentration for spectroscopic experiments was 2.3 ␮M. All spectroscopic experiments were carried out at 25 ◦ C. 2.5. Unfolding and refolding experiments The thermal unfolding was carried out by incubating the samples in a thermoelectrically controlled cell holder of the CD spectrophotometer or fluorescence spectrofluorimeter. The temperature range was from 25 to 80 ◦ C and the CD or Trp fluorescence spectra were recorded at intervals of 2.5 ◦ C with an equilibration time of 2 min. The time-course thermal aggregation was detected by incubating the samples continuously at 48 ◦ C for 20 min and the turbidity at 400 nm was recorded. The final concentrations of the enzymes in the thermal unfolding and aggregation studies were 2.3 ␮M. The GdnHCl-induced unfolding was investigated by denaturing the proteins (With a final concentration of 2.3 ␮M) in stranded buffer with GdnHCl concentrations ranging from 0 to 3 M at 25 ◦ C overnight. Then CD, intrinsic and ANS fluorescence, and the turbidity at 400 nm were recorded using the same set of samples. In the dilution refolding process, the aggregation of the proteins was monitored by recording the turbidity at 400 nm. The final concentration of the enzyme for spectroscopic experiments was 2.3 ␮M and all experiments were carried out at 25 ◦ C. For the kinetic refolding of dimer AKs, proteins with a final concentration of 200 ␮M were completely denatured in 3 M GdnHCl overnight at 25 ◦ C. The refolding was initiated by a 100-fold dilution of the denatured AK into standard buffer, containing 0.1 M GdnHCl. The kinetics data was derived by monitoring the changes of the intrinsic fluorescence intensity at 350 nm on an F-4500 spectrofluorimeter with an excitation wavelength of 280 nm. The refolding rate constants k1 (fast phase rate constant) and k2 (slow phase rate constant) were calculated by non-linear fit using Origin 6.0 software. The reactivation course was studied using the kinetic method of the substrate reaction as described previously [7,27,28]. In brief, the reactivation was started by a 400-fold dilution of the denatured AKs into the buffer used for activity assay. Then the changes at 575 nm were monitored by UV/visible spectrophotometer for 10 min. The apparent reactivation rate constants (A) were calculated according to the reactivation kinetics model of AK described previously [7,27,28].

2.3. Heat- and GdnHCl-induced AK inactivation 2.6. Differential scanning calorimetry (DSC) measurements Thermal inactivation was performed by incubating the samples for 10 min at given temperatures varying from 25 to 60 ◦ C, then cooled on ice and the activity was measured at 30 ◦ C. For GdnHCl-induced inactivation, the protein solutions were incubated in the standard buffer containing various concentrations of GdnHCl (0–1 M) at 25 ◦ C overnight, then the activity was determined at 30 ◦ C. The final protein concentrations of the enzymes were 2.3 ␮M in all experiment.

DSC was used to analyze the thermal stabilities of the WT and mutant AKs. DSC was carried out in a differential adiabatic scanning microcalorimeter Setaram Micro DSC III. Prior to the DSC experiment, all samples were dialyzed against 30 mM HepesNaOH, 0.1 mM DTT (pH 8.1) overnight at 4 ◦ C. The DSC curves were obtained at a temperature scanning rate of 1 k min−1 from 25 to 75 ◦ C. The concentration of all samples was 2.3 mg ml–1 .

Q.-Y. Wu et al. / International Journal of Biological Macromolecules 49 (2011) 822–831

825

1.26 1.56 0.63 0.66 0.82 1.25 1.53 0.41 ± ± ± ± ± ± ± ± 25.7 29.93 12.51 12.06 15.88 24.08 29.95 6.76 38.5 ± 1.894 44.61 ± 2.35 18.64 ± 1.03 17.98 ± 0.72 23.68 ± 1.31 46.83 ± 2.48 45.51 ± 2.42 11.73 ± 0.62

Note: Kinetic parameters were obtained from at least four runs of the reaction. a Kinetic parameters cited from the article[30]. b The apparent reactivation rate was obtained from the data in Fig. 5B according to the reactivation kinetics model of AK described previously [6,7,14,27].

3.02 3.03 2.96 2.99 3.04 3.01 3.05 2.98 2.46 ± 0.0968 2.497 ± 0.096 3.712 ± 0.205 5.218 ± 0.277 3.919 ± 0.223 2.902 ± ± 0.151 2.727 ± 0.14 4.327 ± 0.224 0.032 0.043 ± 0.072 0.099 0.074 0.051 0.048 0.812 ± ± ± ± ± ± ± ± 0.814 0.823 1.254 1.321 1.289 0.964 0.894 1.452 1.249 ± 0.231 1.275 ± 0.125 3.203 ± 0.164 3.749 ± 0.214 3.533 ± 0.182 1.764 ± 0.084 1.928 ± 0.097 4.853 ± 0.243

ATP Km (mM) Arg

Kd (mM)

Arg

Km (mM)

kcat (s−1 )

Native AKa Recombinant WT-AK D69A E70A E71A V75A F76A F80A

In order to explore the effects of mutations on AK secondary and tertiary structures, the spectroscopic spectra were determined. The CD spectra of the seven proteins (Fig. 2A) indicated that the secondary structure compositions of V75A and F76A was similar to that of the WT-AK, while a smaller mean residue ellipticity was observed in the CD spectra of D69A, E70A, E71A and F80A, suggesting that these four mutants were not well-structured. Meanwhile the intrinsic fluorescence spectra of the D69A, E70A, E71A and F80A mutant AKs displayed a red shift, compared to the WT-AK, while that of the V75A and F76A mutant AKs showed similar position to the WT-AK (Fig. 2B). As all the four Trp residues are located on the C-terminal of dimer AK, the slight red-shift of the Trp fluorescence spectra of D69A, E70A, E71A and F80A suggested that these mutations might induce microenvironmental changes of the

Vmax (␮mol Pi min−1 mg−1 )

3.2. Mutations destroyed the secondary and tertiary structure of dimer AK

Mutations

Arg

showed the similar trend to that of Km value resulted in the Kd /Km of all mutants was similar to that of WT-AK, which suggested that the mutant did not affect the synergism in substrate binding. These results suggested that mutations in the intra-subunit domain–domain interfaces might reduce the binding affinity of arginine. Among the six residues studied here, D69A, E70A and F80A were found to be the most important ones for AK activity and substrate binding (Table 1). This can be understand by the fact that residues D69A, E70A may play important roles in sustaining the correct direction of N-terminal loop from residue 60 to 68 to interact with the substrate arginine, while the residue F80 may interact with the C-loop though the benzene ring by hydrophobic interaction (Fig. 1). This conclusion is consistent with the previous findings that from residues 60 to 68 in the loop is involved in the binding of arginine [18,19,30,31].

Table 1 Comparison of kinetic parameters for the forward reaction and apparent reactivation rate of recombinant WT and mutants AKs.

As is shown in Table 1, the recombinant WT-AK showed similar enzymatic characteristics to native AK, indicating the His6 -tag portion had no effects on its activity (Table 1). The activities of four mutations, D69A, E70A, E71A and F80A, retained 26.3–53.1% of the WT-AK activity (kcat ) and displayed decreased substrate affinity, while another two mutations had no effect on AK activArg ity. The Km values of D69A, E70A, E71A and F80A mutant AKs (1.254–1.452 mM) was 1.5–1.8 fold higher than that of recombiArg nant WT-AK (0.823 mM), while their Kd values (3.712–5.218 mM) were 1.49–2.08 fold higher than that of WT-AK (2.497 mM), resulting in a Kd /Km value of 2.96–3.04. These results indicated that those mutants decreased the binding affinity of ATP in the forward reaction but did not affect synergism in substrate binding, while those of another two mutants (V75A and F76A) were almost identical Arg to that of WT-AK. The Km values (1.082–1.634 mM) of mutations D69A, E70A, E71A and F80A increased about two- to fourfold, while those of another two mutants (V75A and F76A) were almost idenArg tical to that of WT-AK (0.421 mM). Meanwhile the Kd value also

KdATP (mM)

3.1. Mutations decreased dimer AK activity

0.413 ± 0.0593 0.421 ± 0.024 1.082 ± 0.069 1.254 ± 0.086 1.162 ± 0.064 0.586 ± 0.034 0.632 ± 0.032 1.634 ± 0.088

Kd /Km

3. Results and discussion

± ± ± ± ± ± ± ±

0.15 0.24 0.13 0.09 ± 0.07 0.16 0.13 0.14

In order to analyze the effect of the intra-subunit interaction on the AKs structures, both the SPDBV software (http://swissmodel.expasy.org/) and the VMD modeling procedures (version 1.8.7, http://www.ks.uiuc.edu/Research/vmd/) [29] were used to model the structure of mutated AKs based on PDB files (PDB ID numbers 3JU5 and 3JU6) for S. japonicus AK from the Protein Data Bank.

1.84 ± 0.03 0.82 ± 0.01 0.73 ± 0.01 1.06 ± 0.06 1.76 ± 0.08 1.69 ± 0.05 0.42 ± 0.01

Apparent reactivation rate b (*103 , s−1 )

2.7. Modeling the structure of mutant AKs

826

Q.-Y. Wu et al. / International Journal of Biological Macromolecules 49 (2011) 822–831

B WT D69A E70A E71A V75A F76A

15 10

[θ222]MRE

Relative flourescence intensity (100%)

A

5

F80A

0 -5 -10 -15 -20 190

200

210

220

230

240

250

260

C

60

ANS Fluorescence intensity

Wavelength (nm)

50

120 WT D69A E70A E71A V75A

100

80

F76A 60

F80A

40

20

0 300

320

340

360

380

400

Wavelength (nm)

WT D69A E70A E71A

40

V75A F76A F80A

30

ANS Control 20 10 0 400

450

500

550

600

Wavelength (nm) Fig. 2. Effect of mutations on AK structures detected by CD (A), intrinsic fluorescence spectra (B) and ANS fluorescence spectra (C). The CD data were presented as the mean residue ellipticity ([]MRW ) expressed in [103 deg cm2 dmol−1 ]. The final protein concentration was 2.3 ␮M. All experiments were carried out at 25 ◦ C.

Trp residues and affect the structure of C-terminal domain. Furthermore, the ANS fluorescence spectra also validated the above results. The intensity of D69A, E70A, E71A and F80A mutant AKs was higher than that of WT-AK at the same concentration (Fig. 2C), while that of V75A and F76A mutant AKs was identical to that of WT-AK, which reflected that the mutants (D69A, E70A, E71A and F80A) had more hydrophobic exposure than that of WT-AK to allow the more binding of ANS molecules. These spectroscopic experiments clearly indicated that the mutations (D69A, E70A, E71A and F80A) may impair both the secondary, tertiary structures of dimer AK. Analyzing the reason, the mutations may destroy the interactions between the C-terminal and the N-terminal domains and resulted in the looser structure of dimer AK. Combined with the decreased activity, one can deduce that the mutations impaired the intra-domain interactions and destroyed the conformation of the active site that located on the cleft between C-terminal and N-terminal domains. 3.3. Effects of the mutations on AK thermal inactivation and unfolding In order to detect the effects of mutations on AK structural stability, the thermal inactivation was determined. Previous studies have shown that the inactivation of dimer AK occurred prior to its unfolding, which suggested that the active site unfolded before the

conformational changes of the overall structure [6,7,14,15,20]. As shown in Fig. 3A, WT-AK could retain its activity well at temperatures lower than 45 ◦ C, and then it showed a steep decrease in activity from 45 to 60 ◦ C and completely lost its activity at temperatures above 65 ◦ C. This result was consistent with those reported in the literature [6,14]. The thermal inactivation of V75A and F76A were almost identical to the WT-AK, while other mutant AKs were inactivated at relatively low temperature. In agreement with previously studies, this observation suggested that the mutations D69A, E70A, E71A and F80A affected the stability of the active site. This conclusion is also consistent with the fact that the intra domain interactions may play roles in sustaining the conformation of the active site [13,20]. To further investigate whether the mutations affected the overall structural stability of AK, the thermal unfolding and aggregation of AKs were detected by CD and intrinsic fluorescence spectroscopy. The data presented in Fig. 3B and C could be well-fitted to a twostate model, and the midpoints of the thermal denaturation (Tm ) are summarized in Table 2. The Tm values of the WT-AK were almost similar for the two techniques: 56.3 ± 0.5 ◦ C from the change of residue ellipticity [ 222 ]MRE and 55.8 ± 0.5 ◦ C from that of fluorescence. Furthermore, both the CD data and the intrinsic fluorescence data indicated that the Tm values of the D69A, E70A, E71A and F80A mutant AKs were smaller than that of WT-AK, while that of the mutations V75A and F76A were almost identical to WT-AK. DSC was

Q.-Y. Wu et al. / International Journal of Biological Macromolecules 49 (2011) 822–831

827

Fig. 3. Thermal inactivation (A), thermal unfolding monitored by CD (B) and intrinsic fluorescence (C), thermal stability determined by DSC (D) and thermal aggregation at 48 ◦ C (E) of the WT and mutant AKs. In panel C, thermal melting curves were obtained by monitoring the ratio of I320 /I365 . The data in (A–C) were fitted to a two-state model, and the parameters are presented in Table 2.

also used to determine the thermal stabilities of WT and mutant AKs. The apparent heat capacity change profiles (Fig. 3D) revealed that an endothermic reaction took place just before the exothermic reaction in AKs. Since an overlap of the two reactions made the endothermic reaction partly offset by the following sharply exothermic reaction, it was difficult to gain the Tm (temperature when heat capacity reaches the maximum value) directly from the data shown in Fig. 3D. However, it was obvious that both the endothermic and exothermic reactions began at low temperatures in the order F80A < V69A < E70A < E71A < V76A < V75A < WT-AK, although the mutant V76A and V75A showed similar trends

to the WT-AK, which suggested that the mutants F80A, V69A, E70A and E71A were sensitive to the thermal changes in the environment, and thus the thermal stability of AKs followed the same order: F80A < V69A < E70A < E71A < V76A < V75A < WTAK. Those results suggested that the mutations D69A, E70A, E71A and F80A decreased the overall structural stability of AK. Previous studies indicated that the thermal denaturation of AK was an irreversible process accompanied with serious aggregation, and aggregates could form at temperatures where the protein had not been fully unfolded [14,15,20]. To detect the effects of mutations on the thermal aggregation, the aggregation of the AKs

828

Q.-Y. Wu et al. / International Journal of Biological Macromolecules 49 (2011) 822–831

Table 2 The stability of WT and the mutant AKs in the unfolding and refolding process. Parameters

WT-AK

T0.5 (◦C)a Tm ,CD (◦C)b Tm , Trp fluorescence (◦C)b c0.5 (M)c Cm , NI (M)d Cm , IU (M)d k1 (×103 s−1)e k2 (×103 s−1)e

53.6 56.3 55.8 0.28 0.33 1.30 15.4 1.4

± ± ± ± ± ± ± ±

0.5 0.5 0.5 0.02 0.02 0.11 0.3 0.01

D69A

E70A

E71A

V75A

F76A

F80A

40.5 ± 0.5 40.5 ± 0.5 48.9 ± 0.5 0.13 ± 0.01 0.18 ± 0.01 1.24 ± 0.12 2.4 ± 0.2 –

46.7 ± 0.5 42.4 ± 0.5 53.2 ± 0.5 0.21 ± 0.01 0.20 ± 0.01 1.28 ± 0.12 4.6 ± 0.3 –

47.4 ± 0.5 43.6 ± 0.5 53.8 ± 0.5 0.19 ± 0.01 0.24 ± 0.02 1.25 ± 0.13 5.1 ± 0.4 –

52.9 ± 0.5 56.3±0.5 55.4±0.5 0.26 ± 0.02 0.30 ± 0.03 1.26 ± 0.11 12.8 ± 0.8 –

53.1 ± 0.5 59.7 ± 0.5 55.2 ± 0.5 0.27 ± 0.02 0.31 ± 0.03 1.28 ± 0.12 13.4 ± 0.9 –

36.3 ± 0.5 38.7 ± 0.5 47.4 ± 0.5 0.1 ± 0.01 0.12 ± 0.01 1.20 ± 0.12 1.2 ± 0.1 –

a

Midpoint temperature of thermal inactivation. Midpoint temperature of thermal unfolding. c Midpoint concentration of inactivation induced by GdnHCl. d Midpoint concentrations of denaturation by GdnHCl for native to intermediate (Cm , NI) and for intermediate to unfolded states (Cm , IU), respectively. e Rate constants for the fast phase (k1) and slow phase (k2) of AK refolding from the GdnHCl-denatured state. The kinetic data of the WT-AK was fit by a biphasic process, while that of the mutant AKs were fit by a monophasic process. b

at 48 ◦ C was monitored by the turbidity at 400 nm (Fig. 3E). The thermal aggregation of the WT-AK had an obvious lag time of about 15 min, while the lag time of the mutants was much shorter (<2 min). Meanwhile, the aggregation amounts of the D69A, E70A, E71A and F80A mutants were much more that that of WT-AK. The shorter lag time and the faster aggregation rate indicated that during heating, the mutants (D69A, E70A, E71A and F80A) were more prone to aggregate than WT-AK. Combined with the above results, one can deduce that the mutations (D69A, E70A, E71A and F80A) impaired the intra-domain interactions and decreased the AK activity and structural stability. This observation was consistent with the speculations that the intra-subunit interactions played key roles in keeping the structural stability of the active site conformation [13,15,20]. 3.4. Effects of mutations on dimer GdnHCl induced AK inactivation and unfolding A similar result could be obtained for the inactivation induced by GdnHCl (Fig. 4A). Furthermore, the D69A, E71A and F80A mutants were the most unstable among the six mutants, suggesting that these positions may be more sterically constrained than other positions. In agreement with previously studies [6,14], our study also suggested that the dissociation of the dimer AK occurred above 0.4 M GdnHCl concentrations (data not shown). Thus, the inactivation of dimer AK in this study was not due to the dissociation of the dimer, but caused by the changes of the active site which located in the cleft between the N- and C-terminal domains [6,14,20]. While the mutations V75 and F76 had no significant effect on AK activity (Table 1, Figs. 1–3), it is more likely that these mutations influenced and weakened the indirect domain–domain interactions, and destabilized the enzyme during heat or GdnHCl inactivation. In order to investigate the effects of mutations on GdnHCl induced AK unfolding, spectroscopic spectrums were determined. In agreement with previous studies [6,7,14,15], the GdnHCl induced AK unfolding was a multistage process. As is shown in Fig. 4, the most dramatic change for WT-AK occurred at 0.4 M GdnHCl concentration. This state is characterized by about a 60% loss of secondary structures (Fig. 4B), a significant red-shift of the emission wavelength maximum (Emax ) of the intrinsic fluorescence (Fig. 4C), and a maximum of ANS-fluorescence intensity (Fig. 4D). Compared to WT-AK, most of the mutants reached this state earlier, while the changes above 1.5 M GdnHCl concentrations were almost identical to that of WT-AK. The I320 /I365 values of intrinsic Trp fluorescence also showed the same trends of mutations on the unfolding transition as above three techniques (Fig. 4E). The turbidity experiment further indicated that the mutations D69A, E70A, E71A and F80A impaired the structural stability of AK, as the aggregation amount of the mutations was higher than that of WT-AK at the

