Impact of stromal cell composition on BMP-induced chondrogenic differentiation of mouse bone marrow derived mesenchymal cells

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 4 ( 2 00 8 ) 2 4 0 0 –24 1 0

a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m

w w w. e l s e v i e r. c o m / l o c a t e / y e x c r

Research Article

Impact of stromal cell composition on BMP-induced chondrogenic differentiation of mouse bone marrow derived mesenchymal cells Hanna Taipaleenmäkia,d , Salla Suomi b,c,e , Teuvo Hentunenb,c , Tiina Laitala-Leinonenb,c , Anna-Marja Säämänena,⁎ a Department of Medical Biochemistry and Genetics, Institute of Biomedicine, University of Turku, Kiinamyllynkatu 10, 20520 Turku, Finland b Department of Cell Biology and Anatomy Institute of Biomedicine, University of Turku, Turku, Finland c Bone Biology Research Consortium, Department of Anatomy, Institute of Biomedicine, University of Turku, Turku, Finland d Turku Graduate School of Biomedical Sciences, University of Turku, Turku, Finland e Drug Discovery Graduate School, University of Turku, Turku, Finland

ARTICLE INFORMATION

ABS T R AC T

Article Chronology:

Chondrogenic differentiation in mesenchymal stromal cells (MSCs) has been actively

Received 10 January 2008

studied due to their potential use in mesenchymal tissue repair. Our goal was to develop a

Revised version received

simple isolation protocol for adherent mouse MSCs to simultaneously clear off

25 April 2008

hematopoietic cells and expand to obtain enough starting material for differentiation

Accepted 29 April 2008

studies. CD34 and CD45 expressing cells were rapidly removed by inhibiting growth of

Available online 15 May 2008

hematopoietic cells to yield short-term selected (STS) cells. Further passaging enriched more primitive, uniformly Sca-1 expressing, long-term selected (LTS) cells. The efficacy of

Keywords:

several BMPs to induce chondrogenesis in pellet culture was compared in STS and LTS cells.

Chondrogenesis

In STS cells, chondrogenesis progressed rapidly to terminal differentiation while LTS cells

Mesenchymal stem cell

differentiated at a slower rate with no hypertrophy. In LTS cells, rhBMP homodimers -2, -4,

Mesenchymal stromal cell

-6 and rhBMP2/7 heterodimer were effective enhancers of chondrogenesis over that of

Bone marrow stroma

rhBMP-5 and -7. In STS cells, rhBMP-2 and rhBMP-7 supported rapid chondrogenesis and

Mouse

terminal differentiation over that of rhBMP-6. These data indicate the impact of stromal cell

Bone morphogenetic protein

composition on the chondrogenic differentiation profile, which is an important aspect to be

Stem cell antigen-1

considered when standardizing differentiation assay conditions as well as developing MSC

Sca-1

based cartilage repair technologies.

Terminal differentiation

© 2008 Elsevier Inc. All rights reserved.

Pellet culture

Introduction Mesenchymal stromal cells (MSCs) are multipotent nonhematopoietic cells present in a variety of adult tissues including bone marrow, periosteum and adipose tissue. They

represent a small percentage of the total population of nucleated cells in the bone marrow, where majority of the cells consists of hematopoietic stem cells and hematopoiesis supporting stromal cells [1]. As MSCs represent a rather heterogenous cell population consisting mostly of a mixture

⁎ Corresponding author. E-mail address: [email protected] (A.-M. Säämänen) 0014-4827/$ – see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2008.04.019

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 4 ( 2 00 8 ) 2 4 0 0 –24 1 0

of various mesenchymal progenitor cells rather than true stem cells, the International Tissue Repair Society has recently recommended the use of a broader term “multipotent mesenchymal stromal cells” for this cell population [2]. The suggested minimal criteria for defining these human MSC are 1) plastic adherence under standard culture conditions and expression of CD105, CD73 and CD90; 2) lack of expression of CD45, CD34, CD14 or CD11b, CD79a or CD19 and HLA-DR surface markers; and 3) differentiation capacity to osteogenic, adipogenic and chondrogenic lineages [3]. Due to their potential therapeutic applications there is a continuing interest to study MSC biology, especially the regulation of their differentiation. MSCs from human and rat bone marrow have been most extensively characterized, in part because they are easy to isolate and can be extensively expanded in culture while retaining their multipotent differentiation capacity. For unknown reasons it has been more difficult to isolate and expand MSCs from mouse bone marrow [4,5]. Mouse MSC populations with differentiation potential towards osteogenic, adipogenic and chondrogenic lineages have been selected either by extended passaging on plastic, or cell sorting approaches by negative selection for surface antigens CD11b, CD31, CD34, CD45, CD48, CD90, CD117, CD135, or positive selection for CD29, CD44, CD49e, CD81, CD106 and stem cell antigen 1 (Sca-1) [4,6–9]. However, there are differences between mouse strains both in respect to MSC surface antigens and in the differentiation potential, which present further challenges when developing differentiation assays [4]. Due to ethical reasons, bone marrow cells are easier to obtain from mice than humans. Hence, mouse is a practical model for pre-screening of the chondrogenic potency of various novel factors that may have potential in stem cell -based repair of cartilage lesions. Chondrogenic differentiation has been shown to occur when MSCs are cultured in 3D culture format and in serumfree medium supplemented with one or more members of the TGF-β superfamily [10]. Under these conditions, cells lose their fibroblastic morphology and begin to express cartilage-specific matrix components. In vitro chondrogenesis is typically carried out in a micromass pellet culture system, which allows cellcell interactions similar to those occurring in prechondrogenic condensations during embryonic development [11]. In addition, several growth factors that promote chondrogenesis in vivo also enhance in vitro chondrogenesis of MSCs [12,13]. Bone morphogenetic proteins (BMPs) form a subgroup of TGF-β superfamily of growth factors. They were originally described by their capacity to induce ectopic bone and cartilage formation in vivo [14] and are known to initiate, promote and maintain osteogenesis and chondrogenesis [15,16]. The chondrogenic potency of various BMPs is actively studied due to the possible clinical applications in cartilage repair technologies. BMP-2, -4, -6, -7, -9 and -13 have been reported to induce in vitro chondrogenesis of human mesenchymal progenitor cells [17–23]. The effects of different BMPs on mouse MSC differentiation has been less characterized [24,25]. Our goal in this study was to optimize the isolation and differentiation conditions for mouse MSCs to be used for characterization of the chondrogenesis inducing efficacy of various factors. In this study, we compared the chondrogenic effects of five BMPs in a 3D pellet culture system, where

2401

adherent bone marrow stromal cells were selected by passaging in a medium that inhibits the growth of hematopoietic stem cells. Effects of BMP-2, -4, -5, -6, and -7 were studied, as they were found to be expressed in knee epiphyseal cartilage during limb chondrogenesis in developing mouse embryos. BMPs form dimers, the dimeric conformation being required for their biological function [26]. BMP-2/BMP-7 heterodimer has been reported to effectively induce osteoblastic differentiation [27,28], but to our knowledge, its influence on chondrogenesis has not been studied. Hence, BMP-2/ BMP-7 heterodimer was also included in this study. We found that selection of MSCs by passaging greatly contributed to the differentiation profiles by reducing chondrogenic differentiation rate and hypertrophy. All BMPs were found to enhance chondrogenesis, but there were differences in their potency to induce deposition of type II collagen and proteoglycans.

