Impact of mitochondrial DNA copy number and displacement loop alterations on polycystic ovary syndrome risk in south Indian women

Mitochondrion xxx (xxxx) xxx–xxx

Contents lists available at ScienceDirect

Mitochondrion journal homepage: www.elsevier.com/locate/mito

Impact of mitochondrial DNA copy number and displacement loop alterations on polycystic ovary syndrome risk in south Indian women Tumu Venkat Reddya, Suresh Govatatia, Mamata Deenadayalb, Shivaji Sisinthyc,1, ⁎ Manjula Bhanooria, a

Department of Biochemistry, Osmania University, Hyderabad, India Infertility Institute and Research Centre (IIRC), Secundrabad, India c Centre for Cellular and Molecular Biology (CCMB), Hyderabad, India b

A R T I C L E I N F O

A B S T R A C T

Keywords: mtDNA copy number Mitochondrial D loop Mutations Polycystic ovary syndrome

Sequencing of mitochondrial displacement-loop (D-loop) of polycystic ovary syndrome (PCOS) patients and (n = 118) and controls (n = 114) of south Indian origin showed significant association of D310 (P = 0.042) and A189G (P = 0.018) SNPs with PCOS. qRT-PCR analysis revealed significantly diminished mtDNA copy number in PCOS patients compared to controls (P = 0.038). Furthermore, mtDNA copy number was significantly lower in PCOS cases carrying D310 and 189G alleles when compared to non-carriers (P = 0.001 and 0.006 respectively). The D310 carriers also showed significantly elevated LH/FSH ratio (P = 0.026). In conclusion, mtDNA D-loop and copy number alterations may constitute an inheritable risk factor for PCOS in south Indian women.

1. Introduction Polycystic ovary syndrome (PCOS) is a common endocrine disorder affecting 6–10% of the reproductive age women worldwide (Moran et al., 2010; Azziz et al., 2004). The main features of PCOS include menstrual dysfunction, anovulation, hyperandrogenism, low grade chronic inflammation, obesity, hyperlipidaemia and hirsutism (Azziz et al., 2009; Kelly et al., 2001; Franks, 1995; Kopera et al., 2010). PCOS patients have an increased risk of reproductive abnormalities and infertility (Goodarzi et al., 2011; Schmid et al., 2004). Despite its high prevalence, pathogenesis of PCOS is largely unknown. Recent investigations have shown that oxidative stress and reactive oxygen species (ROS) are involved in characteristics associated with PCOS (Murri et al., 2013). It is also shown to be associated with decreased antioxidants concentration (Palacio et al., 2006). Mitochondria are the prime site of cellular ROS generation, which leads to the damage of mitochondrial components such as mitochondrial DNA (mtDNA) and initiate the development of various diseases (Turrens, 2003; Murphy, 2009). The mitochondrial genome is more vulnerable to oxidative damage and acquires a higher rate of mutations than nuclear DNA. This is due to the absence of protecting histones, lack of an efficient DNA repair capabilities and its close proximity to the Electron Transport Chain (ETC) machinery where oxygen-derived free radicals are produced. The

⁎

1

mtDNA displacement loop (D-loop) is the only non-coding region of the mitochondrial genome. It is highly polymorphic and contains two constitutively hypervariable segments: Hyper Variable Region-1 (HVR1) (np 16024–16383) and Hyper Variable Region-2 (HVR-2) (np 57–372) which are the hot spots for acquired mutations (Stoneking, 2000). D-loop is the major regulatory site of mtDNA replication and transcription because it contains origin of replication for leading-strand and promoters for heavy and light strands (Taanman, 1999). Mutations in this region might affect mtDNA replication and transcription which lead to alterations in ETC, and subsequent elevation in cellular ROS generation and oxidative stress. Association of sequence alterations in the mtDNA D-loop have been reported in several human diseases including PCOS (Govatati et al., 2013; Tipirisetti et al., 2013; Zhuo et al., 2010; Zhuo et al., 2012), but no reports are documented in PCOS patients of Indian origin. There are thousands of copies of mtDNA in a single cell, and the level of mtDNA transcripts mainly depend on the copy number of mtDNA (Fernandez-Silva et al., 2003). The amount of mtDNA remains comparatively stable within the cells to meet the energy requirement of the cell to sustain under normal physiological conditions (Montier et al., 2009). It is likely that the alterations in the mtDNA copy number reflect the net results in the levels of oxidative stress, caused by environmental oxidants and gene–environmental interactions, all of which are thought to be risk factors for several types of diseases (Lee

Corresponding author at: Department of Biochemistry, Osmania University, Hyderabad 500 007, India. E-mail address: [email protected] (M. Bhanoori). Presently at: Jhaveri Microbiology Centre, L V Prasad Eye Institute, Hyderabad, India.

https://doi.org/10.1016/j.mito.2017.12.010 Received 10 April 2017; Received in revised form 18 October 2017; Accepted 21 December 2017 1567-7249/ © 2017 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

Please cite this article as: Tumu, V.R., Mitochondrion (2017), https://doi.org/10.1016/j.mito.2017.12.010

Mitochondrion xxx (xxxx) xxx–xxx

T.V. Reddy et al.

in EDTA coated vacutainers and plasma was removed followed by storage at − 20 °C until further analysis was performed. Mitochondrial DNA was extracted from 1 ml of EDTA anti-coagulated whole blood by the methods described elsewhere (Govatati et al., 2012).

et al., 1998; Verma et al., 2007). Copy number alterations of mtDNA have been shown in association with the development of various diseases including PCOS (Lee et al., 2011). The potential differences in mtDNA copy number in the context of D-loop alterations were not evaluated in PCOS. Present study investigated the correlation of mtDNA D-loop sequence alterations and mtDNA copy number with the risk of developing PCOS in South Indian women, a group that, so far as has not been investigated.

2.3. Genotyping of complete D-loop The genotyping of entire D-loop was carried out in a randomized, blinded fashion by PCR-Sequencing analysis. The entire D-loop region (nucleotide position [np] 16024–576 = 1,124 bp) of the mitochondrial genome was amplified by using the two sets of overlapping primers as described elsewhere (Govatati et al., 2013). Forward and reverse primers for the first segment were 5′ TCATTGGACAAGTAGCATCC3′ and 5′ GAGTGGTTAATAGGGTGATAG 3′ respectively, and for the second segment were 5′ CACCATCCTCCGTGAAATCA 3′, and 5′ AGGCTAAGC GTTTTGAGCTG 3′. PCRs were performed in a total volume of 25 μl containing 50 ng mitochondrial DNA, 2 to 6 pmol of each primer, 1X Taq polymerase buffer (1.5 mM MgCl2), and 0.25 U of Amplitaq DNA polymerase (Perkin Elmer, Foster City, CA). PCR amplification was performed in a programmable thermal cycler gradient PCR system (Eppendorf AG, Hamburg, Germany). The PCR amplification was performed initial denaturation at 96 °C for 5 min followed by 40 cycles of denaturation at 94 °C for 1 min, annealing at 58 °C for 1 min, extension at 72 °C for 1 min, and final extension for 10 min at 72 °C. The PCR products were sequenced with a Taq-Dye deoxy-terminator cycle sequencing kit (Applied BioSystems, Foster City, USA) using an automated ABI 3770 DNA sequencer (Applied BioSystems, Foster City, USA). Genotype calling was performed using Chromas V.2 software (Technelysium Ltd., Australia).

2. Materials and methods 2.1. Study subjects We carried out this study with a total of one hundred and eighteen South Indian women of reproductive age with PCOS who were recruited at the infertility institute and research centre (IIRC), Secunderabad, India. Briefly, these subjects were selected by using the Rotterdam criteria to diagnose PCOS (Rotterdam ESHRE/ASRMSponsored PCOS Consensus Workshop Group, 2004). PCOS was diagnosed when the phenotypes of the patients satisfied two of the following three criteria: 1) oligomenorrhea or amenorrhea, 2) clinical or biochemical hyperandrogenism, and 3) ultrasonographic polycystic ovarian morphology. Polycystic ovaries were identified by transvaginal ultrasonography following the Rotterdam criteria, which defines PCOS as the presence of 12 or more small (2 to 9 mm) follicles in each ovary. In addition, laboratory tests associated with PCOS revealing, oligoovulation (cycles longer than 35 days or less than 26 days), elevated free testosterone levels (serum testosterone concentration > 2.5 nmol/l or plasma testosterone > 40 pmol/l), hirsutism (total Ferriman-Gallwey score ≥ 7), and an elevated LH/FSH ratio. Women with cardiovascular disease, diabetes, other endocrine disorders and causes of hyperandrogonism, such as congenital adrenal hyperplasia, hyperprolactinemia, Cushing's syndrome or androgen-secreting tumors, smoking, and the use of alcohol or medications were excluded from this study. A total of one hundred and fourteen women of reproductive age with clinically diagnosed PCOS negative were recruited as control subjects. They had regular menses, normal glucose tolerance, no hirsutism, normal androgen levels and no family history of diabetes. They all had normal luteinizing hormone (LH) and follicle stimulating hormone (FSH) levels. None of the subjects had galactorrhea or any endocrine or systemic disease that could possibly affect her reproductive physiology. BMI of all subjects was calculated as: weight in kilograms (kg) divided by the square of height in metres (m2). The demographic and biochemical characteristics of South Indian PCOS women and controls were summarized in Table 1. Written informed consent obtained from all the participants for the collection of samples and subsequent analysis. The study was approved by the review board of the Osmania University, Hyderabad.

2.4. Identification of sequence variants in the mtDNA D-loop region The comparison of the obtained individual mtDNA D-loop sequences with the revised Cambridge reference sequence (rCRS) (Anderson et al., 1981; Andrews et al., 1999) was performed by Auto Assembler (ver. 2.1; Applied Biosystems) both in controls and PCOS patients. Sequence variations found in subjects were checked against the MITOMAP database (http://www.mitomap.org/MITOMAP/ PolymorphismsControl) and mtDB database. Sequences were aligned using CLUSTAL X, and mutations were noted by using MEGA software version 3.1. Those not recorded in these databases were considered as novel mutations, and those that are present in databases were reported as polymorphisms. 2.5. Quantification of mitochondrial DNA copy number by real time PCR The mtDNA copy number was measured using a real time quantitative polymerase chain reaction (qRT-PCR) using an Applied Biosystems 7500 Sequence Detection System (Applied Biosystems, Foster City, CA) (Hsieh et al., 2011). For the analysis of the nuclear DNA, forward primer 5′-GCCAATCTCAGTCCCTTCCC-3′ and the reverse primer 5′-TCGGTGAGGATCTTCATGAGGTA-3′ (GAPDH gene) were used to amplify 177-bp product. For analysis of the mtDNA, forward primer 5′-GGGCTACTACAACCCTTCGCT-3′ and the reverse primer 5′-GAGGCCTAGGTTGAGGTTGAC-3′ (ND1 gene) were used to amplify 153-bp product. The DNA (10 ng) was mixed with 10 μl SYBR Green I Master Mix (TaKaRa, USA) that contained 10 pmol of forward and reverse primer in a final volume of 20 μl. The qRT-PCR conditions consisted of initiation at 50 °C for 2 min, 95 °C for 10 s followed by 40 cycles of denaturation at 95 °C for 5 s, annealing at 59 °C for 35 s, and extension at 72 °C for 1 min. The value of the threshold cycle number (Ct) of the GAPDH gene and the ND1 gene were determined for each individual quantitative PCR run. Each measurement was performed at least two times and normalized in each experiment against control DNA sample. Ct value differences used to quantify mtDNA copy number relative to the GAPDH gene were calculated as follows: Relative

2.2. DNA extraction Peripheral blood samples (5 ml) were collected from all the subjects Table 1 Demographic and clinical characteristics of PCOS and control group. Variable

Controls

PCOS

p-Valuea

Number Age (years) BMI (kg/m2) FSH (μU/ml) LH (μU/ml) LH:FSH

114 29.72 ± 5.96 22.82 ± 3.26 6.2 ± 3.33 5.18 ± 1.49 0.98 ± 0.68

118 28.55 ± 6.01 23.13 ± 5.47 5.65 ± 1.59 7.74 ± 2.25 1.45 ± 0.57

0.1405 0.6033 0.1116 < 0.0001 < 0.0001

Data are given as mean ± S.D. or n (%). a p values obtained by comparison of variables between controls and PCOS by Student's t-test.

2

Mitochondrion xxx (xxxx) xxx–xxx

T.V. Reddy et al.

copy number (Rc) = 2Δ Ct, where Δ Ct is the CtGAPDH- CtND1. Reasonably good reproducibility was observed both within and between runs. The intraassay coefficients of variation of Ct values were around 2.5% and 3.9% for ND1 and GAPDH gene, respectively. The interassay coefficients of variation of Ct values were around 4.7% and 5.6% for ND1 and GAPDH gene, respectively. 2.6. Statistical analysis All statistical analyses were performed using the SPSS 17.0 software (SPSS Company, Chicago, IL, USA). The genotype distribution among cases and controls was performed using the Fisher's exact test. The chisquare (χ2), odds ratio and 95% confidence interval (CI) values were calculated using the online Vassar Stats Calculator (http://www. faculty.vassar.edu/lowry/VassarStats.html). Logarithmic transformation of the obtained data was used because the original values of the relative mtDNA copy number did not show a normal distribution. Values were expressed as mean ± standard deviation unless otherwise indicated. Student's t-test was used to determine the differences of the mtDNA copy number between PCOS cases and controls, and the differences between two subgroups. When, more than two subgroups were present, one-way ANOVA was used to calculate the differences of mtDNA copy number, followed by the least significant difference test. For all the statistical tests, values of p < 0.05 was considered as statistically significant difference.

Fig. 1. Log-transformed mtDNA copy number in PCOS women and controls. P values (P < 0.05) calculated by the t-test.

Table 2 Risk of PCOS as estimated by mtDNA copy number. Cases (%)

Controls (%)

Odds ratio (95% CI)b

By mean > 1.50 ≤ 1.50

44 (37.3) 74 (62.7)

56 (50.11) 54 (49.09)

1 (reference) 0.573 (0.3381–0.9724)

By quartile > 1.86 1.51–1.86

17 (14.41) 27 (22.88)

29 (26.36) 27 (24.55)

1.20–1.50

32 (27.12)

27 (24.55)

≤ 1.20

42 (35.59)

27 (24.55)

1(reference) 0.586 (0.2629–1.3071) 0.495 (0.2249–1.0875) 0.377 (0.1745–0.8134)

mtDNA copy numbera

χ2P value

3. Results 3.1. Demographic and biochemical characteristics of cases and controls Demographic characteristics of PCOS patients and controls are described in Table 1. The mean age of the PCOS patients and that of the controls was 28.55 ± 6.01 (range = 20–46; median = 27) and 29.72 ± 5.96 (range = 17–48; median = 29) years respectively with no statistical significant difference between two groups (P = 0.1405). However, with respect to LH and LH: FSH ratio, we found significant difference between PCOS patients and controls (P < 0.0001). However, in case of BMI, and FSH we did not find significant difference between cases and controls.

0.038

0.19 0.07 0.011

CI = confidence intervals. a mtDNA copy number was grouped based on the mean/quartile value of controls. b Analysis were performed using unconditional logistic regression models adjusted for age, body mass index.

3.2. Decreased relative mtDNA copy number in PCOS The mtDNA copy number variations were quantified mtDNA copy number by using qRT-PCR. Our results revealed significantly decreased mtDNA copy number in PCOS cases compared to controls (P = 0.047) (Fig. 1). The mean mtDNA copy number was 1.36 ± 0.44 in PCOS and 1.50 ± 0.56 in controls. The studied subjects were divided into high or low groups based on the mean mtDNA copy number value in controls. We have observed that low mtDNA copy number was associated with an increased risk of PCOS after adjusting for age, BMI (higher mean vs lower, odds ratio (OR) = 0.573, 95%CI: 0.3381 to 0.9724, P value (χ2) = 0.038; Table 2). In addition, analysis of the obtained data by the quartile distribution of mtDNA copy number in controls revealed an association between mtDNA copy number and PCOS risk (highest quartile vs lowest, OR = 0.377, 95%CI: 0.1745 to 0.8134; P value = 0.011; Table 2).

present in PCOS patients and remaining (155) were polymorphisms. Among 158 variants, 10 were nucleotide deletions, 5 were nucleotide insertions and remaining 143 were nucleotide substitutions (transitions and transversions) (Table 3). Four (2.85%) of 158 polymorphisms occurred in > 50% of the cases. Polymorphisms were predominantly located in HVR-1 (51%) and HVR-2 (33%) than control region (16%) of mitochondrial D-loop (Table 3). Among 158 polymorphisms, nineteen have > 5% minor allele frequency in both patients and controls (Table 4). Among them two SNPs, A189G (P = 0.018) and D310 (P = 0.042), showed statistically significant difference between PCOS patients and controls (Fig. 2).

3.4. Correlation between mtDNA copy number and D loop mutations To identify impact of significant D-loop polymorphisms on mtDNA copy number, we analyzed their correlation in PCOS cases along with the clinical parameters such as age, BMI, testosterone and LH and LH: FSH ratio (Table 5). mtDNA copy number was significantly lower in PCOS cases carrying D310 and 189G alleles when compared to noncarriers (P = 0.001 and 0.006 respectively). In addition, the D310 carrying cases showed significantly higher LH/FSH ratio (P = 0.026).

3.3. Analysis of sequence alterations in mtDNA D-loop region The entire D-loop region of mitochondrial genome of all cases and controls were successfully sequenced. All the variants were analyzed with the help of mitochondrial databases, such as; Mitomap and mtDB, to find the significance of the observed variants. We identified 158 distinct sequence variants (Supplementary Table 1) in which three were novel mutations (Supplementary Table 2; Supplementary Fig. 1) 3

Mitochondrion xxx (xxxx) xxx–xxx

T.V. Reddy et al.

Table 3 Total number of mitochondrial D-loop mutations observed in PCOS patients and/or controls. S. no

Region

Position (bp)

Substitutions

Deletions

Insertions

Total no. of mutations

Percentage

1 2 3

HVR-1a HVR-2a Control region of D-loop

16024–16383 57-372 16384-56 and 373-576

78 42 23

3 5 2

0 5 0

81 52 25

51 33 16

143

10

5

158

100%

Total a

Hyper variable region (HVR).

4. Discussion

of D-loop polymorphisms in patient group; indicating possible role in development of PCOS. In addition, our results showed significant association between PCOS risk and D-loop polymorphisms located at D310. By sequencing of entire D-loop, we have identified three novel mutations in PCOS patients. The role of these novel mutations in pathogenesis of PCOS is presently unknown. However, few of these mutations are located in structurally/functionally important regions of mtDNA D-loop. Further functional studies may be required to determine the consequence of these mutations on energy metabolism and PCOS development. The D-loop has a poly-C tract (PCT) located between 303 and 315 nucleotides known as D310, which has been identified as a frequent hot spot mutation region in human diseases. Alterations in the number of cytosines present in poly-C tract are an indication of DNA instability. In the present study, for the first time we report significant association of D310 alterations in PCOS patients of Indian origin. The D310 region is more sensitive to oxidative damage compare to other regions and is located at the CSB-II (Conserved Sequence Bock-II), which is crucial for replication origin of mtDNA (Mambo et al., 2003; Chen et al., 2009; Lee et al., 1998; Verma et al., 2007). This CSB-II contributes to the formation of a persistent RNA-DNA hybrid that initiates the mtDNA replication (Lee et al., 1998). Hence, sequence alterations at D310 region may affect mtDNA replication thereby altering mtDNA copy number. We identified decreased mtDNA copy number in PCOS patients carrying D310 variants. Decreased mtDNA copy number could result in diminished expression of mtDNA-encoded genes (Skov et al., 2007), mitochondrial dysfunction, elevated ROS generation and PCOS progression (Victor et al., 2009). Further biochemical and molecular biology studies are necessary to confirm our findings because these mutations could have functional significance, affecting the replication as well as transcription of the mitochondrial genome.

Earlier, we have demonstrated the correlation between various candidate genes and risk of PCOS in South Indian women (Tumu et al., 2013; Guruvaiah et al., 2014; Guruvaiah et al., 2016). Present study investigated the impact of mtDNA copy number alterations and mtDNA D-loop sequence variations on PCOS risk in South Indian women. Earlier studies have reported association between either mtDNA copy number alterations or mtDNA D-loop sequence variations and PCOS risk in different ethnic groups (Lee et al., 2011; Zhuo et al., 2010; Zhuo et al., 2012), but none of them have described combined effect. To the best of our knowledge, this is the first study reporting impact of both factors on pathophysiology of PCOS. Our results showed significantly decreased mtDNA copy number in PCOS patients when compared to age and BMI-matched healthy controls. It is consistent with a previous case-control study reporting reduced mtDNA copy number in Korean women with PCOS (Lee et al., 2011). However, present findings indicated correlation of mtDNA copy number with LH/FSH ratio. However, Rabol et al. has reported no correlation between skeletal muscle mtDNA copy number and PCOS risk (Rabøl et al., 2011). This inconsistency may be due to tissue preference or ethnic differences of studied population or of smaller sample size. Therefore, further studies are warranted to elucidate these associations and the molecular mechanisms. Mitochondrial D-loop is a hot spot for mtDNA alterations (Stoneking, 2000). Although, these mutations do not lead to alterations in the coding sequence of mtDNA, they may interrupt sequence in the promoter region and modify the affinity for the inducers and modifiers of mtDNA replication and/or mtDNA transcription. D-loop mutations may alter transcription of mitochondrial genome which may affect ETC and cellular ROS generation. Present study showed elevated frequencies Table 4 Mitochondrial D-loop polymorphisms observed in PCOS patients and/or controls. Serial number

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 a

Variant position

A73G A93G T146C T152C A189G T195A A263G 316C ins T489C 522CA del G16129A T16172C T16189C C16223T T16311C G16319A T16362C T16519C D310

rCRSa

A A T T A T A C T CA G T T C T G T T C7TC6

Base change

G G C C G A G CC C – A C C T C A C C C8/C9/T/C6

IUPAC code

R R Y Y R W R – Y – R Y Y Y Y R Y Y –

χ 2P value

Frequency Cases

Controls

75 7 8 23 31 8 72 71 25 15 9 10 14 44 13 12 14 63 64

75 4 12 23 15 7 76 68 14 7 11 11 15 52 16 5 8 54 33

rCRS: Revised Cambridge reference sequence.

4

0.928 0.361 0.338 0.974 0.018 0.803 0.521 0.746 0.059 0.076 0.624 0.803 0.823 0.259 0.534 0.081 0.186 0.261 0.042

Function location

Association

H strand origin H to strand origin H to strand origin H to strand origin TFAM binding site

TFAM binding site

Leukemia (Zhou et al., 2017)

Mitochondrion xxx (xxxx) xxx–xxx

T.V. Reddy et al.

Fig. 2. A) Genotyping of the mitochondrial D-loop D310 polymorphism by sequence analysis of the PCR amplified product using a forward primer. B) Genotyping of the mitochondrial Dloop A189G polymorphism by sequence analysis of the PCR amplified product using a forward primer.

Non-mutated one (A); *Mutated one (G).

PCOS to an increased risk of development of diabetes (Skov et al., 2007). In vitro study in polycystic gilt ovaries indicated that hypermethylation of the D-loop region was associated with lower mtDNA content and down-regulated expression of mtDNA-encoded genes, implicating possible role on the replication and transcription of mitochondrial genome (Jia et al., 2016). In this study, we identified decreased mtDNA copy number in PCOS patients carrying D310 variants. In conclusion, sequence alterations of mtDNA D-loop may constitute heritable risk factor for PCOS in South Indian women. Decrease in mtDNA copy number and increased frequency of D310 polymorphisms is strongly associated with PCOS risk. To the best of our knowledge, this is the first study exploring the association of mtDNA D-loop polymorphisms and mtDNA copy number with PCOS risk in Indian population. Further, our findings have the potential for future clinical utility in the identification of individuals at a higher risk of developing PCOS. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.mito.2017.12.010.

The A189G mutation located in the HVR-2 (np 57–372), is another mutational hot spot (Stoneking, 2000). The A189G transition occurs very close to the primary site of H-strand DNA synthesis initiation at position 191 (OH1) (Ghivizzani et al., 1994). In addition, the mutations that occur in the OH (Heavy strand origins-OH 1 and OH 2), were found to be associated with a significant decrease in mtDNA copy number (Lee et al., 2004). These findings strongly suggest that germline mutations occurring near the heavy-strand origins may reduce mtDNA replication in PCOS. The mtDNA copy number was a relative measure of the cellular number or mass of mitochondria. Recent experimental studies suggested that alterations in mtDNA played a fundamental role in the increase in ROS, maintenance of mtDNA copy number was essential for the preservation of mitochondrial function and cell growth (Jeng et al., 2008). In patients with PCOS, decreased expression of nuclear-encoded genes involved in OXPHOS has been demonstrated in skeletal muscle. The discovery led to the hypothesis that aberrations in mitochondrial function could be the pathological feature of insulin resistance linking

Table 5 Genotype frequencies of significant D-loop polymorphisms and mtDNA copy number in PCOS patients based on clinical characteristics. p valuea

D310

No. of subjects Age (years) BMI (kg/m−2) FSH (mIU/mL) LH (mIU/mL) LH:FSH Ratio mtDNA copy number

Yes

No

64 29.02 ± 5.95 23.6 ± 5.56 5.69 ± 1.57 7.69 ± 2.26 1.26 ± 0.50 1.07 ± 0.28

51 27.32 ± 6.64 21.51 ± 5.36 5.6 ± 1.50 7.84 ± 2.01 1.53 ± 0.78 1.81 ± 0.22

0.221 0.097 0.799 0.765 0.026 0.001

Data are given as mean ± S.D. a p values obtained by comparison of variables between controls and PCOS by Student's t-test.

5

p valuea

A189G A

G

84 28.43 ± 5.53 23.54 ± 5.33 5.55 ± 1.65 7.60 ± 2.18 1.48 ± 0.65 1.58 ± 0.29

31 28.89 ± 7.60 22.24 ± 6.13 5.96 ± 1.43 8.1 ± 2.50 1.36 ± 0.27 1.38 ± 0.45

0.723 0.276 0.224 0.297 0.322 0.006

Mitochondrion xxx (xxxx) xxx–xxx

T.V. Reddy et al.

Author contributions

number and expression are essential for preservation of mitochondrial function and cell growth. J. Cell. Biochem. 103, 347–357. Jia, L., Li, J., He, B., et al., 2016. Abnormally activated one-carbon metabolic pathway is associated with mtDNA hypermethylation and mitochondrial malfunction in the oocytes of polycystic gilt ovaries. Sci. Rep. 6, 19436. Kelly, C.C., Lyall, H., Petrie, J.R., et al., 2001. Low grade chronic inflammation in women with polycystic ovarian syndrome. J. Clin. Endocrinol. Metab. 86, 2453–2455. Kopera, D., Wehr, E., Obermayer-Pietsch, B., 2010. Endocrinology of hirsutism. Int. J. Trichol. 2, 30. Lee, H.C., CY, Lu, Fahn, H.J., et al., 1998. Aging- and smoking-associated alteration in the relative content of mitochondrial DNA in human lung. FEBS Lett. 441, 292–296. Lee, H.C., Li, S.H., Lin, J.C., et al., 2004. Somatic mutations in the D-loop and decrease in the copy number of mitochondrial DNA in human hepatocellular carcinoma. Mutat. Res. 547, 71–78. Lee, S.H., Chung, D.J., Lee, H.S., et al., 2011. Mitochondrial DNA copy number in peripheral blood in polycystic ovary syndrome. Metabolism 60, 1677–1682. Mambo, E., Gao, X., Cohen, Y., et al., 2003. Electrophile and oxidant damage of mitochondrial DNA leading to rapid evolution of homoplasmic mutations. Proc. Natl. Acad. Sci. U. S. A. 100, 1838–1843. Montier, L.L., Deng, J.J., Bai, Y., 2009. Number matters: control of mammalian mitochondrial DNA copy number. J. Genet. Genomics 36, 125–131. Moran, C., Tena, G., Moran, S., et al., 2010. Prevalence of polycystic ovary syndrome and related disorders in Mexican women. Gynecol. Obstet. Investig. 69, 274–280. Murphy, M.P., 2009. How mitochondria produce reactive oxygen species. Biochem. J. 417, 1–3. Murri, M., Luque-Ramírez, M., Insenser, M., et al., 2013. Circulating markers of oxidative stress and polycystic ovary syndrome (PCOS): a systematic review and meta-analysis. Hum. Reprod. Update 19, 268–288. Palacio, J.R., Iborra, A., Ulcova-Gallova, Z., et al., 2006. The presence of antibodies to oxidative modified proteins in serum from polycystic ovary syndrome patients. Clin. Exp. Immunol. 144, 217–222. Rabøl, R., Svendsen, P.F., Skovbro, M., et al., 2011. Skeletal muscle mitochondrial function in polycystic ovarian syndrome. Eur. J. Endocrinol. 165, 631–637. Rotterdam ESHRE/ASRM-Sponsored PCOS Consensus Workshop Group, 2004. Revised 2003 consensus on diagnostic criteria and long-term health risks related to polycystic ovary syndrome. Fertil. Steril. 81, 19–25. Schmid, J., Kirchengast, S., Vytiska-Binstorfer, E., et al., 2004. Infertility caused by PCOS health-related quality of life among Austrian and Moslem immigrant women in Austria. Hum. Reprod. 19, 2251–2257. Skov, V., Glintborg, D., Knudsen, S., et al., 2007. Reduced expression of nuclear-encoded genes involved in mitochondrial oxidative metabolism in skeletal muscle of insulinresistant women with polycystic ovary syndrome. Diabetes 56, 2349–2355. Stoneking, M., 2000. Hypervariable sites in the mtDNA control region are mutational hotspots. Am. J. Hum. Genet. 67, 1029–1032. Taanman, J.W., 1999. The mitochondrial genome: structure, transcription, translation and replication. Biochim. Biophys. Acta 1410, 103–123. Tipirisetti, N.R., Govatati, S., Pullari, P., et al., 2013. Mitochondrial control region alterations and breast cancer risk: a study in south Indian population. PLoS One 9, e85363. Tumu, V.R., Govatati, S., Guruvaiah, P., et al., 2013. An interleukin-6 gene promoter polymorphism is associated with polycystic ovary syndrome in south Indian women. J. Assist. Reprod. Genet. 30, 1541–1546. Turrens, J.F., 2003. Mitochondrial formation of reactive oxygen species. J. Physiol. 552, 335–344. Verma, M., Naviaux, R.K., Tanaka, M., et al., 2007. Meeting report: mitochondrial DNA and cancer epidemiology. Cancer Res. 67, 437–439. Victor, M., Rocha, M., Banuls, C., et al., 2009. Mitochondrial complex I impairment in leukocytes from polycystic ovary syndrome patients with insulin resistance. J. Clin. Endocrinol. Metab. 94, 3505. Zhou, J., Gou, H., Ye, Y., et al., 2017. Sequence variations of mitochondrial DNA D-loop region in patients with acute myeloid leukemia. Oncol. Lett. 14, 6269–6276. Zhuo, G., Feng, G., Leng, J., et al., 2010. A 9-bp deletion homoplasmy in women with polycystic ovary syndrome revealed by mitochondrial genome-mutation screen. Biochem. Genet. 48, 157–163. Zhuo, G., Ding, Y., Feng, G., et al., 2012. Analysis of mitochondrial DNA sequence variants in patients with polycystic ovary syndrome. Arch. Gynecol. Obstet. 286, 653–659.

Conceived and designed the experiments: SS MB TVR. Performed the experiments and analyzed the data: TVR SG. Contributed acquisition of data/materials/analysis: MD. Drafting the article: TVR SG MB. Funding This study was supported in part by grants from the Department of Science and Technology (DST), India (Lr No: SR/FT/LS-188/2009) to Dr. Manjula Bhanoori. Conflict of interest No conflict of interests. Acknowledgments We are most grateful to all of the patients who participated in the present study. Tumu Venkat Reddy would like to thank University Grants Commission (UGC), India for providing Basic Science Research (BSR-JRF) fellowship. References Anderson, S., Bankier, A.T., Barrel, B.G., et al., 1981. Sequence and organization of the human mitochondrial genome. Nature 290, 457–465. Andrews, R.M., Kubacka, I., Chinnery, P.F., et al., 1999. Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat. Genet. 23, 147. Azziz, R., Woods, K.S., Reyna, R., et al., 2004. The prevalence and features of the polycystic ovary syndrome in an unselected population. J. Clin. Endocrinol. Metab. 89, 2745–2749. Azziz, R., Carmina, E., Dewailly, D., et al., 2009. The androgen excess and PCOS Society criteria for the polycystic ovary syndrome: the complete task force report. Fertil. Steril. 91, 456–488. Chen, J.B., Lin, T.K., Liao, S.C., et al., 2009. Lack of association between mutations of gene-encoding mitochondrial D310 (displacement loop) mononucleotide repeat and oxidative stress in chronic dialysis patients in Taiwan. J. Negat. Results Biomed. 8 (10). Fernandez-Silva, P., Enriquez, J.A., Montoya, J., 2003. Replication and transcription of mammalian mitochondrial DNA. Exp. Physiol. 88, 41–56. Franks, S., 1995. Polycystic ovary syndrome. N. Engl. J. Med. 333, 853–861. Ghivizzani, S.C., Madsen, C.S., Nelen, M.R., et al., 1994. In organello footprint analysis of human mitochondrial DNA: human mitochondrial transcription factor a interactions at the origin of replication. Mol. Cell. Biol. 14, 7717–7730. Goodarzi, M.O., Dumesic, D.A., Chazenbalk, G., et al., 2011. Polycystic ovary syndrome: etiology, pathogenesis and diagnosis. Nat. Rev. Endocrinol. 7, 219–231. Govatati, S., Tipirisetti, N.R., Perugu, S., et al., 2012. Mitochondrial genome variations in advanced stage endometriosis: a study in South Indian population. PLoS One 7, e40668. Govatati, S., Deenadayal, M., Shivaji, S., et al., 2013. Mitochondrial displacement loop alterations are associated with endometriosis. Fertil. Steril. 99 (1980–6.e9). Guruvaiah, P., Govatati, S., Reddy, T.V., et al., 2014. The VEGF + 405 G > C 5′ untranslated region polymorphism and risk of PCOS: a study in the South Indian Women. J. Assist. Reprod. Genet. 31, 1383–1389. Guruvaiah, P., Govatati, S., Reddy, T.V., et al., 2016. Analysis of Connexin37 gene C1019T polymorphism and PCOS susceptibility in south Indian population: case–control study. Eur. J. Obstet. Gynecol. Reprod. Biol. 196, 17–20. Hsieh, C.J., Weng, S.W., Liou, C.W., et al., 2011. Tissue-specific differences in mitochondrial DNA content in type 2 diabetes. Diabetes Res. Clin. Pract. 92, 106–110. Jeng, J.Y., Yeh, T.S., Lee, J.W., et al., 2008. Maintenance of mitochondrial DNA copy

6