GdnHCl concentrations below 2 M especially at the concentration the intermediate formation (Fig. 4F). This result suggested that the intra-domain interactions played important roles in keeping the structural stability of AK. Consistent with the GdnHCl induced inactivation results (Fig. 4A), the mutations D69A, E70A, E71A and F80A had a significant effect on dimer AK denaturation at GdnHCl concentrations below 0.4 M. These results indicated that the mutations mainly affected the transition before the formation of the MG state which existed as a monomer at 1.2 M GdnHCl concentration. Previous studies had shown that dimer AK lost its activity before the dissociation of the dimer and formed an inactive dimeric intermediate [6,7,14]. Thus the mutations might affect the denaturation of AK by destabilizing the indirect intra-subunit interactions. Since this region is located on the cleft of the two domains near the active site (Fig. 1), it is more likely that the mutations destroyed the active site by influence the indirect or direct intra-subunit interactions rather than destabilized the dimer interface. This deduction is also in agreement with the thermal inactivation results. 3.5. Effects of mutations on dimer AK reactivation and refolding kinetics Consistent with previous studies [6,7,14,15], when the refolding of GdnHCl or urea-denatured dimer AK was initiated by dilution, aggregation appeared immediately (Fig. 5A). All the mutants showed much higher absorbance at 400 nm, which suggested that all the mutations promoted the formation of off pathway aggregates during refolding. In accordance with aggregation results, only WT-AK could efficiently reactivate after dilution for 10 min, while the mutants could not (Fig. 5B). This suggested that although the active forms could be obtained by recombinant expression in E. coli (Table 1), it was difficult for the mutants to recover their activities from the GdnHCl denatured state in vitro. To further characterize whether the mutations affected the refolding of dimer AK, refolding kinetics of WT and mutant AKs was obtained by monitoring the Trp fluorescence at 350 nm after the initiation of refolding by mixing the denatured proteins with Tris-HCl buffer containing 0.1 M GdnHCl. The refolding of the WT-AK was best fit by a biphasic process (Fig. 5C). The rate constants for the fast phase (k1 ) and the slow phase (k2 ) were 15.4 ± 0.3×10−3 and 1.4 ± 0.1 × 10−3 s−1 , respectively, which is quite similar to those reported in previous studies [6,7,14]. As for the refolding of most mutants, the data were best fit by a one-stage process, which suggested that the samples might be trapped by off-pathway misfolding and could not refold to their native states. It has been suggested that the fast phase of AK refolding involved the transition from denatured states to a monomeric intermediate, while the slow phase involved the transition from the inactive dimeric intermediate state to the native-like state [6,7,14]. Thus the significant difference in the refolding kinetics

Q.-Y. Wu et al. / International Journal of Biological Macromolecules 49 (2011) 822–831

A

B

0

WT -4

D69A E70A

80

WT

E71A

[θ]222

Relative activity (100%)

100

V75A

60

D69A

-8

E70A E71A

F76A -12

F80A

40

V75A F76A

20

F80A

-16

0 0.00

0.20

0.40

-20

0.60

0.0

0.5

[GdnHCl] (M)

1.5

2.0

2.5

3.0

D

350

345 WT D69A

Emax (nm)

1.0

[GdnHCl] (M)

340

E70A E71A

335

V75A F76A F80A

330

ANS Fluorenscence intensity

C

829

WT

80

D69A E70A 60

E71A V75A F76A

40

F80A

20

325 0.0

0.5

1.0

1.5

2.0

2.5

0

3.0

0.0

0.5

[GdnHCl] (M)

1.0

1.5

2.0

2.5

3.0

[GdnHCl] (M)

E

F

2.00

0.020

WT D69A E70A

0.016

turbidity (A400)

I320 / I365

1.60

E71A 1.20

V75A F76A

0.80

F80A

0.012

0.008

0.004 0.40 0.000 0.00

0.0

1.0

2.0

3.0

4.0

5.0

6.0

[GdnHCl] (M)

0.0

0.5

1.0

1.5

2.0

2.5

3.0

[GdnHCl] (M)

Fig. 4. Inactivation (A) and unfolding monitored by CD (B), Emax (C) and ANS fluorescence (D), I320 /I365 (E) values of intrinsic fluorescence, and turbidity at 400 nm (F) of the WT and mutant AKs induced by GdnHCl. The data in panel A were fitted to a two-state model, and the parameters are presented in Table 2.

might be due to the failure to generate active native-like states from the inactive dimeric intermediate resulting in an increased tendency to aggregate [6–8,14,15]. To further confirm this deduction, the reactivation kinetics was determined as previously described [7,27,28]. As is shown in Fig. 5B and Table 1, the reactivation kinetic courses of the substrate reaction of V75A and F76A were similar to that of WT-AK, while another four mutations (D69A, E70A, E71A and F80A) gradually decreased the reactivation rate of dimer AK. Since the reactivation rate is mainly limited by the slow phase of the refolding, the results in Fig. 5B also suggested that the muta-

tions (D69A, E70A, E71A and F80A) affected the transition from the inactive dimer AK to active dimer AK by destroying the direct or indirect intra-subunit interactions when dimer AK refolded from the GdnHCl denatured states. Although the folding pathway of AK has been thoroughly studied [6,7,12–14,18], as a dimeric two-domain protein (Fig. 1A), the refolding of AK involves not only the folding of the two domains, but also the recognition and assembly of the two domains to form the active native state. Although the intra domain–domain interactions was presumed to play a crucial role in sustain the

830

Q.-Y. Wu et al. / International Journal of Biological Macromolecules 49 (2011) 822–831

B

A 0.40

WT

E70A

V75A

D69A

E71A

F76A

0.60

F80A

WT D69A E70A E71A

0.30 0.40

P575

Turbidity (A400)

0.50

0.20

V75A F76A F80A

0.30 0.20

0.10 0.10 0.00

0.00 0

100

200

300

400

500

600

0

100

200

300

400

500

600

Time (s)

Time (S)

intensity

C 160

WT

140

D69A E70A E71A V75A F76A F80A

120 100 80 60 40 0

500

1000

1500

2000

Time (s) Fig. 5. Aggregation (A), reactivation (B) and refolding (C) kinetics of the WT and the mutant AKs. The kinetics was monitored by the changes of UV absorbance at 400 nm (panel A) or the intrinsic fluorescence intensity at 350 nm (panel C). The data in panel C were fitted to a biphasic process. In panel B, the reactivation was started by a 1000-fold dilution of the fully denatured enzyme into the buffer used for activity assay. Then the changes at 575 nm were monitored.

activity and stability of AK [13,20], little is known about the roles of intra subunit interactions in the assembly of AK during refolding. This study revealed that the intra domain–domain interactions played key roles in keeping the correct domain–domain recognition and assembly. The domain–domain recognition and assembly was important to the folding of the multi-subunits proteins. All those results suggested that mutations (D69A, E70A, E71A and F80A) that impaired the intra subunit interactions affected the correct conformation of the active site and the structural stability. In conclusion, the roles of six conserved residues located on the intra-subunit interactions of dimer AK were studied by site-directed mutagenesis. The effects of the mutations could be clustered into three classes. The mutation at F80 dramatically decreased the activity, structure and structural stability of dimer AK, suggesting that this residue was particularly important in the formation and maintenance of the structure and the sufficient contact between the N-terminal domain and C-terminal domain by direct interaction (Fig. 1). The mutations D69A, E70A and E71A also remarkably decreased the activity and structural stability of dimer AK, suggesting that those residues may be play key roles in maintenance the interaction between the N-loop and C-loop by hydration water molecules mediate indirect interactions. However, the effect of mutations V75A and F76A on the activity and stability were negligible, suggesting that these residues might provide some additional stability to the intra-subunit interactions. Interestingly, all the mutations affected the stability and refolding kinetics of dimer AKs. These results suggested that the mutations might

destroy the direct and indirect intra-subunit N-terminal and Cterminal domains interactions, and result in decreased stability when subjected to environmental stress. Acknowledgements The present investigation was supported by grants from the National Key Scientific Program of China (2007CB914504) and Program for Changjiang Scholar and Innovative Research Team in University (IRT0635) References [1] W.R. Ellington, Annu. Rev. Physiol. 63 (2001) 289–325. [2] M. Wyss, J. Smeitink, R.A. Wevers, Biochim. Biophys. Acta 1102 (1992) 119–166. [3] D.C. Watts, Evolution of phosphagen kinases, in: E. Schoffeniels (Ed.), Biochemical Evolution and the Origin of Life, North-Holland, Amsterdam, 1971, pp. 150–173. [4] D.C. Watts, Symp. Zool. Soc. Lond. 36 (1975) 105–127. [5] S.Y. Guo, Z. Guo, Q. Guo, B.Y. Chen, X.C. Wang, Protein Expr. Purif. 29 (2003) 230–234. [6] Q. Guo, F. Zhao, Z. Guo, X. Wang, J. Biochem. 136 (2004) 49–56. [7] Q. Guo, J.L. zhang, T.T. Liu, X.C. Wang, Int. J. Biol. Macromol. 41 (2007) 521–528. [8] R. Jaenicke, Prog. Biophys. Mol. Biol. 49 (1987) 117–237. [9] S.D. Lahiri, P.F. Wang, P.C. Babbitt, M.J. McLeish, G.L. Kenyon, K.N. Allen, Biochemistry 41 (2002) 13861–13867. [10] J.R. Garel, Protein Folding, W.H. Freeman and Co, New York, 1992, pp. 405–454. [11] S. Feng, T.J. Zhao, H.M. Zhou, Y.B. Yan, Int. J. Biochem. Cell Biol. 39 (2007) 392–401. [12] J.M. Cox, C.A. Davis, C. Chan, M.J. Jourden, A.D. Jorjorian, M.J. Brym, M.J. Snider, C.L. Borders, P.L. Edmiston, Biochemistry 42 (2003) 1863–1871.

Q.-Y. Wu et al. / International Journal of Biological Macromolecules 49 (2011) 822–831 [13] X. Wu, S. Ye, S. Guo, W. Yan, M. Bartlam, Z. Rao, FASEB J. 24 (2010) 242–252. [14] G. Qin, X.C. Wang, Protein Pept. Lett. 12 (2005) 369–373. [15] S.Y. Guo, Z. Guo, B.Y. Chen, Q. Guo, S.W. Ni, X.C. Wang, Biochemistry (Mosc) 68 (2003) 1267–1271. [16] T.J. Zhao, S. Feng, Y.L. Wang, Y. Liu, X.C. Luo, H.M. Zhou, Y.B. Yan, FEBS Lett. 580 (2006) 3835–3840. [17] H.M. Zhou, C.L. Tsou, Biochim. Biophys. Acta 911 (1987) 136–143. [18] T. Suzuki, M. Kamidochi, N. Inoue, H. Kawamichi, Y. Yazawa, T. Furukohri, W.R. Ellington, Biochem. J. 340 (1999) 671–675. [19] P.F. Wang, M.J. Mcleish, M.M. Kneen, G. Lee, G.L. Kenyon, Biochemistry 40 (2001) 11698–11705. [20] J.W. Zhang, T.J. Zhao, S.L. Wang, Q. Guo, T.T. Liu, F. Zhao, X.C. Wang, Int. J. Biol. Macromol. 38 (2006) 203–210. [21] N. Fujimoto, K. Tanaka, T. Suzuki, FEBS Lett. 579 (2005) 1688–1692.

831

[22] Q.Y. Wu, F. Li, X.Y. Wang, Insect Biochem. Mol. Biol. 38 (2008) 59–65. [23] Q.Y. Wu, F. Li, X.Y. Wang, Z.J. Chen, Impact of inter-subunit interactions on the dimeric arginine kinase activity and structural stability, Arch. Biochem. Biophys. 512 (2011) 61–68. [24] M.M. Bradford, Anal. Biochem. 72 (1976) 248–254. [25] C.A. Pereira, G.D. Alonso, M.C. Paveto, J. Biol. Chem. 275 (2000) 1495–1501. [26] M. Li, X.Y. Wang, J.G. Bai, Protein Pept. Lett. 13 (2006) 405–410. [27] J.C. Pan, Y. Cheng, E.F. Hui, H.M. Zhou, Biochem. Biophys. Res. Commun. 317 (2004) 539–544. [28] W.J. Zhu, M. Li, X.Y. Wang, Int. J. Biol. Macromol. 41 (2007) 564–571. [29] W. Humphrey, A. Dalke, K. Schulten, J. Mol. Graph. 14 (1996) 33–38. [30] K. Uda, T. Suzuki, Protein J. 23 (2004) 53–64. [31] Q.Y. Wu, F. Li, X.Y. Wang, Int. J. Biol. Macromol. 45 (2009) 393–398.