Materials and methods Experimental animals Bone marrow stromal cells and embryonic tissue samples were obtained from C57/bl × DBA hybrid mice which have been maintained for over 15 years as a control strain for transgenic Del1 mice at the Animal core facility of University of Turku, Finland [29,30]. The study protocol was approved by the institutional committee for animal welfare.

RNA analysis in developing mouse limbs Epiphyseal cartilage samples from developing hind limbs were collected by microdissection at embryonic days E12.5, E13.5, E14.5, E15.5, E16.5, E18.5, and E20.5 pc, where E20.5 equals to newborn. Samples were stored in RNA-later solution (Ambion, USA) at −70 °C, and ground into fine powder prior to RNA extraction in 4 M guanidinium isothiocyanate solution. Total RNA was isolated by sedimentation through 5.7 M cesium chloride density gradient by ultracentrifugation [31]. Samples were pooled from a minimum of 3 animals to reduce the sampling variation between animals and to obtain enough tissue for RNA isolation. Mouse Genome 430 2.0 Array (Affymetrix, Santa Clara, CA, USA) was performed according to manufacturers instructions (www.affymetrix.com). Data was preprocessed and normalised with Affymetrix GCOS software (www. affymetrix.com). Inforsense KDE software (www.inforsense. com) was used to obtain the expression profiles of all BMPs.

Immunohistochemistry of mouse limb tissue sections Dissected mouse limbs were fixed in freshly made 4% paraformaldehyde, dehydrated, embedded in paraffin, and sectioned sagittally into 5 μm sections. The sections were either stained with hematoxylin and eosin, or processed for immunohistochemistry. Epitopes were exposed by heating in 10 mM Tri-Na-citrate (pH 6.0) at 95 °C, and endogenous peroxidase activity was blocked by incubating the slides in 1% H2O2 for 10 min, as recommended by the antibody supplier (Santa Cruz Biotechnology, USA). Blocking was performed with 2% rabbit normal serum and 2% bovine serum albumin (Sigma-

2402

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 4 ( 2 00 8 ) 2 4 0 0 –24 1 0

Aldrich Corp., USA) in PBS for 20 min at room temperature (RT). Distribution of BMPs was studied by immunohistochemistry with goat polyclonal antibodies against BMP-2, -5, -6, and -7 (Santa Cruz Biotechnology, USA) and BMP2/4 (R&D Systems, UK). Antigoat IgG and ABC detection reagents (Vector Laboratories, USA) and diaminobenzidine (DAB) chromogen (Zymed, USA) were used for visualization.

Isolation and expansion of mouse mesenchymal stromal cells All sets of experiments were started by harvesting bone marrow stromal cells from long bones of 8–10 weeks old male mice. Altogether 89 mice were used for collection of the stromal cells. Bone ends of femori, tibiae and humeri were removed and bone marrow cells were flushed using a 10 ml syringe, 25-ga needle and isolation medium (RPMI-1640, Gibco Invitrogen, USA; 12% fetal calf serum (FCS), Gibco Invitrogen, USA; and 100 U/ml penicillin and 100 μg/ml streptomycin). Cells from 4–9 individual mice at each preparation time were pooled and incubated on plastic for 2 h at +37 °C to remove rapidly adhering fibroblastlike cells from the pool [32,33]. Remaining cells were plated into a new cell culture flask at a density of 1 × 106 cells/cm2. After 48 h, nonadherent cells were discarded, and adherent cells were washed with phosphate-buffered saline (PBS). To obtain shortterm selected (STS) cells for differentiation studies, plastic adherent cells were cultured in DMEM medium for 1 week with medium changes after 4 days and lifted by incubation in 0.25% trypsin/1 mM EDTA for 5 min at 37 °C. Otherwise, adherent cells were cultured in isolation medium for 4 weeks with a medium change after every 3 to 4 days, lifted with trypsin, and replated at a density of 10 000 cells/cm2 in isolation medium. After 1– 2 weeks the cells were lifted by trypsinization, plated at density of 1000 cells/cm2, and cultured in expansion medium (DMEM, Gibco Invitrogen, USA, 12% FCS, 100 U/ml penicillin and 100 μg/ ml streptomycin) until confluent (1–2 weeks) for two more passages to obtain long-term selected (LTS) cells. STS and LTS cells were subjected for surface epitope characterization or differentiation studies.

Surface epitope characterization of MSCs STS and LTS cells were cultured on chamber slides at a density of 10 000 cells/cm2 (Lab-tek® Chamberslides™, Elec-

tron Microscope Sciences, USA) until confluent. Immunostainings for surface epitopes were performed using antibodies for Ly-6A/E stem cell antigen-1 (Sca-1) (BD Biosciences, USA), CD45 (Dako, Denmark) and CD34 (Vision Biosystems, USA). Primary antibodies were diluted in ChemMate antibody diluent (Dako, Denmark). After incubation in Post-Blocking (DPVO+500Post, Immunovision Technologies Co., Netherlands) and subsequently in poly-HRP anti-Mouse/Rabbit IgG polymer (DPVO+500HRP, Immunovision Technologies Co., Netherlands), the secondary antibodies were visualized with DAB chromogen (Zymed, USA) and nuclei were counterstained with hematoxylin.

Osteoblastic and adipogenic differentiation In order to characterize the osteogenic differentiation capacity, a method described before was slightly modified [34]. LTS cells were cultured in αMEM (Gibco Invitrogen, USA) supplemented with 12% FCS, 10 mM Na-β-glycerophosphate (Fluka BioChemika, Switzerland), 50 μg/ml of L-ascorbic acid 2-phosphate (Sigma-Aldrich Corp., USA), 100 U/ml of penicillin and 100 μg/ml of streptomycin for 3 to 6 weeks in T25 flasks and 24-well plates at a density of 10 000 cells/cm2. During the first week, the culture media was supplemented with 10 nM dexamethasone (Sigma-Aldrich Corp., USA). The cultures were terminated by fixation in 3% paraformaldehyde, 2% sucrose or subjected to RNA isolation as described below. To demonstrate osteogenic differentiation, fixed cells were stained for alkaline phosphatase (ALP) using a commercial kit (86-R, Sigma-Aldrich Corp., USA). Bone nodules were detected by von Kossa staining. Total RNA was isolated using mirVana RNA isolation kit (Ambion, USA) and RT-PCR was used to demonstrate expression of type I collagen (Col1a1), osterix (Osx/Sp7), runt-related transcription factor 2 (Runx2) and glyceraldehyde 3-phosphate dehydrogenase (Gapdh) genes (Table 1). One microgram of DNase I treated total RNA was reverse transcribed using M-MLV reverse transcriptase (Promega Corporation, UK). cDNA was amplified using DyNAzyme II DNA Polymerase (Finnzymes, Finland). For adipogenesis, LTS cells were incubated in DMEM supplemented with 12% FCS, 100 U/mL penicillin, 100 µg/mL streptomycin, 5 µg/mL insulin (Sigma-Aldrich Corp., USA), 50 µM indomethacin (Sigma-Aldrich Corp., USA), 1 µM

Table 1 – RT-PCR analysis of gene expression Gene

Agc1 Col1a1 Col2a1 Col10a1 Gapdh Osx/Sp7 Runx2 Sox9

Primer sequence (5' → 3') Left primer

Right primer

CCCGGTACCCTACAGAGACA GAAGTCAGCTGCATACAC AGAGACCTGAACTGGGCAGA CCTGCAGCAAAGGAAAACTC AGGTGAAGGTCGGAGTCAACG ACTCATCCCTATGGCTCGTG CCGCACGACAACCGCACCAT CGACTACGCTGACCATCAGA

ACAGTGACCCTGGAACTTGG AGGAAGTCCAGGCTGTCC GCACCATTGTGTAGGACACG TGGCTTAGGAGTGGGAGCTA GCTCCTGGAAGATGGTGATGG GGTAGGGAGCTGGGTTAAGG CGCTCCGGCCCACAATCTC AGACTGGTTGTTCCCAGTGC

Amplicon size (base pairs)

NCBI Gene bank accession a number

203 312 201 179 232 238 289 188

NM_007424 NM_007742.3 NM_031163 NM_009925 NM_008084 NM_001032298.2 NM_009820.2 NM_011448

Initial denaturation for the cDNA samples was performed at 95 °C for 1 min and amplification was carried out by denaturing at 95 °C for 30 s, annealing at 60 °C for 30 s and extending at 72 °C for 30 s for 30 cycles, and finally extending at 72 °C for 7 min. a NCBI Genbank sequence used for primer design.

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 4 ( 2 00 8 ) 2 4 0 0 –24 1 0

dexamethasone. (Sigma-Aldrich Corp., USA). After 3 weeks, the cells were fixed in 3% paraformaldehyde for 20 min at RT and stained with 0.5% Oil Red O (Sigma-Aldrich Corp., USA) in methanol for 5 min at RT.

Chondrogenic differentiation For pellet cultures, 200 000 cells were placed in a 15-ml polypropylene tube (Falcon™ BD Biosciences, USA) and centrifuged into a pellet at 500 ×g for 6 min. Control pellets were cultured at 37 °C in 5% CO2 in 0.5 ml of chondrogenic medium: high-glucose DMEM (Gibco Invitrogen, USA) supplemented with 10 ng/ml of TGF-β3 (R&D Systems, UK), 100 nM dexamethasone, 50 μg/ml of L-ascorbate-2-phosphate, 40 μg /ml of L-proline (Sigma-Aldrich Corp., USA), 100 μg/ml of sodium pyruvate (Sigma-Aldrich Corp., USA), 50 mg/ml of

2403

ITS + Premix (BD Biosciences, USA). STS and LTS cells were induced in chondrogenic medium or supplemented with rhBMP-2, rhBMP-6 or rhBMP-7. Pellets were cultured for 10, 15, 20, 30 or 45 days and fixed as described below. To compare the effect of rhBMP-2, rhBMP-4, rhBMP-5, rhBMP-6, rhBMP-7 or rhBMP-2/BMP-7-heterodimer in LTS cells, chondrogenic medium was supplemented with 500 ng/ ml of each BMP (R&D Systems, UK). Pellets were cultured for 20 days and the medium was replaced every 3–4 days.

Histological and immunohistochemical analysis of the pellets Pellets were fixed in 4% paraformaldehyde for 2.5 h, dehydrated, embedded in paraffin and cut into 5 μm sections. Toluidine blue staining was used for demonstration of sulphated proteoglycans.

Fig. 1 – Expression of bone morphogenetic proteins BMP-2, BMP-4, BMP-5, BMP-6, and BMP-7 mRNAs and proteins in developing mouse limb knee epiphyseal cartilage. Total RNA was isolated from knee epiphyseal cartilage from E12.5 to E20.5 pc (newborn), and subjected for micro array analysis. Messenger RNA expression profiles of Bmps were subtracted from Mouse Genome 430 2.0 Array data (A). Immunostainings of the tissue sections indicate the distribution of the BMPs in distal femoral epiphyses of E16.5 embryos (B). Regions presented at a higher magnification on the right are indicated by roman numerals in the left panel; I, periarticular proliferating chondrocytes; II, columnar proliferating chondrocytes; III, prehypertrophic/ hypertrophic chondrocytes. Bar equals to 200 μm in left panel and 50 μm in right panels of B.

2404

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 4 ( 2 00 8 ) 2 4 0 0 –24 1 0

Type IIA and type II collagen deposition was detected by immunohistochemistry. Rehydrated sections were digested with bovine testicular hyaluronidase (2000 U/ml) in PBS (pH 5.5) for 60 min at +37 °C to facilitate antibody access. Nonspecific antibody binding was blocked by 3% BSA (Sigma-Aldrich Corp., USA)/PBS. Sections were incubated with a monoclonal antibody against chicken type II collagen (6B3 Chemicon Millipore, USA) [35], overnight at +4 °C. Binding of primary antibody was detected by Mouse Link and AP Label (BioGenex, USA) and Fast Red (Sigma-Aldrich Corp., USA) staining was used for the color development [36]. Type IIA collagen was detected by affinity purified rabbit polyclonal antibody raised against mouse recombinant type IIA collagen propeptide [37]. A histostain broad spectrum kit with DAB chromogen was used for detection of the primary antibody (Zymed, USA). Tissue sections were counterstained with hematoxylin. In control sections, the primary antibody was replaced with normal rabbit serum. Progression of chondrogenic differentiation was evaluated in LTS cell pellets histomorphometrically by determining the relative area of type II collagen matrix. Tissue sections at 120 μm intervals from each pellet were analyzed for the global threshold values using LabView 7.1 program (National Instruments, Austin, Texas). Relative area of type II collagen matrix was counted by comparing the number of pixels exceeding global threshold value to the total amount of pixels in the pellet. Mean values were counted from nine pellets per group from three experiments.

RT-PCR analysis of cartilage gene expression Ten pellets after 20-day culture period were washed in PBS and combined for total RNA isolation by mirVana RNA isolation kit (Ambion, USA). Genomic DNA was digested with DNase I (NEB, USA). First strand cDNA was synthesized from 0.5 µg total RNA using M-MLV reverse transcriptase, point H- mutant (Promega Corporation, UK). Expression of Agc1, Col2a1, Col10a1, Sox9 and Gapdh genes was studied by RT-PCR (Table 1). cDNAs were amplified using DyNAzyme II DNA Polymerase (Finnzymes, Finland).

Statistical analysis Statistical testing was performed by ANOVA. Pair wise comparisons were then performed by two-sample independent t-Test.

Results Gene expression profiles in developing epiphyseal cartilage Gene expression profiles of Bmps during in vivo chondrogenesis were extracted from our unpublished Affymetrix micro array data covering the period of embryonic limb development. Bmps had distinct temporal distribution patterns in vivo

Fig. 2 – Characterization of mesenchymal stromal cells. Mesenchymal stromal cells derived from mouse bone marrow were characterized after isolation and adhesion on plastic for 48 h, and after 0 (STS) and 3 (LTS) passages by immunocytochemistry for their expression of hematopoietic cell marker proteins CD34, CD45 and stem cell antigen-1 (Sca-1). Secondary antibodies were detected by DAB and nuclei by hematoxylin staining. Bar equals to 50 μm.

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 4 ( 2 00 8 ) 2 4 0 0 –24 1 0

in the developing limb cartilage (Fig. 1A). Bmp-2 and Bmp-6 expressions increased between E12.5 and E20.5. Bmp-4 expression was high at E12.5 and E13.5 and thereafter decreased to a half level where it remained until E18.5, whereafter it increased two-fold again after birth at E20.5. Bmp-5 expression increased to a two-fold level from E12.5 to E14.5 and remained at high level until birth. Bmp-7 mRNA was expressed at a relatively low and stable level throughout embryonic days E12.5–E20.5 in epiphyseal cartilage.

Tissue distribution of BMP-proteins in epiphyseal cartilage during limb development BMP protein distribution was studied in E16.5 day-old hind limbs (Fig. 1B). BMP-7 expression was restricted to hypertrophic cartilage. All other BMPs were more widely expressed throughout the different zones of epiphyseal cartilage, although the highest expression was observed in the prehypertrophic-hypertrophic zones.

Cell morphology and surface antigens in plastic adherent primary stromal, short-term selected and long-term selected cells Plastic adherent cells, directly after 48 h adhesion, or from STS and LTS, were plated in chamber slides and their surface antigens were analyzed immunohistochemically (Fig. 2). Majority of the primary adherent cells were small, spindleshaped and positive for CD34 and CD45 surface antigens. Only a few cells were Sca-1 positive either with flat fibroblast-like or spindle-shaped morphology. In STS population all cells were negative for CD34 or CD45 and the proportion of Sca-1expressing flat cells with large nuclei had increased. In LTS population, majority of the LTS cells were large and flat. All cells were negative for the expression of CD34 and CD45 and they uniformly expressed Sca-1.

Osteogenic and adipogenic differentiation LTS cells were induced to differentiate into osteoblasts and adipocytes. They readily differentiated along the osteogenic

2405

lineage as indicated by alkaline phosphatase activity and von Kossa staining for bone nodule formation (Fig. 3A), and by expression of osteogenic marker genes Col1a1, Osx/Sp7, and Runx2 (Fig. 3B). Cells were also able to differentiate along the adipogenic lineage as evidenced by Oil Red O staining of the lipids (Fig. 3C).

Chondrogenic differentiation of short-term selected cells in pellets STS cells differentiated within 2 weeks into proteoglycanproducing chondrocyte-like cells in control and especially in BMP-supplemented chondrogenic medium. Pellets were surrounded by a tight, almost cell-free connective tissue capsule rich in type IIA collagen (Fig. 4A). Chondrogenic differentiation progressed to hypertrophy and matrix mineralization in rhBMP-2 and -7 induced pellets, and after 4 weeks of culture, the central regions of the pellets stained positive for type X collagen (data not shown). During tissue sectioning, BMP-2 and BMP-7 induced pellets were found to be brittle, and von Kossa staining demonstrated the presence of calcium deposits (Fig. 4B). Chondrogenesis and terminal differentiation were slower in control and rhBMP-6 induced pellets. Calcium deposits were observed by 5–6 weeks (data not shown), indicating that terminal differentiation with mineralization eventually took place also in these pellets.

Chondrogenic differentiation of long-term selected cells in pellets LTS cells were subjected to chondrogenic differentiation in pellet cultures. Supplementation with rhBMP-2 increased the pellet diameter by 40%, rhBMP-4 by 36%, rhBMP-5 by 26%, rhBMP-6 by 47%, rhBMP-7 by 24% and rhBMP-2/7 heterodimer by 39% (p b 0.001) in comparison to controls (Table 2). There was some variation in the extent of chondrogenic differentiation between different experiments, and in one experiment chondrogenesis had progressed throughout the pellet. The data presented in Fig. 5 represents the minimum degree of chondrogenesis observed in the separate experiments. Majority of the cells in control pellets were small and

Fig. 3 – Multipontency of mesenchymal stromal cells. Osteogenic and adipogenic differentiation was induced in monolayer culture of LTS cells for 3 weeks. Osteogenic differentiation was demonstrated by histochemical staining for alkaline phosphatase and von Kossa staining for bone nodule formation (A), and by RT-PCR analysis for the expression of osteoblast specific genes (B). Adipogenic differentiation was demonstrated with Oil Red O staining of the lipids (C).

2406

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 4 ( 2 00 8 ) 2 4 0 0 –24 1 0

Fig. 4 – Progression of chondrogenesis into terminal differentiation and osteogenesis in STS cells. Mesenchymal stromal cells were subjected to chondrogenic differentiation for 2 weeks (A) or 4 weeks (B) in pellet cultures after 7 days of monolayer culture. Control pellets were cultured in medium containing TGF-β3. This medium was supplemented with rhBMP-2, rhBMP-6 or rhBMP-7 (500 ng/ml) for comparison of their chondrogenic potency. Deposition of proteoglycans was demonstrated by histochemistry with toluidine blue, and type IIA procollagen by immunohistochemistry with DAB (diaminobenzidine) chromogen detection. Osteogenic differentiation and endochondral ossification was demonstrated by von Kossa staining for calsium deposits in 4-week cultures. Bar in panel A equals to 100 μm.

round. No metachromasia was observed in toluidine blue stained sections indicating absence of proteoglycans, and only a few cells had deposited type II collagen. In all BMP-induced

pellets, superficial cells were enlarged and deposited type II collagen and sulphated proteoglycans, although the cells in the center were small and round like in the control pellets,

Table 2 – Pellet size and the relative volume of type II collagen matrix in LTS differentiated pellets Pellet size

TGF-β3 + BMP-2 + BMP-4 + BMP-5 + BMP-6 + BMP-7 + BMP-2/7

Type II collagen matrix a

Diameter (μm)

Increase(%)

BMP-5

641 ± 26 897 ± 89 872 ± 46 805 ± 85 943 ± 53 793 ± 19 894 ± 80

40⁎⁎⁎ 36⁎⁎⁎ 26⁎⁎⁎ 47⁎⁎⁎ 24⁎⁎⁎ 39⁎⁎⁎

⁎ ⁎

⁎⁎ ⁎⁎

⁎⁎

⁎⁎⁎

⁎⁎

⁎⁎

BMP-7

a

Relative volume (%)

Fold change

BMP-5 a

BMP-7 a

1.3 ± 1.1 21.9 ± 8.1 21,9 ± 4,6 6.3 ± 1.2 20.2 ± 1.8 6.4 ± 1.5 22.8 ± 6.6

17⁎⁎⁎ 17⁎⁎⁎ 5⁎⁎⁎ 16⁎⁎⁎ 5⁎⁎⁎ 18⁎⁎⁎

⁎⁎⁎ ⁎⁎⁎

⁎⁎⁎ ⁎⁎⁎

⁎⁎⁎

⁎⁎⁎

⁎⁎⁎

⁎⁎⁎

Average of pellet diameter was measured from total of 9 pellets from 3 experiments. Relative volume of type II collagen matrix was analyzed by histomorphometry by measuring the antibody stained area. Both parameters were measured from sections at 120 μm intervals throughout the pellet. The values are mean ± SD of 27 sections representing total of 9 pellets from 3 separate experiments. Statistical significance between TGF-β3 control and BMP treated pellets was tested by two-sample independent t-test; ⁎⁎⁎, pb 0.001. ⁎ pb 0.05, ⁎⁎ pb 0.01. a Significant difference between BMP-2, -4, -6 or 2/7 and BMP-5 or BMP-7.

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 4 ( 2 00 8 ) 2 4 0 0 –24 1 0

2407

Fig. 5 – Deposition of proteoglycans and type II collagen in LTS cells differentiated in chondrogenic medium. Control pellets were cultured for three weeks in medium containing TGF-β3. This medium was supplemented with rhBMP-2, rhBMP-4, rhBMP-5, rhBMP-6, rhBMP-7 or rhBMP2/BMP7 heterodimer for comparison of their chondrogenic potency. Toluidine blue staining was used to demonstrate proteoglycan deposition (A). Type II collagen deposition was demonstrated by immunohistochemistry with AP-conjugated biotin streptavidin complex secondary antibody and detected by Fast Red substrate (B). Bar equals to 100 μm.

with no cartilage matrix deposition. No type X collagen staining was observed (data not shown). The relative area of type II collagen stained matrix was analyzed histomorphometrically at 120 μm intervals throughout the pellets (Table 2). Compared to control pellets in three repeated experiments, there was approximately a 17–19 fold increase in type II collagen matrix area by induction of rhBMP-2, rhBMP-4, rhBMP-6, or rhBMP-2/

BMP-7 heterodimer, and a 5–6 fold increase by rhBMP-5 and rhBMP-7.

Expression of cartilage genes during chondrogenic differentiation of long-term selected cells Sox9, Col2a1 and Col10a1 genes were expressed in all samples after 20 days of culture (Fig. 6). Agc1 was not expressed in control pellets. It was only weakly expressed in rhBMP-7 induced pellets, and roughly equally expressed in other BMPinduced pellets.

Discussion

Fig. 6 – Expression of chondrocyte marker genes in LTS cells after 3 weeks of chondrogenic induction. Control pellets were cultured in medium containing TGF-β3. This medium was supplemented by rhBMP-2, rhBMP-4, rhBMP-5, rhBMP-6, rhBMP-7 or rhBMP2/BMP7 heterodimer for comparison of their chondrogenic potency. RT-PCR was used to demonstrate expression of Sox9, Agc1, Col2a1, and Col10a1 genes, and Gapdh was amplified as a reference gene.

Chondrogenic differentiation in MSCs has been actively studied due to their potential in mesenchymal tissue repair. One of the major problems has been to obtain MSC populations free of hematopoietic stem cells. Cell sorting by various surface markers using fluorescent-activated cell sorting (FACS) [6,9,38] and magnetic-activated cell sorting (MACS) [39], or extended passaging [40,41] have been used for selection of MSC populations. Our goal in this study was to develop a simple isolation protocol where the hematopoietic cells can be simultaneously cleared off and the selected cells expanded to obtain enough starting material for differentiation studies. The other goal was to optimize the differentiation conditions for studying the chondrogenic potential of various factors. Since BMPs have been

2408

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 4 ( 2 00 8 ) 2 4 0 0 –24 1 0

shown to be important regulators of in vivo chondrogenesis [42,43], we compared the potential of several BMPs to induce chondrogenesis in vitro. Comparison studies were performed in short-term and long-term selected MSCs, and differences were observed in their relative potencies to induce in vitro chondrogenesis and terminal differentiation. Culturing of bone marrow derived adherent cells in RPMI medium cleared off the CD34 and CD45 positive cells within the first week, but the remaining cells were highly heterogeneous with a mixed population of large and flat Sca-1 positive cells, and smaller spindle-shaped Sca-1 negative cells. Others have reported the presence of hematopoietic cells for several weeks, where the clearance from hematopoietic cells probably took place due to the progressive loss of progenitors during passaging [9,40]. Uniformly Sca-1 expressing large and flat cells became predominant during passaging in RPMI, followed by expansion in DMEM. Although the role of Sca-1 has remained unclear, it has been used for selection of hematopoietic, mesenchymal or endothelial precursor/stem cells associated with the corresponding tissues [44]. It remains to be shown whether Sca-1 positive cells truly are precursor/stem cells, but they may, however, represent a more primitive stage than Sca-1 negative stromal cells. Starting density of MSC cultures appears to be one of the most important factors when establishing long-term cultures. Initial plating at 2 × 106 cells/cm2 in HEPES-buffered DMEM and 10% FCS, followed by gradually increasing split ratios after each passage best supported the long-term growth of MSCs [8]. We used successfully the initial plating density of 1 × 106 cells/cm2 in RPMI isolation medium, followed by subsequent platings at low density, 1000 cells/cm2 in DMEM expansion medium, where the Sca-1 positive cells have retained their osteogenic and adipogenic differentiation potential for over 50 passages. On the contrary, mouse MSCs cultivated in αMEM grow poorly and loose their differentiation capacity only after a few passages (our unpublished observations, and [8]). In an earlier study, where cells were first cultivated in the presence of allogenic bone pieces, then supplemented by 10% of this allogenic bone marrow conditioned medium, and subsequently by basic FGF, expansion in αMEM resulted within eighth passages into a selection of mesenchymal progenitor cell population, where about 90% of the cells were positive for Sca-1, CD29, CD44, c-kit, CD105, and negative for CD31, CD34 or CD45 [41]. Like our Sca-1 positive LTS cell population, these cells were shown to differentiate along chondrogenic, adipogenic and osteogenic lineages, but the researchers did not report for how long this capacity was retained. Chondrogenic differentiation profiles were compared between cells induced after short-term and long-term selection. Interestingly, when differentiation was induced in STS cells, the chondrogenic differentiation progressed faster than in LTS cells, and advanced to terminal differentiation with deposition of type X collagen and matrix mineralization. Col10a1 mRNA was also expressed in all LTS differentiated pellet cultures although there was neither deposition of type X collagen nor changes in morphology resembling hypertrophy. More detailed analysis is needed to characterize the nature of STS and LTS cells, but it is possible that part of the STS cells were chondro/osteoprogenitors favouring terminal differentiation and osteogenesis, while uniformly Sca-1 expressing LTS cells represented a more primitive cell population where progenitors have been cleared off.

CD45 positive cells were demonstrated to enhance unfavourable terminal differentiation in MSCs derived from rat bone marrow [39]. Our STS cells were devoid of CD45 positive cells, thus suggesting that the short-term selected cells contain other stromal cells that support terminal differentiation. As chondrocyte hypertrophy is an unwanted phenomenon in cartilage tissue repair, we compared the chondrogenic potential of several BMPs in long-term selected LTS cells. Best enhancers of chondrogenesis were rhBMP-2, rhBMP-4, rhBMP6 and rhBMP-2/BMP-7 heterodimer. The diameter of the pellets induced by these BMPs increased by 36 to 47%. Type II collagen and proteoglycans were expressed both at the transcriptional and translational level, and the volume of type II collagen containing matrix increased by 20–31%. To our knowledge, this is the first study to demonstrate the effect of rhBMP-2/BMP-7 heterodimer on chondrogenic differentiation in vitro. BMP-2 and BMP-7 proteins have been shown to colocalize during mouse embryonic development [45] and to form heterodimers in vivo and in vitro [27,46]. These heterodimers have been shown to be more potent than corresponding homodimers in inducing ALP activity in vitro [27] and osteoblastic differentiation in mesenchymal precursor cells [47,48]. The weaker Noggin antagonism of BMP heterodimers compared to homodimers has been suggested to contribute to the increased osteogenic potency of heterodimers in vitro and in vivo [28]. We found rhBMP-2/BMP-7 heterodimer to be efficient in promoting chondrogenic differentiation of MSCs but it did not significantly exceed that of rhBMP-2 alone. Less advanced chondrogenic differentiation was observed in rhBMP-5 and rhBPM-7 induced LTS pellets. Pellet size increased by 24–26% and the volume of type II collagen matrix was only 6% higher than in the control. In rhBMP-7 induced pellets, also Agc1 transcription was low. BMP-5 has been earlier reported to enhance cell proliferation rather than chondrogenic differentiation [49]. In the present study, protein distribution studies by immunohistochemistry indicated a strong expression throughout the different zones of epiphyseal cartilage. Messenger RNA expression was high throughout the limb development, but it decreased just before birth, which is atypical to the genes supporting development of the chondrogenic phenotype, suggesting that BMP-5 has also other roles than to primarily induce chondrogenic differentiation. Relative potencies of BMP-2, BMP-6 and BMP-7 to induce chondrogenesis were different in STS cells in comparison to LTS cells. BMP-2 induced STS and LTS cells equally well. BMP-7 induced chondrogenesis and terminal differentiation in STS cells at a similar rate to BMP-2, but it induced only poorly LTS cells. BMP-6 induced terminal differentiation in STS cells at a slower rate than BMP-2 and BMP-7, while it induced chondrogenesis in LTS cells similarly to BMP-2. Supposed that LTS cells are more primitive than STS cells, these data suggests that BMP-6 is a better inducer of primitive stromal cells while BMP-7 induces partially differentiated progenitor cells present in STS, and BMP-2 induces equally well both populations. BMP-7 was expressed only in the prehypertrophic and hypertrophic zones while BMP-6 and BMP-2 were more widely distributed throughout the epiphysis representing different stages of chondrocyte maturation. Expression profiles during limb chondrogenesis indicated up-regulation of BMP-2 and BMP-6 mRNAs during late embryonic development, when expression of several

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 4 ( 2 00 8 ) 2 4 0 0 –24 1 0

cartilage matrix genes was also strongly up-regulated. On the contrary, BMP-7 was expressed relatively stably throughout the limb development. Data derived both from the in vivo and in vitro experiments suggest that BMP-2 and BMP-6 expression in vivo is more related to support chondrocyte maturation while that of BMP-7 into terminal differentiation and endochondral ossification. Yet, this conclusion may be oversimplified, as BMP-7 has been used in cartilage repair studies with beneficial effects to promote cartilage homeostasis [50]. Among the existing literature, where the effects of at least two of BMP-2, BMP-4, BMP-6 or BMP-7 have been compared, somewhat contradictory results have been reported, at least partially resulting from different cell sources and culture conditions. In goat adipose tissue, BMP-2 effectively induced osteogenesis, while BMP-7 promoted chondrogenesis [51]. In human bone marrow derived MSCs, BMP-2 was the most efficient inducer of chondogenesis over BMP-4 and BMP-6 [22]. In synovial explants, BMP-7 was more potent inducer of chondrogenesis than BMP-2 [52]. These contradictory results may arise from the real differences between stem cells and progenitors derived from various tissues and species, but also may result from differences in the stromal cell populations that have been used for these studies. As this study shows, the composition of the MSC population has crucial effects on the chondrogenic differentiation profile.

Conclusions Passaging under conditions that inhibit growth of hematopoietic cells rapidly removed hematopoietic surface epitopes -expressing cells and enriched more primitive Sca-1 expressing cells. These cell populations had distinct chondrogenic differentiation profiles, suggesting that heterogenous adherent stromal cells favour rapid chondrogenesis with terminal differentiation while chondrogenesis in more primitive cells progressed at a slower rate with no hypertrophy. BMPs enhanced chondrogenic differentiation with different impacts into heterogenous stromal cell population and in a more primitive (stem) cell population. BMP-2, -4 and -6 and BMP-2/ BMP-7 heterodimer were effective enhancers of chondrogenesis over that of BMP-5 and -7. Our data indicate the impact of the composition of stromal cell population on the chondrogenic differentiation profile, an important aspect to be considered when standardizing differentiation assays and developing MSC based cartilage repair technologies.

Acknowledgments We thank Tuula Oivanen, Merja Lakkisto and Marja Nykänen for their excellent technical assistance, Asta Laine for the bioinformatics analysis of the microarray data, and Niko Moritz for his kind help in the histomorphometric analysis. Hanna Taipaleenmäki is a graduate student of Turku Graduate School of Biomedical Sciences, University of Turku, Finland. Salla Suomi is a graduate student of Drug Development Graduate School, University of Turku, Finland. This work was supported by the grants from the Research Council for Health of the Academy of Finland (projects 203446 and 205581), the Varsi-

2409

nais-Suomi Regional Fund of Finnish Cultural Foundation, The Schering Foudation and Turku University Foundation.

REFERENCES

[1] M.F. Pittenger, A.M. Mackay, S.C. Beck, Multilineage potential of human mesenchymal stem cells, Science 284 (1999) 143–147. [2] E.M. Horwitz, K. Le Blanc, M. Dominici, I. Mueller, I. Slaper-Cortenbach, F.C. Marini, R.J. Deans, D.S. Krause, A. Keating, Clarification of the nomenclature for MSC: The International Society for Cellular Therapy position statement, Cytotherapy 7 (2005) 393–395. [3] M. Dominici, K. Le Blanc, I. Mueller, I. Slaper-Cortenbach, F. Marini, D. Krause, R. Deans, A. Keating, D.J. Prockop, E. Horwitz, Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement, Cytotherapy 8 (2006) 315–317. [4] A. Peister, J.A. Mellad, B.L. Larson, B.M. Hall, L.F. Gibson, D.J. Prockop, , Adult stem cells from bone marrow (MSCs) isolated from different strains of inbred mice vary in surface epitopes, rates of proliferation, and differentiation potential, Blood 103 (2004) 1662–1668. [5] D.G. Phinney, G. Kopen, R.L. Isaacson, D.J. Prockop, Plastic adherent stromal cells from bone marrow of commonly used strains of inbred mice: variations in yeld, growth, and differentiation, J. Cell Biochem. 72 (1999) 570–585. [6] M. Baddoo, K. Hill, R. Wilkinson, D. Gaupp, C. Hughes, G.C. Kopen, D.G. Phinney, Characterization of mesenchymal stem cells isolated from murine bone marrow by negative selection, J. Cell Biochem. 89 (2003) 1235–1249. [7] H. Hachisuka, Y. Mochizuki, Y. Yasunaga, K. Natsu, P. Sharman, R. Shinomiya, M. Ochi, Flow cytometric discrimination of mesenchymal progenitor cells from bone marrow-adherent cell populations using CD34/44/45(−) and Sca-1(+) markers, J. Orthop. Sci. 12 (2007) 161–169. [8] S. Meirelles Lda, N.B. Nardi, Murine marrow-derived mesenchymal stem cell: isolation, in vitro expansion, and characterization, Br. J. Haematol. 123 (2003) 702–711. [9] P. Tropel, D. Noël, N. Platet, P. Legrand, A.L. Lenabid, F. Berger, Isolation and characterisation of mesenchymal stem cells from adult mouse bone marrow, Exp. Cell Res. 295 (2004) 395–406. [10] F. Barry, R.E. Boynton, B. Liu, J.M. Murphy, Chondrogenic differentiation of mesenchymal stem cells from bone marrow: differentiation-dependent gene expression of matrix components, Exp. Cell Res. 268 (2001) 189–200. [11] B. Johnstone, T.M. Hering, A.I. Caplan, V.M. Goldberg, J.U. Yoo, In vitro chondrogenesis of bone marrow-derived mesenchymal progenitor cells, Exp. Cell Res. 238 (1998) 265–272. [12] A.H. Reddi, Role of morphogenetic proteins in skeletal tissue engineering and regeneration, Nat. Biotechnol. 16 (1998) 247–252. [13] I. Sekiya, D.C. Colter, D.J. Prockop, BMP-6 enhances chondrogenesis in a subpopulation of human marrow stromal cells, Biochem. Biophys. Res. Commun. 284 (2001) 411–418. [14] M.R. Urist, Bone: formation by autoinduction, Science 150 (1965) 893–899. [15] S. Pizette, L. Niswander, BMPs are required at two steps of limb chondrogenesis: formation of prechondrogenic condensations and their differentiation into chondrocytes, Dev. Biol. 219 (2000) 237–249. [16] J.M. Wozney, V. Rosen, A.J. Celeste, L.M. Mitsock, M.J. Whitters, R.W. Kriz, R.M. Hewick, E.A. Wang, Novel regulators of bone formation: molecular clones and activities, Science 242 (1988) 1528–1534. [17] B.T. Estes, A.W. Wu, F. Guilak, Potent induction of chondrocytic differentiation of human adipose-derived adult

2410

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26] [27]

[28]

[29]

[30]

[31]

[32]

[33] [34]

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 4 ( 2 00 8 ) 2 4 0 0 –24 1 0

stem cells by bone morphogenetic protein 6, Arthritis Rheum. 54 (2006) 1222–1232. N. Indrawattana, G. Chen, M. Tadokoro, L.H. Shann, H. Ohgushi, T. Tateishi, J. Tanaka, A. Bunyaratvej, Growth factor combination for chondrogenic induction from human mesenchymal stem cell, Biochem. Biophys. Res. Commun. 320 (2004) 914–919. M.K. Majumdar, E. Wang, E.A. Morris, BMP-2 and BMP-9 promotes chondrogenic differentiation of human multipotential mesenchymal cells and overcomes the inhibitory effect of IL-1, J. Cell Physiol. 189 (2001) 275–284. G.D. Palmer, A. Steinert, A. Pascher, E. Gouze, J-N. Gouze, O. Betz, O.B. Johnstone, C.H. Evans, S.C. Ghivizzani, Gene-induced chondrogenesis of primary mesenchymal stem cells in vitro, Mol. Ther. 12 (2005) 219–228. J.M. Schmitt, K. Hwang, S.R. Winn, J.O. Hollinger, Bone morphogenetic proteins: an update on basic biology and clinical relevance, J. Orthop. Res. 17 (1999) 269–278. I. Sekiya, B.L. Larson, J.T. Vuoristo, R.L. Reger, D.J. Prockop, Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma, Cell Tissue Res. 320 (2005) 269–276. D. Xu, Z. Gechtman, A. Hughes, A. Collins, R. Dodds, X. Cui, L. Jolliffe, L. Higgins, A. Murphy, F. Farrell, Potential involvement of BMP receptor type IB activation in a synergistic effect of chondrogenic promotion between rhTGFbeta3 and rhGDF5 or rhBMP7 in human mesenchymal stem cells, Growth Factors 24 (2006) 268–278. T. Hennig, H. Lorenz, A. Thiel, K. Goetzke, A. Dickhut, F. Geiger, W. Richter, Reduced chondrogenic potential of adipose tissue derived stromal cells correlates with an altered TGFbeta receptor and BMP profile and is overcome by BMP-6. J. Cell Physiol. 211 (3) (2007) 682–691. H. Nochi, J.H. Sung, J. Lou, H.D. Adkisson, W.J. Maloney, K.A. Hruska, Adenovirus mediated BMP-13 gene transfer induces chondrogenic differentiation of murine mesenchymal progenitor cells, J. Bone Miner. Res. 19 (2004) 111–122. A.H. Reddi, Aging, osteoarthritis and transforming growth factor-beta signaling in cartilage, Arthritis Res. Ther. 8 (2006) 101. D.I. Israel, J. Nove, K.M. Kerns, R.J. Kaufman, V. Rosen, K.A. Cox, J.M. Wozney, Heterodimeric bone morphogenetic proteins show enhanced activity in vitro and in vivo, Growth Factors 13 (1996) 291–300. W. Zhu, J. Kim, C. Cheng, B.A. Rawlins, O. Boachie-Adjei, R.G. Crystal, C. Hidaka, Noggin regulation of bone morphogenetic protein (BMP) 2/7 heterodimer activity in vitro, Bone 39 (2006) 61–71. M. Metsaranta, S. Garofalo, G. Decker, M. Rintala, B. de Crombrugghe, E. Vuorio, Chondrodysplasia in transgenic mice harboring a 15-amino acid deletion in the triple helical domain of pro alpha 1(II) collagen chain, J. Cell Biol. 118 (1992) 203–212. A.K. Saamanen, H.J. Salminen, P.B. Dean, B. De Crombrugghe, E.I. Vuorio, M.P. Metsaranta, Osteoarthritis-like lesions in transgenic mice harboring a small deletion mutation in type II collagen gene, Osteoarthr. Cartil. 8 (2000) 248–257. J.M. Chirgwin, A.E. Przybyla, R.J. MacDonald, W.J. Rutter, Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease, Biochemistry 18 (1979) 5294–5299. A.J. Friedenstein, U. Gorskaja, N.N. Kulagina, Fibroblast precursors in normal and irradiated mouse hematopoietic organs, Exp. Hematol. 4 (1976) 267–274. D.J. Prockop, Marrow stromal cells as stem cells for non-hematopoietic tissues, Science 276 (1997) 71–74. M.P. Valta, T. Hentunen, Q. Qu, E.M. Valve, A. Harjula, J.A. Seppanen, H.K. Vaananen, P.L. Harkonen, Regulation of osteoblast differentiation: a novel function for fibroblast growth factor 8, Endocrinology 147 (2006) 2171–2182.

[35] T. Linsenmayer, M. Hendrix, Monoclonal antibodies to connective tissue macromolecules: type II collagen, Biochem. Biophys. Res. Commun. 92 (1980) 440–446. [36] A.M. Saamanen, H.J. Salminen, A.J. Rantakokko, D. Heinegard, E.I. Vuorio, Murine fibromodulin: cDNA and genomic structure, and age-related expression and distribution in the knee joint, Biochem. J. 355 (2001) 577–585. [37] H. Salminen, E. Vuorio, A.M. Saamanen, Expression of Sox9 and type IIA procollagen during attempted repair of articular cartilage damage in a transgenic mouse model of osteoarthritis, Arthritis Rheum. 44 (2001) 947–955. [38] N.B. Nardi, S. Meirelles Lda, Mesenchymal stem cells: isolation, in vitro expansion and characterization, Handb. Exp. Pharmacol. 174 (2006) 249–282. [39] N. Ahmed, B. Vogel, E. Rohde, D. Strunk, J. Grifka, M.B. Schulz, S. Grassel, CD45-positive cells of haematopoietic origin enhance chondrogenic marker gene expression in rat marrow stromal cells, Int. J. Mol. Med. 18 (2006) 233–240. [40] Y. Kitano, A. Radu, A. Shaaban, A.W. Flake, Selection, enrichment, and culture expansion of murine mesenchymal progenitor cells by retroviral transduction of cycling adherent bone marrow cells, Exp. Hematol. 28 (2000) 1460–1469. [41] S. Sun, Z. Guo, X. Xiao, B. Liu, X. Liu, P.H. Tang, N. Mao, Isolation of mouse marrow mesenchymal progenitors by a novel and reliable method, Stem Cells 21 (2003) 527–535. [42] D. Chen, M. Zhao, G.R. Mundy, Bone morphogenetic proteins, Growth Factors, 22 (2004) 233–241. [43] B.S. Yoon, D.A. Ovchinnikov, I. Yoshii, Y. Mishina, R.R. Behringer, K.M. Lyons, Bmpr1a and Bmpr1b have overlapping functions and are essential for chondrogenesis in vivo, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 5062–5067. [44] C. Holmes, W.L. Stanford, Concise review: stem cell antigen-1: expression, function, and enigma, Stem Cells 25 (2007) 1339–1347. [45] K.M. Lyons, B.L. Hogan, E.J. Robertson, Colocalization of BMP 7 and BMP 2 RNAs suggests that these factors cooperatively mediate tissue interactions during murine development, Mech. Dev. 50 (1995) 71–83. [46] T.K. Sampath, J.E. Coughlin, R.M. Whetstone, D. Banach, C. Corbett, R.J. Ridge, E. Ozkaynak, H. Oppermann, D.C. Rueger, Bovine osteogenic protein is composed of dimers of OP-1 and BMP-2A, two members of the transforming growth factor-beta superfamily, J Biol Chem. 265 (1990) 13198–13205. [47] M. Zhao, Z. Zhao, J.T. Koh, T. Jin, R.T. Franceschi, Combinatorial gene therapy for bone regeneration: cooperative interactions between adenovirus vectors expressing bone morphogenetic proteins 2, 4, and 7, J. Cell Biochem. 95 (2005) 1–16. [48] W. Zhu, B.A. Rawlins, O. Boachie-Adjei, E.J. Myers, J. Arimizu, E. Choi, Combined bone morphogenetic protein-2 and -7 gene transfer enhances osteoblastic differentiation and spine fusion in a rodent model, J. Bone Miner. Res. 19 (2004) 2021–2032. [49] G. Mailhot, M. Yang, A. Mason-Savas, C.A. Mackay, I. Leav, P.R. Odgren, BMP-5 expression increases during chondrocyte differentiation in vivo and in vitro and promotes proliferation and cartilage matrix synthesis in primary chondrocyte cultures, J. Cell Physiol. 214 (2008) 56–64. [50] S. Chubinskaya, M. Hurtig, D.C. Rueger, OP-1/BMP-7 in cartilage repair, Int. Orthop. 31 (2007) 773–781. [51] M. Knippenberg, M.N. Helder, B. Zandieh Doulabi, P.I. Wuisman, J. Klein-Nulend, Osteogenesis versus chondrogenesis by BMP-2 and BMP-7 in adipose stem cells, Biochem. Biophys. Res. Commun. 342 (3) (2006) 902–908. [52] N. Shintani, E.B. Hunziker, Chondrogenic differentiation of bovine synovium: bone morphogenetic proteins 2 and 7 and transforming growth factor beta1 induce the formation of different types of cartilaginous tissue, Arthritis Rheum. 56 (2007) 1869–1879.