Impairment in motor learning of somatostatin null mutant mice

Brain Research 906 (2001) 107–114 www.elsevier.com / locate / bres

Research report

Impairment in motor learning of somatostatin null mutant mice Thomas Zeyda a ,1 , Nicole Diehl a ,2 , Richard Paylor b ,3 , Miles B. Brennan c , d, Ute Hochgeschwender * b

a Unit on Molecular Genetics, Clinical Neuroscience Branch, National Institute of Mental Health, Bethesda, MD 20892, USA Section on Behavioral Neuropharmacology, Experimental Therapeutics Branch, National Institute of Mental Health, Bethesda, MD 20892, USA c Eleanor Roosevelt Institute, Denver, CO 80206, USA d Developmental Biology Program, Oklahoma Medical Research Foundation, 825 NE 13 th Street, MS 49, Oklahoma City, OK 73104, USA

Accepted 10 April 2001

Abstract Somatostatin was first identified as a hypothalamic factor which inhibits the release of growth hormone from the anterior pituitary (somatotropin release inhibitory factor, SRIF). Both SRIF and its receptors were subsequently found widely distributed within and outside the nervous system, in the adult as well as in the developing organism. Reflecting this wide distribution, somatostatin has been implicated regulating a diverse array of biological processes. These include body growth, homeostasis, sensory perception, autonomous functions, rate of intestinal absorption, behavior, including cognition and memory, and developmental processes. We produced null mutant mice lacking somatostatin through targeted mutagenesis. The mutant mice are healthy, fertile, and superficially indistinguishable from their heterozygous and wildtype littermates. A ‘first round’ phenotype screen revealed that mice lacking somatostatin have elevated plasma growth hormone levels, despite normal body size, and have elevated basal plasma corticosterone levels. In order to uncover subtle and unexpected differences, we carried out a systematic behavioral phenotype screen which identified a significant impairment in motor learning revealed when increased demands were made on motor coordination. Motor coordination and motor learning require an intact cerebellum. While somatostatin is virtually absent from the adult cerebellum, the ligand and its receptor(s) are transiently expressed at high levels in the developing cerebellum. This result suggests the functional significance of transient expression of SRIF and its receptors in the development of the cerebellum.  2001 Elsevier Science B.V. All rights reserved. Theme: Neurotransmitters, modulators, transporters, and receptors Topic: Peptides: anatomy and physiology Keywords: Targeted disruption; Mouse mutant; Motor learning; Cerebellum; Development; Growth hormone

1. Introduction Somatostatin was originally isolated from bovine hypothalamus as a somatotropin release inhibitory factor (SRIF) [6,26]. Its anatomic distribution extends far beyond the hypothalamus, both within and outside the nervous system

*Corresponding author. Tel.: 11-405-271-7318; fax: 11-405-2717220. E-mail address: [email protected] (U. Hochgeschwender). 1 Present address: Max-Planck-Institute for Experimental Medicine, Goettingen, Germany. 2 Present address: Wyeth-Ayerst Research, Chazy, NY 12921, USA. 3 Present address: Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030, USA.

[23,37,38]. Experimental results and the anatomical distribution of SRIF are compatible with a multitude of functions, which can be grouped roughly into those of neurohormone, neurotransmitter / modulator, and paracrine / autocrine agent (for review see Refs. [37,40] and references therein). The physiological actions of SRIF are mediated by high affinity receptors on the surface of responsive cells coupled by G-proteins to multiple effector systems [39]. So far five SRIF receptor genes and / or cDNAs have been cloned and sequenced [3,30,42]. The receptor subtypes are distinguished by their affinities for SRIF analogs [7]. The five receptors are distributed in distinct, but overlapping patterns in the brain and in peripheral tissues [48]. As a neurohormone, SRIF inhibits the release of growth

0006-8993 / 01 / $ – see front matter  2001 Elsevier Science B.V. All rights reserved. PII: S0006-8993( 01 )02563-X

108

T. Zeyda et al. / Brain Research 906 (2001) 107 – 114

hormone from the pituitary. It specifically mediates the inhibition of growth hormone release due to stress or starvation [1,44] and influences sleep-induced hormonal rhythms [36]. Furthermore, it inhibits the release of thyrotropin [12]. SRIF fits the definition of a neurotransmitter: it is present in nerve terminals, is released by depolarization, is recovered in synaptosomes and synaptic vesicles, undergoes calcium dependent release from synaptosomes, and is rapidly degraded by peptidases [36]. In the nervous system, the effect of exogenous SRIF on behavior is one of general arousal, decreased sleep, excessive grooming and exploring, and analgesia [37,38]. Outside the nervous system SRIF acts as an autocrine / paracrine regulator (for review see Ref. [34]). In the pancreas it inhibits secretion of insulin, glucagon, and SRIF itself. In the gut it can inhibit intestinal hormone secretion as well as exocrine secretions of the gut. It impairs the motility of the stomach, gallbladder, and small intestine, and reduces the blood flow to the intestine. In addition to its effects on the adult organism, there is evidence that SRIF is important during development. High evolutionary conservation of SRIF [5], early onset of expression in ontogeny [21], transient expression patterns during development [4,14], and morphogenic effects in vitro [8], strongly suggest a developmental role for this molecule. The patterns of SRIF receptor expression during development generally parallel the regional SRIF gene expression [28]. In order to determine the actual involvement of SRIF in the developing and adult organism, we undertook a mutational analysis of SRIF in the mouse.

2. Materials and methods

2.1. Mutation of the pre-prosomatostatin gene The mouse SRIF gene [15] was isolated from a 129Sv genomic phage library (Lambda FIX, Stratagene) using a SRIF cDNA as a probe. The 1.3-kb PstI-fragment was placed upstream and the 4.7-kb PstI-BglII fragment was placed downstream of the SV40 E -tk P -neo cassette, pAB5. Insertion of the selection cassette deleted the last 30 basepairs of exon 1 and the first 39 basepairs of intron 1. Electroporation and G418 selection of J1 [29] embryonic stem cell clones was performed according to standard procedures [33]. Colonies were screened for homologous integration by PCR, using primers 59 of the start of the targeting vector (MSST2: 59 GAATGGTGTCAGAATGCACC) and from the neo cassette (MB4: 59 TCCACACCCTAACTGACACAC). Clones with the expected rearrangement at the targeted locus were injected into C57Bl / 6 blastocysts. The third line injected transmitted through the germline. Chimeric males were mated

to 129Sv wildtype females (129SvEv-Tac, Taconic) to keep the mutation in an isogenic background.

2.2. Histological analyses Tissues were collected from animals perfused with 10% buffered formalin and placed in 20 vol. of 10% buffered formalin. Fixed tissues were embedded in paraffin blocks, sectioned, and stained using standard methods by American Histolabs (Gaithersburg, MD).

2.3. Chemical analyses Brain tissue was extracted by homogenizing in 2 N acetic acid, followed by lyophilizing and reconstituting in RIA buffer [22]. Blood was collected at noon from the retro-orbital sinus, heparinized, spun and the plasma was flash-frozen in liquid nitrogen. RIAs were done using the Incstar somatostatin RIA kit, the Amersham rat growth hormone RIA kit and the ICN rat corticosterone RIA kit. Analyses of mouse thyroxin and glucose were carried out by Anilytics, Gaithersburg, MD.

2.4. Behavioral analyses Mice were housed in a SPF (specific pathogen free) facility, on a 12-h dark–light cycle, with free access to food and water. All experiments were done in compliance with NIMH ACUC guidelines. A total of ten wildtype animals (seven male and three female) and 15 mutants (eight male and seven female) were tested when they were 8–16 weeks old. Several parts of the behavioral test battery were carried out as described: motor and sensory reflexes, open-field activity, and light / dark exploration test [9], acoustic startle and prepulse inhibition [31], and the conditioned fear test [32]. The rotarod (rod diameter, 30 mm) was a UGO Basile Accelerating rotarod for mice (model 7650, Stoelting). Mice were given three consecutive trials (intertrial interval, 1 h) with the rotarod adjusted to accelerate from 4 to 40 rpm over a 5-min period. Time on the rotarod was measured. Mice (five wildtype and ten mutants) were also tested using the rotarod adjusted to maintain a constant speed of 12 rpm for the entire 5-min test period. For the wire-hang test, the forepaws of a mouse were placed on a single wire (1 mm diameter). The wire was elevated and the suspension time (maximum 60 s) was measured. In the vertical pole test a mouse is placed facing up on a cloth-tape covered pole (1.9 cm diameter, 43 cm long). The end of the pole is lifted to a vertical position and the time a mouse stays on the pole is recorded. These values are converted to a pole test score: 0, fell before pole reached 458 angle; 1, fell before pole reached 908 angle; 2, fell 0–10 s; 3, fell 11–20 s; 4, fell 21–30 s; 5, fell 31–40 s; 6, fell 41–50 s; 7, fell 51–60 s; 8, stayed on 60 s and climbed halfway down pole; 9, stayed on 60 s and climbed to lower half of pole; 10, climbed

T. Zeyda et al. / Brain Research 906 (2001) 107 – 114

down and off in 51–60 s; 11, climbed down and off in 41–50 s; 12, climbed down and off in 31–40 s; 13, climbed down and off in 21–30 s; 14, climbed down and off in 11–20 s; 15, climbed down and off in 1–10 s. Two-way analyses of variance, Student’s t-tests, and Mann–Whitney U-tests were used to determine if data from wildtype and SRIF-deficient mice were significantly different (P,0.05).

3. Results

3.1. Generation of SRIF-deficient mice We mutated the SRIF gene in 129 / Sv embryonic stem cells by homologous recombination using a targeting vector in which the coding region of the preprohormone gene was disrupted by deleting the last ten codons of the first exon and inserting a neomycin selection cassette (Fig. 1A). The correct recombination of the mutant allele was confirmed by Southern blotting, using SRIF and neo gene fragments as probes (not shown). Chimeric mice transmitting the mutated allele through the germline were mated to

Fig. 1. Targeted disruption of the SRIF gene in mice. (A) Schematic representation of the SRIF targeting construct, wildtype allele, and targeted allele. Open boxes are the two exons, filled box is the neomycin resistance cassette. B, BglII; H, HindIII; P, PstI. (B) Southern blot analysis of HindIII-digested tail DNA from littermates of a heterozygotes cross. The probe was the HindIII fragment indicated in (A). (C) Northern blot analysis of SRIF mRNA of brain from littermates of a heterozygotes cross. The blot was reprobed with labeled cyclophilin DNA [10] as control for even loading. (D) Somatostatin peptide levels (mean1S.E.M.) in midbrain extracts as determined by radioimmunoassay from three animals of each genotype.

109

129 / Sv wildtype mice, resulting in the generation of strain 129 / Sv-Srif tm 1 ute , which maintains the mutation on a homogeneous genetic background. Heterozygous offspring were mated to generate mutant mice (Fig. 1B). The absence of SRIF transcripts was confirmed by Northern blotting (Fig. 1C) and by in situ hybridization on brain tissue, using probes included in the deleted sequence of exon 1 (not shown). The lack of peptide was confirmed by RIA on midbrain extracts (Fig. 1D). Mutant mice were born at the frequency expected for a recessive mutation. They are viable, healthy, and fertile and show no overt behavioral abnormalities. Morphological abnormalities were not detected in serial sections of the brain or in other organs (not shown). Using Northern analysis we found that SRIF receptor transcripts were unchanged (not shown). Autoradiographic analyses with 125 I-SRIF revealed no differences in receptor binding (not shown).

3.2. Endocrinological analysis of SRIF-deficient mice SRIF was initially isolated on the basis of its ability to inhibit release of growth hormone from the anterior pituitary. We determined the plasma growth hormone levels in mutant and wildtype mice and found a threefold higher level in mice lacking SRIF (Fig. 2A). The elevated plasma growth hormone level did not, however, result in increased body weight (Fig. 2B). This is not surprising in light of the results in transgenic mice expressing elevated plasma levels of growth hormone [19]. Here the minimum elevation of plasma growth hormone to result in increased body growth was sevenfold. While SRIF clearly inhibits the release of growth hormone, it does not seem to be a critical factor in regulating body growth, at least not in laboratory conditions. The roles of SRIF with respect to growth hormone regulation in other situations (for example stress [1], or starvation [44]) remain to be determined. In acute and chronic stress growth hormone secretion is suppressed through increased SRIF release in the hypothalamus stimulated by corticotropin-releasing hormone and glucocorticoids [17]. Interestingly, when we measured corticosterone levels in SRIF null mutants, basal levels were significantly elevated compared to wildtype littermates (Fig. 2C). In addition to inhibiting the release of growth hormone, SRIF has been shown to inhibit the release of thyroid stimulating hormone from the anterior pituitary [12]. Radioimmunoassay for thyroxin (T4) revealed similar plasma levels in mutant mice compared to wildtype littermates (Fig. 2D). SRIF inhibits the release of insulin from islet cells in the pancreas [16]. Plasma levels of glucose, however, were not significantly changed in mutant mice (Fig. 2E). Concerning the endocrinological actions of SRIF, as far as they have been tested here, a lack of SRIF does not seem to lead to any measurable functional differences under standard laboratory conditions.

110

T. Zeyda et al. / Brain Research 906 (2001) 107 – 114

Fig. 2. Endocrine effect in SRIF-deficient mice. (A) Plasma levels of growth hormone (mean1S.E.M.) as determined by radioimmunoassay in wildtype (n510) and mutant (n511) mice. (B) Body weight of 3- to 4-month-old wildtype (n510) and mutant (n510) mice. (C) Plasma levels of corticosterone as determined by radioimmunoassay in age-matched wildtype (n54) and mutant (n54) male mice. Plasma levels of age-matched wildtype (n58) and mutant (n58) mice of thyroxin (T4) (D) as determined by radioimmunoassay, and of glucose (E) as determined on a Hitachi 717 Glucose Analyzer.

3.3. Behavioral analysis of SRIF-deficient mice The inference that SRIF has central nervous actions is based on its wide anatomical distributions in the CNS and on a variety of in vivo experiments in which increases or decreases in exogenous SRIF resulted in changes in behaviors such as feeding, pain perception, sleep, and memory [41]. These studies led to conflicting conclusions which probably result from different experimental conditions used and the complexities of the behaviors. Rather than testing each specific hypothesis derived from these experiments, we used a behavioral ‘test battery’ to assess a number of neurological and neuropsychological functions [9], including simple motor and sensory reflexes, locomotor activity, anxiety-related responses, sensorimotor gating, and learning and memory. SRIF-deficient mice were significantly impaired on a test of motor performance, the accelerating rotarod. The performance and behavior of mutant mice was not significantly different from wildtype littermates on any other test (Table 1). Fig. 3A displays the mutant and wildtype data from the accelerating rotarod test. SRIF-deficient mice were able to maintain their balance similarly to wildtype controls on the first two trials of the rotarod test. Wildtype mice, however, showed a significant improvement from trial 2 to trial 3, and were able to stay on the rotarod significantly longer than the mutant mice on the third trial. There was no improvement in mutant mice from trial 2 to trial 3. These findings indicate that the maximum performance of mutant mice is well below that of wildtype mice. There are several possible explanations for the observed impairment. First, mutant mice may have an impairment of motor coordination. This explanation is unlikely since the performance of mutant mice was similar to that of wildtype mice on the first two trials of the accelerating rotarod test. In addition, mutant mice performed similarly to wildtype mice on the vertical pole test (Fig. 3C). This test requires coordinated movements to hold onto the pole, and

to turn around and walk down the pole. We conclude that simple coordination per se is not a problem. Second, mutant mice may not be able to stay on the rotarod, at any speed, for long periods of time due to fatigue. This explanation is also unlikely because in the constant speed rotarod test, mutant mice were able to stay on the rotarod far longer than they did during the accelerating rotarod test, and did not differ from the wildtype controls. These findings demonstrate that mutant mice can stay on the rotarod for long periods of time indicating that the impairment in the accelerating rotarod test is not the result of fatigue. Similarly, on the wire hang test, mutant mice were just as capable as wildtype mice of holding their body weight for the time tested (Fig. 3B). The present data are consistent with the hypothesis that the impairment of mutant mice on the accelerating rotarod to reach the same level of performance as the wildtype mice may result from a motor learning impairment. That is, the mutant mice have difficulty learning to coordinate their movements in order to maintain their balance on the rotarod as the demands of the task continue to increase. Motor coordination, i.e. performing compound movements smoothly, and motor learning, i.e. the ability to adapt motor coordination to changes in task demands, are generally thought of as two functions of the cerebellum. It is very difficult to dissociate these two processes and a defect in either of them, or in both, could result in impaired performance on the accelerating rotarod. Further experiments testing discrete motor learning, such as adaptation of the vestibuloocular reflex and classical conditioning of the eyeblink response [35], should increase our understanding of the nature of the impairment in SRIF mutant mice. Furthermore, in addition to the cerebellum, motor learning might involve other neuroanatomical systems including motor cortex, somatosensory cortex, and ventrolateral nucleus of the thalamus [2]. Functional differences in any one of these sites may contribute to the motor learning impairment seen in SRIF-deficient mice.

T. Zeyda et al. / Brain Research 906 (2001) 107 – 114

111

Table 1 Behavioral test results of wildtype and SRIF-deficient mutant mice Category

Test

Measure

Wildtype, %

Mutant, %

Basic neurological function

Cage observations (% of subjects showing behavior)

Wild running Freezing Sniffing Rearing Jumping Defecation Urination

0 0 100 100 0 67 33

0 0 100 100 0 40 50

Reflexes (% of subjects showing normal reflex)

Body adjustment in moving cage Righting Eye-blink Ear twitch Whisker orientation

100 100 100 100 100

100 100 100 100 100

100

100

Mean (6S.E.M.)

Mean (6S.E.M.)

Latency to edge Explorations (nose pokes over edge)

4.1 (2.2) 7.4 (1.5)

5.5 (1.9) 5.5 (1.2)

P.0.6 P.0.3

30-Min totals Locomotor activity Rearing

3255 (290.4) 63.8 (18.8)

2760.3 (331.5) 27.9 (11.2)

P.0.08 P.0.08

Open-field

% Distance in center

8.7 (2.3)

5.3 (2.1)

P.0.3

Light-dark exploration test

Latency to enter dark Time in dark Transitions

9.2 (3.6) 454 (31.8) 30.4 (6.0)

11 (3) 527 (23.2) 16.9 (4.7)

P.0.6 P.0.08 P.0.1

Acoustic startle response

Startle amplitude

1558.7 (177.6)

1492.1 (139.5)

P.0.5

Prepulse inhibition

Average % inhibition (using 74-, 78-, 82-, 86- and 90-dB prepulse sounds)

55.7 (5.1)

50.7 (2.9)

P.0.35

Conditioned fear

Contextual fear conditioning Auditory-cue fear conditioning

26 (7.6) 32.8 (3.9)

20.9 (4.3) 38.5 (5.4)

P.0.4 P.0.4

Visual reaching (% of subjects showing normal reflex)

Behavior on elevated platform

Open-field exploratory activity

Anxiety related behaviours

Sensorimotor responses

Learning and memory

Morphologically, the adult cerebellum is indistinguishable in the two genotypes (Fig. 3E). This is not too surprising, as even mutant mice with more severe cerebellar impairments, such as ataxia and tremor, do not necessarily show any light [25] or even electronmicroscopic [24] differences compared to wildtype mice. However, a more detailed histological analysis employing different stains for individual cell populations and fiber systems, might reveal differences.

4. Discussion The finding that after a ‘first round’ screen for a phenotype in the SRIF null mouse the cerebellum is the primary site of origin for an observable behavioral differ-

ence is intriguing. In the adult murine cerebellum expression of SRIF and its receptors is barely detectable. In the developing cerebellum, however, both SRIF [46] and its receptor [47] are expressed at high levels. SRIF can be found in Purkinje cells, Golgi cells, and climbing fibers, while receptor binding sites are found in the immature granule cells of the external germinal layer. Both ligand and receptors virtually disappear with the cessation of neurogenesis in the cerebellum. The physiological significance of this transient expression of the somatostatinergic system during histogenesis of the cerebellum has been a matter of speculation. It has been proposed that SRIF acts as a trophic factor [43], or is involved in the regulation of proliferation and / or migration of neuroblasts during the development of the cerebellar cortex [18]. Our study suggests that the transient expression of SRIF during brain

112

T. Zeyda et al. / Brain Research 906 (2001) 107 – 114

Fig. 3. Impaired cerebellar function in SRIF-deficient mice. (A) Accelerating rotarod test. The performance of wildtype mice improves significantly each trial, but for SRIF-deficient mice performance only improves from trial 1 to trial 2 (F(2,46)53.335, P,0.045). In addition, wildtype mice spend significantly more time on the rotarod compared to SRIF-deficient mice in trial 3 (F(1,23)54.813, P,0.04). (B) Constant speed (12 rpm) rotarod test. Performance on the constant speed test is not different between wildtype and SRIF-deficient mice (P.0.94). (C) Wirehang test. The ability to hang from a single wire was similar between wildtype and mutant mice (P.0.34). (D) Vertical pole test. Wildtype and mutant mice had similar vertical pole test scores (P.0.107). (E) Hematoxylin-eosin stain of adult cerebellum. Mutant mice show the same characteristic layering of cells in the cerebellar cortex as wildtype mice.

development is functionally relevant. Further studies are needed to unravel how SRIF contributes to the development of a functioning cerebellum.

The SRIF gene is expressed from gestational day 3.5 in mouse (unpublished observation), and transient expression occurs in a number of developing brain structures [14]. The fact that we observed a change in cerebellar function in the SRIF null mouse, but not in any other system, may be due to the fact that the cerebellum is a much simpler structure than most other parts of the brain. Developmental aberrations in other brain regions may be more easily compensated for by adaptive changes during development, and therefore more difficult to pick up in laboratory test settings. Cysteamine, a drug which selectively depletes the body of SRIF, causes impairments in open-field activity [45] and learning tests [13] in adult rats, as well as a decrease in the amplitude of the acoustic startle response during postnatal development in rats [27]. In our genetically SRIF-depleted mice we do not see these impairments. A possible explanation for these differences is, besides pleiotropic, possibly toxic actions of the drug, the time of onset of the SRIF depletion, i.e. onset of development versus postnatal development or adult stage, respectively. The lack of overt behavioral effects in SRIF null mice could have a number of reasons. First, effects on other behaviors may be partially compensated for by adaptive changes during development, and thus might be more difficult to pick up in laboratory test settings. Second, other ligands with overlapping specificities might bind to the somatostatin receptors and again push dysfunctioning below the level detectable in the limited laboratory environment. One such candidate ligand would be cortistatin [11], a peptide which shares 11 out of 14 amino acids with SRIF, binds and activates SRIF receptors in vitro and is distributed in the brain in partially overlapping patterns with SRIF. Cortistatin mRNA levels in brain were not changed in mutant versus wildtype mice as assessed by Northern blots (not shown). There are also a number of behavioral categories, such as sleep and circadian rhythm, which we have not yet tested and which might reveal impairments in mutant versus wildtype mice. It is astounding that there are no profound endocrinological deficits in a mouse lacking a factor originally discovered for its endocrinological properties. This suggests that in the in vivo situation neuropeptides are involved in more intricate functional networks as those which have been extrapolated from the assays they were originally defined by. It also suggests that our assays for defining phenotypes need to be extended to include testing under more ‘natural’ conditions, i.e. under more stressful conditions. Our finding that absence of SRIF affects cerebellar function is consistent with the hypothesis, long held but untested, that the transient expressions of neuropeptides play important roles in neural development [20]. The challenge raised by the SRIF knockout and indeed by any knockout mice with behavioral phenotypes is correlating the behavioral change with a morphological or physiological change.

T. Zeyda et al. / Brain Research 906 (2001) 107 – 114

Acknowledgements We thank Mary Flynn for artwork, Dr Brian Martin for oligonucleotide synthesis, Dr J. Gregor Sutcliffe for the cortistatin probe, Andrea Becker for plasmid pAB5, and Dr Edward I. Ginns for support of the project.

References [1] A. Arimura, W.D. Smith, A.V. Schally, Blockade of the stressinduced decrease in blood GH by anti-somatostatin serum in rats, Endocrinology 98 (1976) 540–543. [2] H. Asanuma, C. Pavlides, Neurobiological basis of motor learning in mammals, Neuroreport 8 (1997) i–vi. [3] G. Bell, K. Yasuda, H. Kong, S.F. Law, K. Raynor, T. Reisine, Molecular biology of somatostatin receptors, in: D. Chadwick, G. Cardew (Eds.), Somatostatin and Its Receptors, Wiley, New York, 1995, pp. 65–79. [4] C. Bendotti, C. Hohmann, G. Forloni, R. Reeves, J.T. Coyle, M.L. Oster-Granite, Developmental expression of somatostatin in mouse brain. II. In situ hybridization, Brain Res. Dev. Brain Res. 53 (1990) 26–39. [5] M. Berelowitz, D. LeRoith, H. von Schenk, C. Newgard, M. Szabo, L.A. Frohman, J. Shiloach, J. Roth, Somatostatin-like immunoactivity and biological activity is present in Tetrahymena pyriformis, a ciliated protozoan, Endocrinology 110 (1982) 1939–1944. [6] P. Brazeau, W. Vale, R. Burgus, N. Ling, M. Butcher, J. Rivier, R. Guillemin, Hypothalamic polypeptide that inhibits the secretion of immunoreactive pituitary growth hormone, Science 179 (1973) 77–79. [7] C. Bruns, G. Weckbecker, F. Raulf, H. Luebbert, D. Hoyer, Characterization of somatostatin receptor subtypes, in: D. Chadwick, G. Cardew (Eds.), Somatostatin and Its Receptors, Wiley, New York, 1995, pp. 89–100. [8] A.G. