- Email: [email protected]
Impact of vitrification on granulosa cell survival and gene expression
Cryobiology xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Cryobiology journal homepage: www.elsevier.com/locate/cryo
Impact of vitrification on granulosa cell survival and gene expression☆ Maria Kokotsakib, Mario Mairhoferc, Christian Schneebergera, Julian Marschaleka, Detlef Pietrowskia,∗ a b c
Medical University Vienna, Department of Obstetrics and Gynecology, Wien, Austria VivaNeo Kinderwunschklinik Dr. Loimer, Wien, Austria University of Applied Sciences Upper Austria, TIMed Center Campus Linz, Austria
A R T I C LE I N FO
A B S T R A C T
Keywords: Apoptosis Cell culture Cell cycle Cryopreservation Female infertility Gene expression Granulosa cells
Introduction: Cryopreservation of ovarian tissue is an essential step in Ovarian Tissue Banking. In order to prevent the formation of ice crystals, typically the tissue is slowly frozen using a cryoprotectant. As an alternative the method of ultra-fast freezing by vitrification becomes more attention for freezing ovarian tissue because it has successfully been used for oocytes, embryos and sperm. However the impact of vitrification on granulosa cells, which are an essential part of ovarian tissue is uncertain. Aim: In this study, we have therefore analysed the influence of vitrification on the survival rates of granulosa cells, the impact of DMSO or ethylenglycol containing vitrification protocols and investigated to what extent the gene expression of apoptosis- and temperature-sensitive genes changes. Material and methods: We used the human granulosa cell line KGN as a model for human granulosa cells and determined the survival rate and cell cycle stages by FACS analyses. The change in gene expression was determined by quantitative PCR analyses. Results: Our results show that vitrification is possible in granulosa cells but it reduces cell viability and leads to fluctuations in the cell cycle. The DMSO containing protocol results in a lower amount of dead cells than the ethylenglycol containing protocol. Gene expression analysis reveals that TNF-alpha expression is strongly increased after vitrification, while other apoptosis or temperature-related genes seem to stay unaffected. Conclusion: We conclude that vitrification influences the viability of human granulosa cells. Furthermore, our results suggest that this could be mediated by a change in TNF-alpha gene expression.
1. Introduction After cancer diagnosis and subsequent chemotherapy, young females aged 15 years and younger run the risk of completely losing their reproductive function. The most successful way to preserve fertility in these women is the cryopreservation of ovarian tissue before, and the reimplantation of this tissue after cancer therapy, and a subsequent reminiscent phase in an Ovarian Tissue banking (OTB) program [38]. Both, pregnancies and livebirths after reimplantation of frozen and thawed ovarian tissue were reported [10,37]. So far, the number of livebirths using this method exceeded 130 [11]. The majority of these births were achieved with “slow freezing”, where the tissue is stepwise cooled down to −192 °C and stored in liquid nitrogen after incubation in a cryosolution [45]. The incubation step is necessary to avoid the formation of cell-damaging ice crystals in the tissue [12]. An upcoming method to freeze cells and tissue is
vitrification, an ultra-fast freezing procedure by direct immersion of the tissue in liquid nitrogen. The freezing rate of more than 20.000 C° per second results in an ice crystal free amorphous structure of the tissue. In the field of in-vitro-fertilization, vitrification of oocytes, embryos and sperm is the “gold standard” method for cryopreservation which demonstrates its value for reproductive therapies. However, these cell types are very small compared to an ovarian tissue segment. In ovarian tissue banking the ovarian tissue is sliced into pieces of 1–5 mm thickness. As a consequence of this large size it is not clear if the freezing rates in the interior of the tissue are adequate to completely avoid ice crystal formation. To reduce ice crystal formation in ovarian tissue, cryoprotective agents are generally used in vitrification at higher concentrations than in slow freezing which, however, might be damaging to the tissue [8,42]. Ovarian tissue consist of a variety of different cells e.g. granulosa, endothelial, and stroma cells as well as follicles at different stages,
☆ ∗
M.M. was supported by the European Fund for Regional Development (EFRE, IWB2020) and the Federal State of Upper Austria. Corresponding author. Medical University Vienna, Department of Obstetrics and Gynecology, Waehringerstrasse 18-20, 1090, Wien, Austria. E-mail address: [email protected] (D. Pietrowski).
https://doi.org/10.1016/j.cryobiol.2018.09.006 Received 11 May 2018; Received in revised form 6 September 2018; Accepted 24 September 2018 0011-2240/ © 2018 Published by Elsevier Inc.
Please cite this article as: Kokotsaki, M., Cryobiology, https://doi.org/10.1016/j.cryobiol.2018.09.006
Cryobiology xxx (xxxx) xxx–xxx
M. Kokotsaki et al.
which are all necessary to build a functional ovary. Granulosa cells might be the most important for ovarian function as they represent an essential source of hormones and nourish the growing oocyte [3,25]. Aim: We aimed to study the impact of vitrification on human granulosa cells by comparing the effects of two vitrification solutions and their corresponding protocols on the human granulosa cell line KGN physiology [27,29].
2.3. Flow cytometry analysis (FACS) Cell cycle analysis was performed by propidium iodide staining in a FACScan flow cytometer according to standard procedures [9]. A minimum of 7935 events was collected and analysed. In brief, for the viability analyses, the cells were collected by centrifugation (300 × g, 4 min, room temperature) after trypsinization and washing in 2 ml PBS (2x) and re-suspended in 0,5 ml PBS. 5 μl of a 2,5 mg/ml containing propidium iodide solution (BD Bioscience, San Jose, USA) was added to each tube prior to analysis. For the cell cycle analyses cells were fixed on ice with ethanol (3 ml) and stained with 0,5 ml PI/RNase Staining Buffer (BD Biosciences, San Jose, USA) for 15 min at RT after trypsinization and washing. The samples were analysed within 1 h with BD FACScan™ flow cytometry (BD Biosciences, San Jose, USA) using CellQuest Software (BD Biosciences, San Jose, USA and Flow Cytometry Analysis Software, FLOWJO (www.flowjo.com). Experiments were repeated at least five times individually.
2. Materials and methods Except where otherwise stated, all chemicals were obtained from Sigma (Sigma Chemical Co., St Louis, USA).
2.1. Cell culture of human KGN granulosa cells The human KGN cell line was established by Nishi et al., 2001 from a stage III granulosa cell carcinoma [27]. Human KGN cells were cultured in DMEM (Dulbecco's Modified Eagle Medium), 10% FCS (Fetal calf serum) and 1% Pen/Strep (Penicillin/Streptomycin) all purchased by (Sigma, Germany) at 37 °C and 5% CO2 when they reached 75% confluency.
2.4. RNA extraction and cDNA preparation Total RNA from isolated granulosa cells was extracted using RNeasy Minikit (Quiagen, Hilden, Germany) according to the manufacturer's instructions. The RNA was quantified by determining the absorbance at 260 nm and treated with 2 U RNase-free DNase I (Thermo Fisher Scientific, Waltham, USA) at 37 °C for 30 min to remove contaminating DNA. Two μg of the total RNA was reverse transcribed into cDNA using random primer as per manufacturer's instructions (First Strand cDNA Synthesis Kit, MBI-Fermentas, Vilnius, Lithuania, Germany). Quantitative RT PCR was performed using Power SYBR Green PCR master mix according to manufacturers’ instruction on a 7500 Fast Real Time PCR System (Applied Biosystems, Foster City, USA) and individually performed 5 times for each gene. These studies were done in both vitrified and non-vitrified groups for all listed genes in Table 1. The primers are designed by a standard computer program at: http:// bibiserv.techfak.uni-bielefeld.de/genefisher. Calculated primer pairs were investigated for redundancy at the BLAST Genbank server (http:// www.ncbi.nlm.nih.gov/BLAST/). Only those primers were used for the PCR analyses which are shown to be specific for the investigated genes. Prior to the quantitative analysis, optimisation procedures were performed by running real-time PCRs with or without template to verify the reaction conditions, including the annealing temperatures of the primers and specific products.
2.2. Vitrification and thawing Vitrification of the cells was performed as follows: A vitrification solution (VS1) was prepared containing 23% DMSO (Dimethyl sulfoxide) (Cryosure, Steinbach, Germany), 10% BSA (Bovine Serum Albumin) (Thermo Fisher Scientific, Waltham, USA) and 67% DMEM (Thermo Fisher Scientific, Waltham, USA). KGN cells that were treated according to protocol 1 (P1) were equilibrated in 25% VS1 (VS1-25) in PBS for 5 min. After removing the solution by centrifugation at 300 rcf for 60 s and aspiration of the supernatant cells were incubated for 5 min in 50% VS1 (VS1-50) in PBS and after removing VS1-50, cells were incubated for 10 min in VS 1. Every step of this procedure was performed at room temperature (RT). Afterwards the cells were transferred in a cryotube and centrifuged for 60 s (300 rcf) and the supernatant was discarded. In a next step the tubes containing the cell pellet were directly plunged into liquid nitrogen and stored. For treatment of KGN-cells according to protocol 2 (P2), we used the Orgio cooling kit (Origio, Måløv, Denmark) and adapted the protocol as follows: The equilibration media (E2) and the vitrification media (VS2) were warmed to RT for 30 min. One ml of E2 was added to approximately 600.000 KGN cells and equilibrated for 15 min. E2 was removed by aspiration after centrifugation at 300 rcf for 60 s at room temperature. Afterwards 1 ml of VS2 was added to the cell pellet. After 30 s the solution was removed by aspiration after a centrifugation step (300 rcf for 60 s). Than the tubes containing the cell pellet were immediately plunged into liquid nitrogen and stored. Thawing: For cell thawing, we adapted a thawing protocol for OTB (Ovarian Tissue Banking), previously described by Rahimi et al. [30,31]. For this protocol six different sucrose solutions containing 0.75M, 0.625M, 0.5M, 0.375M, 0.25M and 0.125M sucrose were prepared (TS-1 to TS-6). The sucrose was solved in 10 ml PBS (Phosphate Buffered Saline) containing 50 mg/ml Gentamycin and 10% BSA. These solutions were used for the thawing procedure for both protocols in the same way. The stored tubes containing the vitrified cell pellets were taken out of the liquid nitrogen and quickly transferred in a water bath (37 °C) for about 120 s. Afterwards 1 ml of the TS containing 0.75M sucrose was added to the cell pellet for 15min. After centrifugation (60 s, 300rcf) and aspiration of TS-1 the second TS (TS-2) were added for 6 min. After centrifugation (60 s, 300rcf) and aspiration of TS-2 steps were repeated sequentially for all TS until the 0.125 M TS. After removal and centrifugation the cells were stored in PBS and immediately analysed.
2.5. Statistics The results of the quantitative PCR experiments have been analysed using ANOVA for independent samples followed by Tukey's HSD test. The results of the FACS analysis have been analysed by Students t-test. Differences were considered statistically significant at p < 0.05. The statistical analyses were performed at the VassarStats website http:// vassarstats.net/. 3. Results To evaluate the amount of cells that survived the vitrification and thawing process we used FACS analyses of human immortalized granulosa cells (KGN) after staining with propidium iodide. We found that vitrification with both P1 and P2 leads to a strong increment of dead KGN cells compared to untreated controls (p < 0.05). By comparing cells that are vitrified according to DMSO containing protocol 1 with ethyleneglycol containing protocol 2, it can be observed that the amount of non-viable cells treated according to P1 is 26.0% and that the amount of non-viable cells treated according to P2 is 37.1% of all cells (Fig. 1, p < 0.05) Untreated control cells show that 4.6% of all cells are non-viable (Fig. 1). The result of 11.1% difference between the t wo treatments P1 and P2 is significant (p < 0.05) as well as the control vs. 2
Cryobiology xxx (xxxx) xxx–xxx
M. Kokotsaki et al.
Table 1 Gene Name
Sequence 5‘- 3‘
Size (bp)
BAX FAS BCLxL BCL2 RBM3 HSPH1 FASL LGAL PLSCR4 HSP47 TNF-a CIRBP1 HSP27 Hif1a HSP70 18sRNA
Fw: TCTGACGGCAACTTCAACTG, Rev: GAGGAGTCTCACCCAACCAC Fw: TCACTTCGGAGGATTGCTCAA, Rev: GGGCATTAACACTTTTGGACG Fw: GTAAACTGGGGTCGCATTGT, Rev: TGCTGCATTGTTCCCATAGA Fw:ATGTGTGTGGAGAGCGTCAACC,Rev:GAGCAGAGTCTTCAGAGACAGCC Fw: CCATGAACGGAGAGTCTCTGGA, Rev: TAATACCTGCCACTCCCATAGC Fw: TCGAGACCATCGCCAATGAG, Rev: GGCTGCAACTCCGATTGTTC Fw: GGCCCATTTAACAGGCAAGTC, Rev: GGCCACCCTTCTTATACTTCAC Fw: GGGGTGAAGAACAGTCAGCA, Rev: ACGTGGGTGCTCACAAAGAA Fw: CATGGGTCTCTGGCGTTTCT, Rev: AGTTTGTTGTACGGTGCCCT Fw: AAGATGGTGGACAACCGTGG, Rev: ATGAGGCTGGAGAGCTTGTG Fw: ATCCTGGGGGACCCAATGTA, Rev: AAAAGAAGGCACAGAGGCCA Fw. TTAGGAGGCTCGGGTCGTTG, Rev: GCGACTGCTCATTGGTGTCA Fw: GTCCCTGGATGTCAACCACT, Rev: AGATGTAGCCATGCTCGTCC Fw: ATTCACCATGGAGGGCG, Rev: GTGGAAGTGGCAACTGATGA Fw: ATGAGTATAGCGACCGCTGC,Rev: TCCTTGGACTGTGTTCTTTGC Fw: GTAACCCGTTGAACCCCATT, Rev: CCATCCAATCGGTAGTAGCG
185 101 197 196 157 89 104 159 93 155 112 137 112 148 115 150
approximately 25 times higher. This effect was observed for vitrification according to Protocol 1 and Protocol 2. Thus, the process of vitrification and subsequent thawing itself seems to be the main cause of the increased expression rate of TNF-alpha in our experiments (see Fig. 3).
both protocols. Furthermore, we aimed to study whether the two protocols had an influence on the cell cycle of the treated cells. Fig. 2 shows that after vitrification, a significantly lower proportion of cells in the G1 and G2 phases of the cell cycle are found than in untreated cells (p < 0.05). In addition, it was shown that the amount of cells in the synthesis phase (S-phase) is higher after vitrification compared to unvitrified controls (not significant) and the amount of cells treated according to p1 is slightly higher than in cells treated according to P2 (not significant). Since the differences between the two protocols used were small in all the investigated phases of the cell cycle, this experiment might suggests a general activation n of the DNA synthesis machinery after a vitrification process and seems to be independent of the protocol. In order to investigate if gene expression is influenced by vitrification, we used Q-PCR experiments to analyse the expression of apoptosis regulating genes (TNF-alpha, FAS, FAS-L, BCL-2, Bcl-2-xl, Bax, PLSCR, LGALS) and temperature regulated genes (HIF-1a, CRIPT, HSP-27, HSP-47, HSP-70, RBM3). These experiments revealed that in the group of temperature sensitive genes we studied there was only a very slight change of expression before and after vitrification suggesting that gene expression of these genes are not influenced shortly after freezing and thawing. In the group of apoptosis regulating genes, there was a marked difference in the expression of the TNF-alpha gene. Compared to control, the expression after vitrification and thawing was
4. Discussion The standard method for cryopreservation of ovarian tissue is slow freezing using various cryoprotective chemicals [4]. However, several studies reported negative effects on different ovarian tissues as a result of slow freezing [2,24,28]. Vitrification might have some advantages compared to slow freezing as animal studies have shown that it does not induce apoptosis in human and mouse tissue after warming [34,36]. In addition, vitrification is the most accepted method for the cryopreservation of oocytes, embryos and sperm in human artificial reproduction [18,22,32]. Our study demonstrated that vitrification of human granulosa cells leads to a decrease of cell viability compared to unvitrified cells and to a strong increase of TNF-alpha gene expression. These effects were observed using both, a DMSO containing protocol (P1) and an ethyleneglycol containing protocol (P2). Cryopreservation in liquid nitrogen maintains the cellular
Fig. 1. Survival and Mortality rates of human vitrified KGN cells according to FACS analysis. A minimum of 10.000 cells were analyzed. (n = 6 for P1and P2, n = 4 for ctrl, values are given in % ± SD; n.s: not significant). 3
Cryobiology xxx (xxxx) xxx–xxx
M. Kokotsaki et al.
Fig. 2. Cell cycle analysis of human KGN cells after treatment to different vitrification protocols. A minimum of 7935 cells were analyzed. Values for controls are marked in black, values for cells treated according to protocol 1 (P1) are marked in white and values for cells treated according to protocol 2 (P2) are marked in grey. (n = 5, values are given in % ± SD; n.s: not significant).
ethyleneglycol containing solution in bovine cumulus oocyte complexes compared to an ethyleneglycol and DMSO containing solution. In cell cycle experiments we have shown that the amount of cells in S phase of the cell cycle is higher in vitrified cells than in the un-vitrified controls. Of note, the amount of cells in G1 and G2 phase in vitrified cells is lower than in the controls. These findings leads to the conclusion that the vitrification and thawing process might also influence the cell cycle. Furthermore, our cell cycle analysis has shown that cells that survived the vitrification process tend to double their DNA faster than the unfrozen control cells. In addition, the self-manufactured protocol (P1) shows a higher amount of cells in the synthesis phase than the commercial one (P2). We suspect that this finding might reflect the impact of the different chemicals in the protocols (DMSO vs. ethyleneglycol) on cellular physiology after vitrification. Many other studies suggested that the type and the concentration of the freezing chemicals influences both cell physiology and cellular gene expression [20,23,44]. In accordance with our finding that the used vitrification protocol differentially influences the cell cycle, Wang et al. showed that the vitrification regulates the expression levels of many genes in bovine oocytes, claiming that cell cycle specific genes e.g. CDK 2 were up-regulated whereas others were down-regulated by the vitrification procedure [39]. In human oocytes it was shown that both slow freezing and vitrification induces organelle remodeling and membrane recycling of different cellular organelles as well as meiotic spindle reorganization [5]. It is reasonable to assume that these processes could influence the time points of cellular cycles [28]. In order to determine the effects of vitrification on gene expression of apoptosis and temperature sensitive genes we determined the expression level of certain genes in fresh and vitrified KGN samples by QPCR. These experiments revealed that the expression of TNF-alpha is remarkable up-regulated after vitrification and thawing. In contrast, the expression of other apoptosis related genes and temperature or stress regulated genes were not significantly up-or downregulated by vitrification and thawing. This result indicates that vitrification and thawing of human granulosa cells leads to an activation of the death receptor mediated pathway by TNF-alpha. This is in accordance with findings by Han and co-authors [15] who showed that the combination of TNF-α and freezing enhance post thaw injury of MCF-7 cells in a model system for breast cancer cryosurgery.
metabolism in a quiescent state and conserves cells or tissue for an indefinite period of time [12]. The choice of an appropriate cryopreservation protocol especially for ovarian tissue is still a controversial issue and part of an ongoing debate [40,45]. Most authors focus their research effort on morphological parameters of primordial follicles and follicular structures in histologic analysis. Although morphological intact follicles are the origin of intact oocytes in the course of female development, the different cells surrounding the follicle and especially granulosa cells, which are an essential part of the follicle, play an extraordinary role in the growth of an ovarian transplant [14,21]. We therefore used the human granulosa cell line KGN to test which of the two vitrification solutions and their corresponding protocols, a selfmanufactured and a commercial one, yields better results with respect to cell viability and gene expression of genes involved in apoptosis and cellular temperature response. The viability of KGN cells after vitrification was determined with the help of FACs analyses. We found a significant difference in the amount of living cells between fresh cells (control) and vitrified cells independently of the protocol used. This finding points to a severe impact of the vitrification process in general to cell viability in our experiments. Similar finding were described by Da Croce and co-authors [7] in umbilical cord tissue showing that the vitrification process decrease cell viability about 35% of cells of the cord lining membrane and that samples of this umbilical cord tissue are still proliferating in cell culture experiments. Zeng and co-authors [43] demonstrates that the viability of carcinoma cells decreased from 72.7% in fresh tissue to 68.2% in vitrified tissue. In our experiments the amount of non-viable cells is 11% higher of cells treated according to P2 (26,0% vs. 37,1%) than in P1. This might be substantiated in different toxicological effects of DMSO and ethyleneglycol. For example, it was shown that DMSO has an effect on the methylation status of embryonic stem cells as well as on embryonic bodies [19]. In Addition, Santos and co-authors [35] summarized a plethora of cellular effects of DMSO like, reactive oxygen species scavanging, modulation of cell cycle, apoptosis and protein expression. Ethyleneglycol was considered to be embryotoxic at high concentration in mice and rat. However, it was not embryotoxic in rabbits, pointing to species related metabolic processes of ethyleneglycol [13]. In a recent article Azari and co-authors [1] described a higher expression of the maturation genes GDF9 and BMP15 after vitrification with a solely 4
Cryobiology xxx (xxxx) xxx–xxx
M. Kokotsaki et al.
Fig. 3. a. Quantitative PCR Analysis of genes related to apoptosis. The expression is shown as fold difference between genes normalized to 18sRNA expression of independent experiments. (n = 5, values are given as mean ± SEM, *p < 0.05). P1 are the values for gene expression of cells treated according to protocol 1, P2 are the values for gene expression of cells treated according to protocol 2. b. Quantitative PCR Analysis of genes sensitive to temperature. The expression is shown as fold difference between genes normalized to 18sRNA expression of independent experiments. (n = 5, values are given as mean ± SEM, *p < 0.05). P1 are the values for gene expression of cells treated according to protocol 1, P2 are the values for gene expression of cells treated according to protocol 2.
5. Conclusion
At the level of the ovary, TNF-alpha has been proposed as an intraovarian modulator of granulosa cell function and has been shown to alter ovarian steroidogenesis. Moreover, it is also a regulator of atresia and/or luteolysis [16,26]. Recently it has been shown, that TNF-alpha induces granulosa cell death of unruptured follicles via apoptosis and autophagy [41]. Together with our finding of a remarkable upregulation of TNF-alpha gene expression and a increment of non-vital granulosa cells after vitrification, this leads to the idea that one reason for the difficulties in regenerating ovarian function in OTB programs might be the activation of a TNF-alpha mediated pathway leading to apoptosis in the thawed and implanted tissue. As shown by many others the freezing- and thawing process in general, always involves cell damage independently from the use of either slow freezing or vitrification [6,17,42]. The appearance of apoptotic cells is therefore a general problem of this method of fertility preservation [33]. Our finding that the vitrification of granulosa cells occurs with an increased expression of TNF- alpha opens up the possibility that TNF-alpha inhibitors, such as etanercept (ETA) and infliximab (INF) might improve the survival of frozen cells.
We could show that human granulosa cells are damaged by various chemicals or procedures during vitrification and that the vitrificationthawing protocol differentially activates TNF-alpha gene expression which might lead to apoptosis of granulosa cells. Further research is necessary to investigate our idea of a potential influence of TNF-alpha inhibitors in ovarian tissue banking programs. Acknowledgment Human KGN cells were a friendly kind gift by K. Horling Department of Anatomy and Cell Biology, Martin Luther University Faculty of Medicine, Halle (Saale), Germany. The authors would like to thank R. Gessele for proofreading of the manuscript. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.cryobiol.2018.09.006. 5
Cryobiology xxx (xxxx) xxx–xxx
M. Kokotsaki et al.
References [1] M. Azari, M. Kafi, B. Ebrahimi, R. Fatehi, M. Jamalzadeh, Oocyte maturation, embryo development and gene expression following two different methods of bovine cumulus-oocyte complexes vitrification, Vet. Res. Commun. 41 (2017) 49–56. [2] L. Bastings, J.R. Westphal, C.C. Beerendonk, R.L. Bekkers, P.L. Zusterzeel, J.C. Hendriks, D.D. Braat, R. Peek, Clinically applied procedures for human ovarian tissue cryopreservation result in different levels of efficacy and efficiency, J. Assist. Reprod. Genet. 33 (2016) 1605–1614. [3] J. Becker, A. Walz, S. Daube, C. Keck, D. Pietrowski, Distinct responses of human granulosa lutein cells after hCG or LH stimulation in a spheroidal cell culture system, Mol. Reprod. Dev. 74 (2007) 1312–1316. [4] M.A. Bedaiwy, S.A. El-Nashar, A.M. El Saman, J.L. Evers, S. Sandadi, N. Desai, T. Falcone, Reproductive outcome after transplantation of ovarian tissue: a systematic review, Hum. Reprod. 23 (2008) 2709–2717. [5] V. Bianchi, G. Macchiarelli, A. Borini, M. Lappi, S. Cecconi, S. Miglietta, G. Familiari, S.A. Nottola, Fine morphological assessment of quality of human mature oocytes after slow freezing or vitrification with a closed device: a comparative analysis, Reprod. Biol. Endocrinol.: RBE (Rev. Bras. Entomol.) 12 (2014) 110. [6] A. Bissoyi, B. Nayak, K. Pramanik, S.K. Sarangi, Targeting cryopreservation-induced cell death: a review, Biopreserv. Biobanking 12 (2014) 23–34. [7] L. Da-Croce, G.H. Gambarini-Paiva, P.C. Angelo, E.A. Bambirra, A.C. Cabral, A.L. Godard, Comparison of vitrification and slow cooling for umbilical tissues, Cell Tissue Bank. 14 (2013) 65–76. [8] A. Dalman, N.S. Deheshkar Gooneh Farahani, M. Totonchi, R. Pirjani, B. Ebrahimi, M. Rezazadeh Valojerdi, Slow freezing versus vitrification technique for human ovarian tissue cryopreservation: an evaluation of histological changes, WNT signaling pathway and apoptotic genes expression, Cryobiology 79 (2017) 29–36. [9] A.D. Deitch, H. Law, R. deVere White, A stable propidium iodide staining procedure for flow cytometry, J. Histochem. Cytochem.: Off. J. Histochem. Soc. 30 (1982) 967–972. [10] J. Donnez, M.M. Dolmans, D. Demylle, P. Jadoul, C. Pirard, J. Squifflet, B. MartinezMadrid, A. van Langendonckt, Livebirth after orthotopic transplantation of cryopreserved ovarian tissue, Lancet 364 (2004) 1405–1410. [11] J. Donnez, M.M. Dolmans, Fertility preservation in women, N. Engl. J. Med. 377 (2017) 1657–1665. [12] G.D. Elliott, S. Wang, B.J. Fuller, Cryoprotectants: a review of the actions and applications of cryoprotective solutes that modulate cell recovery from ultra-low temperatures, Cryobiology 76 (2017) 74–91. [13] J. Fowles, M. Banton, J. Klapacz, H. Shen, A toxicological review of the ethylene glycol series: commonalities and differences in toxicity and modes of action, Toxicol. Lett. 278 (2017) 66–83. [14] M. Fransolet, L. Henry, S. Labied, A. Noel, M. Nisolle, C. Munaut, In vitro evaluation of the anti-apoptotic drug Z-VAD-FMK on human ovarian granulosa cell lines for further use in ovarian tissue transplantation, J. Assist. Reprod. Genet. 32 (2015) 1551–1559. [15] B. Han, D.J. Swanlund, J.C. Bischof, Cryoinjury of MCF-7 human breast cancer cells and inhibition of post-thaw recovery using TNF-alpha, Technol. Canc. Res. Treat. 6 (2007) 625–634. [16] T. Hojo, M.J. Siemieniuch, K. Lukasik, K.K. Piotrowska-Tomala, A.W. Jonczyk, K. Okuda, D.J. Skarzynski, Programmed necrosis - a new mechanism of steroidogenic luteal cell death and elimination during luteolysis in cows, Sci. Rep. 6 (2016) 38211. [17] C.J. Hunt, Cryopreservation: vitrification and controlled rate cooling, Meth. Mol. Biol. 1590 (2017) 41–77. [18] V. Isachenko, G. Rahimi, P. Mallmann, R. Sanchez, E. Isachenko, Technologies of cryoprotectant-free vitrification of human spermatozoa: asepticity as criterion of effectiveness, Andrology 5 (2017) 1055–1063. [19] M. Iwatani, K. Ikegami, Y. Kremenska, N. Hattori, S. Tanaka, S. Yagi, K. Shiota, Dimethyl sulfoxide has an impact on epigenetic profile in mouse embryoid body, Stem Cells (Dayton) 24 (2006) 2549–2556. [20] L. Janz Fde, A. Debes Ade, C. Cavaglieri Rde, S.A. Duarte, C.M. Romao, A.F. Moron, M. Zugaib, S.P. Bydlowski, Evaluation of distinct freezing methods and cryoprotectants for human amniotic fluid stem cells cryopreservation, J. Biomed. Biotechnol. 2012 (2012) 649353. [21] M. Kurus, C. Karakaya, M.H. Karalok, G. To, J. Johnson, The control of oocyte survival by intrinsic and extrinsic factors, Adv. Exp. Med. Biol. 761 (2013) 7–18. [22] P.E. Levi-Setti, P. Patrizio, G. Scaravelli, Evolution of human oocyte cryopreservation: slow freezing versus vitrification, Curr. Opin. Endocrinol. Diabetes Obes. 23 (2016) 445–450. [23] S. Maffei, M. Hanenberg, G. Pennarossa, J.R. Silva, T.A. Brevini, A. Arav, F. Gandolfi, Direct comparative analysis of conventional and directional freezing for the cryopreservation of whole ovaries, Fertil. Steril. 100 (2013) 1122–1131. [24] F.J. Mathias, F. D'Souza, S. Uppangala, S.R. Salian, G. Kalthur, S.K. Adiga, Ovarian tissue vitrification is more efficient than slow freezing in protecting oocyte and granulosa cell DNA integrity, Syst. Biol. Reprod. Med. 60 (2014) 317–322. [25] L.J. McKenzie, S.A. Pangas, S.A. Carson, E. Kovanci, P. Cisneros, J.E. Buster,
[26] [27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
[44]
[45]
6
P. Amato, M.M. Matzuk, Human cumulus granulosa cell gene expression: a predictor of fertilization and embryo selection in women undergoing IVF, Hum. Reprod. 19 (2004) 2869–2874. R. Meidan, R.A. Milvae, S. Weiss, N. Levy, A. Friedman, Intraovarian regulation of luteolysis, J. Reprod. Fertil. 54 (1999) 217–228 Supplement. Y. Nishi, T. Yanase, Y. Mu, K. Oba, I. Ichino, M. Saito, M. Nomura, C. Mukasa, T. Okabe, K. Goto, R. Takayanagi, Y. Kashimura, M. Haji, H. Nawata, Establishment and characterization of a steroidogenic human granulosa-like tumor cell line, KGN, that expresses functional follicle-stimulating hormone receptor, Endocrinology 142 (2001) 437–445. S.A. Nottola, E. Albani, G. Coticchio, M.G. Palmerini, C. Lorenzo, G. Scaravelli, A. Borini, P.E. Levi-Setti, G. Macchiarelli, Freeze/thaw stress induces organelle remodeling and membrane recycling in cryopreserved human mature oocytes, J. Assist. Reprod. Genet. 33 (2016) 1559–1570. D. Pietrowski, Y. Gong, M. Mairhofer, R. Gessele, M. Sator, Effects of progesterone and its metabolites on human granulosa cells, Hormone and metabolic research = Hormon- und Stoffwechselforschung = Hormones et metabolisme 46 (2014) 133–137. G. Rahimi, E. Isachenko, V. Isachenko, H. Sauer, M. Wartenberg, S. Tawadros, J. Hescheler, P. Mallmann, F. Nawroth, Comparison of necrosis in human ovarian tissue after conventional slow freezing or vitrification and transplantation in ovariectomized SCID mice, Reprod. Biomed. Online 9 (2004) 187–193. G. Rahimi, V. Isachenko, R. Kreienberg, H. Sauer, P. Todorov, S. Tawadros, P. Mallmann, F. Nawroth, E. Isachenko, Re-vascularisation in human ovarian tissue after conventional freezing or vitrification and xenotransplantation, Eur. J. Obstet. Gynecol. Reprod. Biol. 149 (2010) 63–67. L. Rienzi, C. Gracia, R. Maggiulli, A.R. LaBarbera, D.J. Kaser, F.M. Ubaldi, S. Vanderpoel, C. Racowsky, Oocyte, embryo and blastocyst cryopreservation in ART: systematic review and meta-analysis comparing slow-freezing versus vitrification to produce evidence for the development of global guidance, Hum. Reprod. Update 23 (2017) 139–155. E. Rimon, T. Cohen, A. Dantes, L. Hirsh, A. Amit, J.B. Lessing, S. Freimann, A. Amsterdam, F. Azem, Apoptosis in cryopreserved human ovarian tissue obtained from cancer patients: a tool for evaluating cryopreservation utility, Int. J. Oncol. 27 (2005) 345–353. M. Salehnia, M. Sheikhi, S. Pourbeiranvand, M. Lundqvist, Apoptosis of human ovarian tissue is not increased by either vitrification or rapid cooling, Reprod. Biomed. Online 25 (2012) 492–499. N.C. Santos, J. Figueira-Coelho, J. Martins-Silva, C. Saldanha, Multidisciplinary utilization of dimethyl sulfoxide: pharmacological, cellular, and molecular aspects, Biochem. Pharmacol. 65 (2003) 1035–1041. M. Sheikhi, K. Hultenby, B. Niklasson, M. Lundqvist, O. Hovatta, Clinical grade vitrification of human ovarian tissue: an ultrastructural analysis of follicles and stroma in vitrified tissue, Hum. Reprod. 26 (2011) 594–603. S. Silber, How ovarian transplantation works and how resting follicle recruitment occurs: a review of results reported from one center, Women's Health 12 (2016) 217–227. M.A. Smith, N.L. Seibel, S.F. Altekruse, L.A. Ries, D.L. Melbert, M. O'Leary, F.O. Smith, G.H. Reaman, Outcomes for children and adolescents with cancer: challenges for the twenty-first century, J. Clin. Oncol.: Off. J. Am. Soc. Clin. Oncol. 28 (2010) 2625–2634. N. Wang, C.Y. Li, H.B. Zhu, H.S. Hao, H.Y. Wang, C.L. Yan, S.J. Zhao, W.H. Du, D. Wang, Y. Liu, Y.W. Pang, X.M. Zhao, Effect of vitrification on the mRNA transcriptome of bovine oocytes, Reprod. Dom. Animals = Zuchthygiene 52 (2017) 531–541. T.R. Wang, J. Yan, C.L. Lu, X. Xia, T.L. Yin, X. Zhi, X.H. Zhu, T. Ding, W.H. Hu, H.Y. Guo, R. Li, L.Y. Yan, J. Qiao, Human single follicle growth in vitro from cryopreserved ovarian tissue after slow freezing or vitrification, Hum. Reprod. 31 (2016) 763–773. Y. Yamamoto, A. Kuwahara, Y. Taniguchi, M. Yamasaki, Y. Tanaka, Y. Mukai, M. Yamashita, T. Matsuzaki, T. Yasui, M. Irahara, Tumor necrosis factor alpha inhibits ovulation and induces granulosa cell death in rat ovaries, Reprod. Med. Biol. 14 (2015) 107–115. H.W. Youm, J.R. Lee, J. Lee, B.C. Jee, C.S. Suh, S.H. Kim, Optimal vitrification protocol for mouse ovarian tissue cryopreservation: effect of cryoprotective agents and in vitro culture on vitrified-warmed ovarian tissue survival, Hum. Reprod. 29 (2014) 720–730. M. Zeng, Q.R. Yang, G.B. Fu, Y. Zhang, X. Zhou, W.J. Huang, H.D. Zhang, W.J. Li, Z.Y. Wang, H.X. Yan, B. Zhai, Maintaining viability and characteristics of cholangiocarcinoma tissue by vitrification-based cryopreservation, Cryobiology 78 (2017) 41–46. X.G. Zhang, H. Li, J.H. Hu, Effects of various cryoprotectants on the quality of frozen-thawed immature bovine (Qinchuan cattle) calf testicular tissue, Andrologia 49 (2017). X.H. Zhou, D. Zhang, J. Shi, Y.J. Wu, Comparison of vitrification and conventional slow freezing for cryopreservation of ovarian tissue with respect to the number of intact primordial follicles: a meta-analysis, Medicine 95 (2016) e4095.
Contents lists available at ScienceDirect
Cryobiology journal homepage: www.elsevier.com/locate/cryo
Impact of vitrification on granulosa cell survival and gene expression☆ Maria Kokotsakib, Mario Mairhoferc, Christian Schneebergera, Julian Marschaleka, Detlef Pietrowskia,∗ a b c
Medical University Vienna, Department of Obstetrics and Gynecology, Wien, Austria VivaNeo Kinderwunschklinik Dr. Loimer, Wien, Austria University of Applied Sciences Upper Austria, TIMed Center Campus Linz, Austria
A R T I C LE I N FO
A B S T R A C T
Keywords: Apoptosis Cell culture Cell cycle Cryopreservation Female infertility Gene expression Granulosa cells
Introduction: Cryopreservation of ovarian tissue is an essential step in Ovarian Tissue Banking. In order to prevent the formation of ice crystals, typically the tissue is slowly frozen using a cryoprotectant. As an alternative the method of ultra-fast freezing by vitrification becomes more attention for freezing ovarian tissue because it has successfully been used for oocytes, embryos and sperm. However the impact of vitrification on granulosa cells, which are an essential part of ovarian tissue is uncertain. Aim: In this study, we have therefore analysed the influence of vitrification on the survival rates of granulosa cells, the impact of DMSO or ethylenglycol containing vitrification protocols and investigated to what extent the gene expression of apoptosis- and temperature-sensitive genes changes. Material and methods: We used the human granulosa cell line KGN as a model for human granulosa cells and determined the survival rate and cell cycle stages by FACS analyses. The change in gene expression was determined by quantitative PCR analyses. Results: Our results show that vitrification is possible in granulosa cells but it reduces cell viability and leads to fluctuations in the cell cycle. The DMSO containing protocol results in a lower amount of dead cells than the ethylenglycol containing protocol. Gene expression analysis reveals that TNF-alpha expression is strongly increased after vitrification, while other apoptosis or temperature-related genes seem to stay unaffected. Conclusion: We conclude that vitrification influences the viability of human granulosa cells. Furthermore, our results suggest that this could be mediated by a change in TNF-alpha gene expression.
1. Introduction After cancer diagnosis and subsequent chemotherapy, young females aged 15 years and younger run the risk of completely losing their reproductive function. The most successful way to preserve fertility in these women is the cryopreservation of ovarian tissue before, and the reimplantation of this tissue after cancer therapy, and a subsequent reminiscent phase in an Ovarian Tissue banking (OTB) program [38]. Both, pregnancies and livebirths after reimplantation of frozen and thawed ovarian tissue were reported [10,37]. So far, the number of livebirths using this method exceeded 130 [11]. The majority of these births were achieved with “slow freezing”, where the tissue is stepwise cooled down to −192 °C and stored in liquid nitrogen after incubation in a cryosolution [45]. The incubation step is necessary to avoid the formation of cell-damaging ice crystals in the tissue [12]. An upcoming method to freeze cells and tissue is
vitrification, an ultra-fast freezing procedure by direct immersion of the tissue in liquid nitrogen. The freezing rate of more than 20.000 C° per second results in an ice crystal free amorphous structure of the tissue. In the field of in-vitro-fertilization, vitrification of oocytes, embryos and sperm is the “gold standard” method for cryopreservation which demonstrates its value for reproductive therapies. However, these cell types are very small compared to an ovarian tissue segment. In ovarian tissue banking the ovarian tissue is sliced into pieces of 1–5 mm thickness. As a consequence of this large size it is not clear if the freezing rates in the interior of the tissue are adequate to completely avoid ice crystal formation. To reduce ice crystal formation in ovarian tissue, cryoprotective agents are generally used in vitrification at higher concentrations than in slow freezing which, however, might be damaging to the tissue [8,42]. Ovarian tissue consist of a variety of different cells e.g. granulosa, endothelial, and stroma cells as well as follicles at different stages,
☆ ∗
M.M. was supported by the European Fund for Regional Development (EFRE, IWB2020) and the Federal State of Upper Austria. Corresponding author. Medical University Vienna, Department of Obstetrics and Gynecology, Waehringerstrasse 18-20, 1090, Wien, Austria. E-mail address: [email protected] (D. Pietrowski).
https://doi.org/10.1016/j.cryobiol.2018.09.006 Received 11 May 2018; Received in revised form 6 September 2018; Accepted 24 September 2018 0011-2240/ © 2018 Published by Elsevier Inc.
Please cite this article as: Kokotsaki, M., Cryobiology, https://doi.org/10.1016/j.cryobiol.2018.09.006
Cryobiology xxx (xxxx) xxx–xxx
M. Kokotsaki et al.
which are all necessary to build a functional ovary. Granulosa cells might be the most important for ovarian function as they represent an essential source of hormones and nourish the growing oocyte [3,25]. Aim: We aimed to study the impact of vitrification on human granulosa cells by comparing the effects of two vitrification solutions and their corresponding protocols on the human granulosa cell line KGN physiology [27,29].
2.3. Flow cytometry analysis (FACS) Cell cycle analysis was performed by propidium iodide staining in a FACScan flow cytometer according to standard procedures [9]. A minimum of 7935 events was collected and analysed. In brief, for the viability analyses, the cells were collected by centrifugation (300 × g, 4 min, room temperature) after trypsinization and washing in 2 ml PBS (2x) and re-suspended in 0,5 ml PBS. 5 μl of a 2,5 mg/ml containing propidium iodide solution (BD Bioscience, San Jose, USA) was added to each tube prior to analysis. For the cell cycle analyses cells were fixed on ice with ethanol (3 ml) and stained with 0,5 ml PI/RNase Staining Buffer (BD Biosciences, San Jose, USA) for 15 min at RT after trypsinization and washing. The samples were analysed within 1 h with BD FACScan™ flow cytometry (BD Biosciences, San Jose, USA) using CellQuest Software (BD Biosciences, San Jose, USA and Flow Cytometry Analysis Software, FLOWJO (www.flowjo.com). Experiments were repeated at least five times individually.
2. Materials and methods Except where otherwise stated, all chemicals were obtained from Sigma (Sigma Chemical Co., St Louis, USA).
2.1. Cell culture of human KGN granulosa cells The human KGN cell line was established by Nishi et al., 2001 from a stage III granulosa cell carcinoma [27]. Human KGN cells were cultured in DMEM (Dulbecco's Modified Eagle Medium), 10% FCS (Fetal calf serum) and 1% Pen/Strep (Penicillin/Streptomycin) all purchased by (Sigma, Germany) at 37 °C and 5% CO2 when they reached 75% confluency.
2.4. RNA extraction and cDNA preparation Total RNA from isolated granulosa cells was extracted using RNeasy Minikit (Quiagen, Hilden, Germany) according to the manufacturer's instructions. The RNA was quantified by determining the absorbance at 260 nm and treated with 2 U RNase-free DNase I (Thermo Fisher Scientific, Waltham, USA) at 37 °C for 30 min to remove contaminating DNA. Two μg of the total RNA was reverse transcribed into cDNA using random primer as per manufacturer's instructions (First Strand cDNA Synthesis Kit, MBI-Fermentas, Vilnius, Lithuania, Germany). Quantitative RT PCR was performed using Power SYBR Green PCR master mix according to manufacturers’ instruction on a 7500 Fast Real Time PCR System (Applied Biosystems, Foster City, USA) and individually performed 5 times for each gene. These studies were done in both vitrified and non-vitrified groups for all listed genes in Table 1. The primers are designed by a standard computer program at: http:// bibiserv.techfak.uni-bielefeld.de/genefisher. Calculated primer pairs were investigated for redundancy at the BLAST Genbank server (http:// www.ncbi.nlm.nih.gov/BLAST/). Only those primers were used for the PCR analyses which are shown to be specific for the investigated genes. Prior to the quantitative analysis, optimisation procedures were performed by running real-time PCRs with or without template to verify the reaction conditions, including the annealing temperatures of the primers and specific products.
2.2. Vitrification and thawing Vitrification of the cells was performed as follows: A vitrification solution (VS1) was prepared containing 23% DMSO (Dimethyl sulfoxide) (Cryosure, Steinbach, Germany), 10% BSA (Bovine Serum Albumin) (Thermo Fisher Scientific, Waltham, USA) and 67% DMEM (Thermo Fisher Scientific, Waltham, USA). KGN cells that were treated according to protocol 1 (P1) were equilibrated in 25% VS1 (VS1-25) in PBS for 5 min. After removing the solution by centrifugation at 300 rcf for 60 s and aspiration of the supernatant cells were incubated for 5 min in 50% VS1 (VS1-50) in PBS and after removing VS1-50, cells were incubated for 10 min in VS 1. Every step of this procedure was performed at room temperature (RT). Afterwards the cells were transferred in a cryotube and centrifuged for 60 s (300 rcf) and the supernatant was discarded. In a next step the tubes containing the cell pellet were directly plunged into liquid nitrogen and stored. For treatment of KGN-cells according to protocol 2 (P2), we used the Orgio cooling kit (Origio, Måløv, Denmark) and adapted the protocol as follows: The equilibration media (E2) and the vitrification media (VS2) were warmed to RT for 30 min. One ml of E2 was added to approximately 600.000 KGN cells and equilibrated for 15 min. E2 was removed by aspiration after centrifugation at 300 rcf for 60 s at room temperature. Afterwards 1 ml of VS2 was added to the cell pellet. After 30 s the solution was removed by aspiration after a centrifugation step (300 rcf for 60 s). Than the tubes containing the cell pellet were immediately plunged into liquid nitrogen and stored. Thawing: For cell thawing, we adapted a thawing protocol for OTB (Ovarian Tissue Banking), previously described by Rahimi et al. [30,31]. For this protocol six different sucrose solutions containing 0.75M, 0.625M, 0.5M, 0.375M, 0.25M and 0.125M sucrose were prepared (TS-1 to TS-6). The sucrose was solved in 10 ml PBS (Phosphate Buffered Saline) containing 50 mg/ml Gentamycin and 10% BSA. These solutions were used for the thawing procedure for both protocols in the same way. The stored tubes containing the vitrified cell pellets were taken out of the liquid nitrogen and quickly transferred in a water bath (37 °C) for about 120 s. Afterwards 1 ml of the TS containing 0.75M sucrose was added to the cell pellet for 15min. After centrifugation (60 s, 300rcf) and aspiration of TS-1 the second TS (TS-2) were added for 6 min. After centrifugation (60 s, 300rcf) and aspiration of TS-2 steps were repeated sequentially for all TS until the 0.125 M TS. After removal and centrifugation the cells were stored in PBS and immediately analysed.
2.5. Statistics The results of the quantitative PCR experiments have been analysed using ANOVA for independent samples followed by Tukey's HSD test. The results of the FACS analysis have been analysed by Students t-test. Differences were considered statistically significant at p < 0.05. The statistical analyses were performed at the VassarStats website http:// vassarstats.net/. 3. Results To evaluate the amount of cells that survived the vitrification and thawing process we used FACS analyses of human immortalized granulosa cells (KGN) after staining with propidium iodide. We found that vitrification with both P1 and P2 leads to a strong increment of dead KGN cells compared to untreated controls (p < 0.05). By comparing cells that are vitrified according to DMSO containing protocol 1 with ethyleneglycol containing protocol 2, it can be observed that the amount of non-viable cells treated according to P1 is 26.0% and that the amount of non-viable cells treated according to P2 is 37.1% of all cells (Fig. 1, p < 0.05) Untreated control cells show that 4.6% of all cells are non-viable (Fig. 1). The result of 11.1% difference between the t wo treatments P1 and P2 is significant (p < 0.05) as well as the control vs. 2
Cryobiology xxx (xxxx) xxx–xxx
M. Kokotsaki et al.
Table 1 Gene Name
Sequence 5‘- 3‘
Size (bp)
BAX FAS BCLxL BCL2 RBM3 HSPH1 FASL LGAL PLSCR4 HSP47 TNF-a CIRBP1 HSP27 Hif1a HSP70 18sRNA
Fw: TCTGACGGCAACTTCAACTG, Rev: GAGGAGTCTCACCCAACCAC Fw: TCACTTCGGAGGATTGCTCAA, Rev: GGGCATTAACACTTTTGGACG Fw: GTAAACTGGGGTCGCATTGT, Rev: TGCTGCATTGTTCCCATAGA Fw:ATGTGTGTGGAGAGCGTCAACC,Rev:GAGCAGAGTCTTCAGAGACAGCC Fw: CCATGAACGGAGAGTCTCTGGA, Rev: TAATACCTGCCACTCCCATAGC Fw: TCGAGACCATCGCCAATGAG, Rev: GGCTGCAACTCCGATTGTTC Fw: GGCCCATTTAACAGGCAAGTC, Rev: GGCCACCCTTCTTATACTTCAC Fw: GGGGTGAAGAACAGTCAGCA, Rev: ACGTGGGTGCTCACAAAGAA Fw: CATGGGTCTCTGGCGTTTCT, Rev: AGTTTGTTGTACGGTGCCCT Fw: AAGATGGTGGACAACCGTGG, Rev: ATGAGGCTGGAGAGCTTGTG Fw: ATCCTGGGGGACCCAATGTA, Rev: AAAAGAAGGCACAGAGGCCA Fw. TTAGGAGGCTCGGGTCGTTG, Rev: GCGACTGCTCATTGGTGTCA Fw: GTCCCTGGATGTCAACCACT, Rev: AGATGTAGCCATGCTCGTCC Fw: ATTCACCATGGAGGGCG, Rev: GTGGAAGTGGCAACTGATGA Fw: ATGAGTATAGCGACCGCTGC,Rev: TCCTTGGACTGTGTTCTTTGC Fw: GTAACCCGTTGAACCCCATT, Rev: CCATCCAATCGGTAGTAGCG
185 101 197 196 157 89 104 159 93 155 112 137 112 148 115 150
approximately 25 times higher. This effect was observed for vitrification according to Protocol 1 and Protocol 2. Thus, the process of vitrification and subsequent thawing itself seems to be the main cause of the increased expression rate of TNF-alpha in our experiments (see Fig. 3).
both protocols. Furthermore, we aimed to study whether the two protocols had an influence on the cell cycle of the treated cells. Fig. 2 shows that after vitrification, a significantly lower proportion of cells in the G1 and G2 phases of the cell cycle are found than in untreated cells (p < 0.05). In addition, it was shown that the amount of cells in the synthesis phase (S-phase) is higher after vitrification compared to unvitrified controls (not significant) and the amount of cells treated according to p1 is slightly higher than in cells treated according to P2 (not significant). Since the differences between the two protocols used were small in all the investigated phases of the cell cycle, this experiment might suggests a general activation n of the DNA synthesis machinery after a vitrification process and seems to be independent of the protocol. In order to investigate if gene expression is influenced by vitrification, we used Q-PCR experiments to analyse the expression of apoptosis regulating genes (TNF-alpha, FAS, FAS-L, BCL-2, Bcl-2-xl, Bax, PLSCR, LGALS) and temperature regulated genes (HIF-1a, CRIPT, HSP-27, HSP-47, HSP-70, RBM3). These experiments revealed that in the group of temperature sensitive genes we studied there was only a very slight change of expression before and after vitrification suggesting that gene expression of these genes are not influenced shortly after freezing and thawing. In the group of apoptosis regulating genes, there was a marked difference in the expression of the TNF-alpha gene. Compared to control, the expression after vitrification and thawing was
4. Discussion The standard method for cryopreservation of ovarian tissue is slow freezing using various cryoprotective chemicals [4]. However, several studies reported negative effects on different ovarian tissues as a result of slow freezing [2,24,28]. Vitrification might have some advantages compared to slow freezing as animal studies have shown that it does not induce apoptosis in human and mouse tissue after warming [34,36]. In addition, vitrification is the most accepted method for the cryopreservation of oocytes, embryos and sperm in human artificial reproduction [18,22,32]. Our study demonstrated that vitrification of human granulosa cells leads to a decrease of cell viability compared to unvitrified cells and to a strong increase of TNF-alpha gene expression. These effects were observed using both, a DMSO containing protocol (P1) and an ethyleneglycol containing protocol (P2). Cryopreservation in liquid nitrogen maintains the cellular
Fig. 1. Survival and Mortality rates of human vitrified KGN cells according to FACS analysis. A minimum of 10.000 cells were analyzed. (n = 6 for P1and P2, n = 4 for ctrl, values are given in % ± SD; n.s: not significant). 3
Cryobiology xxx (xxxx) xxx–xxx
M. Kokotsaki et al.
Fig. 2. Cell cycle analysis of human KGN cells after treatment to different vitrification protocols. A minimum of 7935 cells were analyzed. Values for controls are marked in black, values for cells treated according to protocol 1 (P1) are marked in white and values for cells treated according to protocol 2 (P2) are marked in grey. (n = 5, values are given in % ± SD; n.s: not significant).
ethyleneglycol containing solution in bovine cumulus oocyte complexes compared to an ethyleneglycol and DMSO containing solution. In cell cycle experiments we have shown that the amount of cells in S phase of the cell cycle is higher in vitrified cells than in the un-vitrified controls. Of note, the amount of cells in G1 and G2 phase in vitrified cells is lower than in the controls. These findings leads to the conclusion that the vitrification and thawing process might also influence the cell cycle. Furthermore, our cell cycle analysis has shown that cells that survived the vitrification process tend to double their DNA faster than the unfrozen control cells. In addition, the self-manufactured protocol (P1) shows a higher amount of cells in the synthesis phase than the commercial one (P2). We suspect that this finding might reflect the impact of the different chemicals in the protocols (DMSO vs. ethyleneglycol) on cellular physiology after vitrification. Many other studies suggested that the type and the concentration of the freezing chemicals influences both cell physiology and cellular gene expression [20,23,44]. In accordance with our finding that the used vitrification protocol differentially influences the cell cycle, Wang et al. showed that the vitrification regulates the expression levels of many genes in bovine oocytes, claiming that cell cycle specific genes e.g. CDK 2 were up-regulated whereas others were down-regulated by the vitrification procedure [39]. In human oocytes it was shown that both slow freezing and vitrification induces organelle remodeling and membrane recycling of different cellular organelles as well as meiotic spindle reorganization [5]. It is reasonable to assume that these processes could influence the time points of cellular cycles [28]. In order to determine the effects of vitrification on gene expression of apoptosis and temperature sensitive genes we determined the expression level of certain genes in fresh and vitrified KGN samples by QPCR. These experiments revealed that the expression of TNF-alpha is remarkable up-regulated after vitrification and thawing. In contrast, the expression of other apoptosis related genes and temperature or stress regulated genes were not significantly up-or downregulated by vitrification and thawing. This result indicates that vitrification and thawing of human granulosa cells leads to an activation of the death receptor mediated pathway by TNF-alpha. This is in accordance with findings by Han and co-authors [15] who showed that the combination of TNF-α and freezing enhance post thaw injury of MCF-7 cells in a model system for breast cancer cryosurgery.
metabolism in a quiescent state and conserves cells or tissue for an indefinite period of time [12]. The choice of an appropriate cryopreservation protocol especially for ovarian tissue is still a controversial issue and part of an ongoing debate [40,45]. Most authors focus their research effort on morphological parameters of primordial follicles and follicular structures in histologic analysis. Although morphological intact follicles are the origin of intact oocytes in the course of female development, the different cells surrounding the follicle and especially granulosa cells, which are an essential part of the follicle, play an extraordinary role in the growth of an ovarian transplant [14,21]. We therefore used the human granulosa cell line KGN to test which of the two vitrification solutions and their corresponding protocols, a selfmanufactured and a commercial one, yields better results with respect to cell viability and gene expression of genes involved in apoptosis and cellular temperature response. The viability of KGN cells after vitrification was determined with the help of FACs analyses. We found a significant difference in the amount of living cells between fresh cells (control) and vitrified cells independently of the protocol used. This finding points to a severe impact of the vitrification process in general to cell viability in our experiments. Similar finding were described by Da Croce and co-authors [7] in umbilical cord tissue showing that the vitrification process decrease cell viability about 35% of cells of the cord lining membrane and that samples of this umbilical cord tissue are still proliferating in cell culture experiments. Zeng and co-authors [43] demonstrates that the viability of carcinoma cells decreased from 72.7% in fresh tissue to 68.2% in vitrified tissue. In our experiments the amount of non-viable cells is 11% higher of cells treated according to P2 (26,0% vs. 37,1%) than in P1. This might be substantiated in different toxicological effects of DMSO and ethyleneglycol. For example, it was shown that DMSO has an effect on the methylation status of embryonic stem cells as well as on embryonic bodies [19]. In Addition, Santos and co-authors [35] summarized a plethora of cellular effects of DMSO like, reactive oxygen species scavanging, modulation of cell cycle, apoptosis and protein expression. Ethyleneglycol was considered to be embryotoxic at high concentration in mice and rat. However, it was not embryotoxic in rabbits, pointing to species related metabolic processes of ethyleneglycol [13]. In a recent article Azari and co-authors [1] described a higher expression of the maturation genes GDF9 and BMP15 after vitrification with a solely 4
Cryobiology xxx (xxxx) xxx–xxx
M. Kokotsaki et al.
Fig. 3. a. Quantitative PCR Analysis of genes related to apoptosis. The expression is shown as fold difference between genes normalized to 18sRNA expression of independent experiments. (n = 5, values are given as mean ± SEM, *p < 0.05). P1 are the values for gene expression of cells treated according to protocol 1, P2 are the values for gene expression of cells treated according to protocol 2. b. Quantitative PCR Analysis of genes sensitive to temperature. The expression is shown as fold difference between genes normalized to 18sRNA expression of independent experiments. (n = 5, values are given as mean ± SEM, *p < 0.05). P1 are the values for gene expression of cells treated according to protocol 1, P2 are the values for gene expression of cells treated according to protocol 2.
5. Conclusion
At the level of the ovary, TNF-alpha has been proposed as an intraovarian modulator of granulosa cell function and has been shown to alter ovarian steroidogenesis. Moreover, it is also a regulator of atresia and/or luteolysis [16,26]. Recently it has been shown, that TNF-alpha induces granulosa cell death of unruptured follicles via apoptosis and autophagy [41]. Together with our finding of a remarkable upregulation of TNF-alpha gene expression and a increment of non-vital granulosa cells after vitrification, this leads to the idea that one reason for the difficulties in regenerating ovarian function in OTB programs might be the activation of a TNF-alpha mediated pathway leading to apoptosis in the thawed and implanted tissue. As shown by many others the freezing- and thawing process in general, always involves cell damage independently from the use of either slow freezing or vitrification [6,17,42]. The appearance of apoptotic cells is therefore a general problem of this method of fertility preservation [33]. Our finding that the vitrification of granulosa cells occurs with an increased expression of TNF- alpha opens up the possibility that TNF-alpha inhibitors, such as etanercept (ETA) and infliximab (INF) might improve the survival of frozen cells.
We could show that human granulosa cells are damaged by various chemicals or procedures during vitrification and that the vitrificationthawing protocol differentially activates TNF-alpha gene expression which might lead to apoptosis of granulosa cells. Further research is necessary to investigate our idea of a potential influence of TNF-alpha inhibitors in ovarian tissue banking programs. Acknowledgment Human KGN cells were a friendly kind gift by K. Horling Department of Anatomy and Cell Biology, Martin Luther University Faculty of Medicine, Halle (Saale), Germany. The authors would like to thank R. Gessele for proofreading of the manuscript. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.cryobiol.2018.09.006. 5
Cryobiology xxx (xxxx) xxx–xxx
M. Kokotsaki et al.
References [1] M. Azari, M. Kafi, B. Ebrahimi, R. Fatehi, M. Jamalzadeh, Oocyte maturation, embryo development and gene expression following two different methods of bovine cumulus-oocyte complexes vitrification, Vet. Res. Commun. 41 (2017) 49–56. [2] L. Bastings, J.R. Westphal, C.C. Beerendonk, R.L. Bekkers, P.L. Zusterzeel, J.C. Hendriks, D.D. Braat, R. Peek, Clinically applied procedures for human ovarian tissue cryopreservation result in different levels of efficacy and efficiency, J. Assist. Reprod. Genet. 33 (2016) 1605–1614. [3] J. Becker, A. Walz, S. Daube, C. Keck, D. Pietrowski, Distinct responses of human granulosa lutein cells after hCG or LH stimulation in a spheroidal cell culture system, Mol. Reprod. Dev. 74 (2007) 1312–1316. [4] M.A. Bedaiwy, S.A. El-Nashar, A.M. El Saman, J.L. Evers, S. Sandadi, N. Desai, T. Falcone, Reproductive outcome after transplantation of ovarian tissue: a systematic review, Hum. Reprod. 23 (2008) 2709–2717. [5] V. Bianchi, G. Macchiarelli, A. Borini, M. Lappi, S. Cecconi, S. Miglietta, G. Familiari, S.A. Nottola, Fine morphological assessment of quality of human mature oocytes after slow freezing or vitrification with a closed device: a comparative analysis, Reprod. Biol. Endocrinol.: RBE (Rev. Bras. Entomol.) 12 (2014) 110. [6] A. Bissoyi, B. Nayak, K. Pramanik, S.K. Sarangi, Targeting cryopreservation-induced cell death: a review, Biopreserv. Biobanking 12 (2014) 23–34. [7] L. Da-Croce, G.H. Gambarini-Paiva, P.C. Angelo, E.A. Bambirra, A.C. Cabral, A.L. Godard, Comparison of vitrification and slow cooling for umbilical tissues, Cell Tissue Bank. 14 (2013) 65–76. [8] A. Dalman, N.S. Deheshkar Gooneh Farahani, M. Totonchi, R. Pirjani, B. Ebrahimi, M. Rezazadeh Valojerdi, Slow freezing versus vitrification technique for human ovarian tissue cryopreservation: an evaluation of histological changes, WNT signaling pathway and apoptotic genes expression, Cryobiology 79 (2017) 29–36. [9] A.D. Deitch, H. Law, R. deVere White, A stable propidium iodide staining procedure for flow cytometry, J. Histochem. Cytochem.: Off. J. Histochem. Soc. 30 (1982) 967–972. [10] J. Donnez, M.M. Dolmans, D. Demylle, P. Jadoul, C. Pirard, J. Squifflet, B. MartinezMadrid, A. van Langendonckt, Livebirth after orthotopic transplantation of cryopreserved ovarian tissue, Lancet 364 (2004) 1405–1410. [11] J. Donnez, M.M. Dolmans, Fertility preservation in women, N. Engl. J. Med. 377 (2017) 1657–1665. [12] G.D. Elliott, S. Wang, B.J. Fuller, Cryoprotectants: a review of the actions and applications of cryoprotective solutes that modulate cell recovery from ultra-low temperatures, Cryobiology 76 (2017) 74–91. [13] J. Fowles, M. Banton, J. Klapacz, H. Shen, A toxicological review of the ethylene glycol series: commonalities and differences in toxicity and modes of action, Toxicol. Lett. 278 (2017) 66–83. [14] M. Fransolet, L. Henry, S. Labied, A. Noel, M. Nisolle, C. Munaut, In vitro evaluation of the anti-apoptotic drug Z-VAD-FMK on human ovarian granulosa cell lines for further use in ovarian tissue transplantation, J. Assist. Reprod. Genet. 32 (2015) 1551–1559. [15] B. Han, D.J. Swanlund, J.C. Bischof, Cryoinjury of MCF-7 human breast cancer cells and inhibition of post-thaw recovery using TNF-alpha, Technol. Canc. Res. Treat. 6 (2007) 625–634. [16] T. Hojo, M.J. Siemieniuch, K. Lukasik, K.K. Piotrowska-Tomala, A.W. Jonczyk, K. Okuda, D.J. Skarzynski, Programmed necrosis - a new mechanism of steroidogenic luteal cell death and elimination during luteolysis in cows, Sci. Rep. 6 (2016) 38211. [17] C.J. Hunt, Cryopreservation: vitrification and controlled rate cooling, Meth. Mol. Biol. 1590 (2017) 41–77. [18] V. Isachenko, G. Rahimi, P. Mallmann, R. Sanchez, E. Isachenko, Technologies of cryoprotectant-free vitrification of human spermatozoa: asepticity as criterion of effectiveness, Andrology 5 (2017) 1055–1063. [19] M. Iwatani, K. Ikegami, Y. Kremenska, N. Hattori, S. Tanaka, S. Yagi, K. Shiota, Dimethyl sulfoxide has an impact on epigenetic profile in mouse embryoid body, Stem Cells (Dayton) 24 (2006) 2549–2556. [20] L. Janz Fde, A. Debes Ade, C. Cavaglieri Rde, S.A. Duarte, C.M. Romao, A.F. Moron, M. Zugaib, S.P. Bydlowski, Evaluation of distinct freezing methods and cryoprotectants for human amniotic fluid stem cells cryopreservation, J. Biomed. Biotechnol. 2012 (2012) 649353. [21] M. Kurus, C. Karakaya, M.H. Karalok, G. To, J. Johnson, The control of oocyte survival by intrinsic and extrinsic factors, Adv. Exp. Med. Biol. 761 (2013) 7–18. [22] P.E. Levi-Setti, P. Patrizio, G. Scaravelli, Evolution of human oocyte cryopreservation: slow freezing versus vitrification, Curr. Opin. Endocrinol. Diabetes Obes. 23 (2016) 445–450. [23] S. Maffei, M. Hanenberg, G. Pennarossa, J.R. Silva, T.A. Brevini, A. Arav, F. Gandolfi, Direct comparative analysis of conventional and directional freezing for the cryopreservation of whole ovaries, Fertil. Steril. 100 (2013) 1122–1131. [24] F.J. Mathias, F. D'Souza, S. Uppangala, S.R. Salian, G. Kalthur, S.K. Adiga, Ovarian tissue vitrification is more efficient than slow freezing in protecting oocyte and granulosa cell DNA integrity, Syst. Biol. Reprod. Med. 60 (2014) 317–322. [25] L.J. McKenzie, S.A. Pangas, S.A. Carson, E. Kovanci, P. Cisneros, J.E. Buster,
[26] [27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
[44]
[45]
6
P. Amato, M.M. Matzuk, Human cumulus granulosa cell gene expression: a predictor of fertilization and embryo selection in women undergoing IVF, Hum. Reprod. 19 (2004) 2869–2874. R. Meidan, R.A. Milvae, S. Weiss, N. Levy, A. Friedman, Intraovarian regulation of luteolysis, J. Reprod. Fertil. 54 (1999) 217–228 Supplement. Y. Nishi, T. Yanase, Y. Mu, K. Oba, I. Ichino, M. Saito, M. Nomura, C. Mukasa, T. Okabe, K. Goto, R. Takayanagi, Y. Kashimura, M. Haji, H. Nawata, Establishment and characterization of a steroidogenic human granulosa-like tumor cell line, KGN, that expresses functional follicle-stimulating hormone receptor, Endocrinology 142 (2001) 437–445. S.A. Nottola, E. Albani, G. Coticchio, M.G. Palmerini, C. Lorenzo, G. Scaravelli, A. Borini, P.E. Levi-Setti, G. Macchiarelli, Freeze/thaw stress induces organelle remodeling and membrane recycling in cryopreserved human mature oocytes, J. Assist. Reprod. Genet. 33 (2016) 1559–1570. D. Pietrowski, Y. Gong, M. Mairhofer, R. Gessele, M. Sator, Effects of progesterone and its metabolites on human granulosa cells, Hormone and metabolic research = Hormon- und Stoffwechselforschung = Hormones et metabolisme 46 (2014) 133–137. G. Rahimi, E. Isachenko, V. Isachenko, H. Sauer, M. Wartenberg, S. Tawadros, J. Hescheler, P. Mallmann, F. Nawroth, Comparison of necrosis in human ovarian tissue after conventional slow freezing or vitrification and transplantation in ovariectomized SCID mice, Reprod. Biomed. Online 9 (2004) 187–193. G. Rahimi, V. Isachenko, R. Kreienberg, H. Sauer, P. Todorov, S. Tawadros, P. Mallmann, F. Nawroth, E. Isachenko, Re-vascularisation in human ovarian tissue after conventional freezing or vitrification and xenotransplantation, Eur. J. Obstet. Gynecol. Reprod. Biol. 149 (2010) 63–67. L. Rienzi, C. Gracia, R. Maggiulli, A.R. LaBarbera, D.J. Kaser, F.M. Ubaldi, S. Vanderpoel, C. Racowsky, Oocyte, embryo and blastocyst cryopreservation in ART: systematic review and meta-analysis comparing slow-freezing versus vitrification to produce evidence for the development of global guidance, Hum. Reprod. Update 23 (2017) 139–155. E. Rimon, T. Cohen, A. Dantes, L. Hirsh, A. Amit, J.B. Lessing, S. Freimann, A. Amsterdam, F. Azem, Apoptosis in cryopreserved human ovarian tissue obtained from cancer patients: a tool for evaluating cryopreservation utility, Int. J. Oncol. 27 (2005) 345–353. M. Salehnia, M. Sheikhi, S. Pourbeiranvand, M. Lundqvist, Apoptosis of human ovarian tissue is not increased by either vitrification or rapid cooling, Reprod. Biomed. Online 25 (2012) 492–499. N.C. Santos, J. Figueira-Coelho, J. Martins-Silva, C. Saldanha, Multidisciplinary utilization of dimethyl sulfoxide: pharmacological, cellular, and molecular aspects, Biochem. Pharmacol. 65 (2003) 1035–1041. M. Sheikhi, K. Hultenby, B. Niklasson, M. Lundqvist, O. Hovatta, Clinical grade vitrification of human ovarian tissue: an ultrastructural analysis of follicles and stroma in vitrified tissue, Hum. Reprod. 26 (2011) 594–603. S. Silber, How ovarian transplantation works and how resting follicle recruitment occurs: a review of results reported from one center, Women's Health 12 (2016) 217–227. M.A. Smith, N.L. Seibel, S.F. Altekruse, L.A. Ries, D.L. Melbert, M. O'Leary, F.O. Smith, G.H. Reaman, Outcomes for children and adolescents with cancer: challenges for the twenty-first century, J. Clin. Oncol.: Off. J. Am. Soc. Clin. Oncol. 28 (2010) 2625–2634. N. Wang, C.Y. Li, H.B. Zhu, H.S. Hao, H.Y. Wang, C.L. Yan, S.J. Zhao, W.H. Du, D. Wang, Y. Liu, Y.W. Pang, X.M. Zhao, Effect of vitrification on the mRNA transcriptome of bovine oocytes, Reprod. Dom. Animals = Zuchthygiene 52 (2017) 531–541. T.R. Wang, J. Yan, C.L. Lu, X. Xia, T.L. Yin, X. Zhi, X.H. Zhu, T. Ding, W.H. Hu, H.Y. Guo, R. Li, L.Y. Yan, J. Qiao, Human single follicle growth in vitro from cryopreserved ovarian tissue after slow freezing or vitrification, Hum. Reprod. 31 (2016) 763–773. Y. Yamamoto, A. Kuwahara, Y. Taniguchi, M. Yamasaki, Y. Tanaka, Y. Mukai, M. Yamashita, T. Matsuzaki, T. Yasui, M. Irahara, Tumor necrosis factor alpha inhibits ovulation and induces granulosa cell death in rat ovaries, Reprod. Med. Biol. 14 (2015) 107–115. H.W. Youm, J.R. Lee, J. Lee, B.C. Jee, C.S. Suh, S.H. Kim, Optimal vitrification protocol for mouse ovarian tissue cryopreservation: effect of cryoprotective agents and in vitro culture on vitrified-warmed ovarian tissue survival, Hum. Reprod. 29 (2014) 720–730. M. Zeng, Q.R. Yang, G.B. Fu, Y. Zhang, X. Zhou, W.J. Huang, H.D. Zhang, W.J. Li, Z.Y. Wang, H.X. Yan, B. Zhai, Maintaining viability and characteristics of cholangiocarcinoma tissue by vitrification-based cryopreservation, Cryobiology 78 (2017) 41–46. X.G. Zhang, H. Li, J.H. Hu, Effects of various cryoprotectants on the quality of frozen-thawed immature bovine (Qinchuan cattle) calf testicular tissue, Andrologia 49 (2017). X.H. Zhou, D. Zhang, J. Shi, Y.J. Wu, Comparison of vitrification and conventional slow freezing for cryopreservation of ovarian tissue with respect to the number of intact primordial follicles: a meta-analysis, Medicine 95 (2016) e4095.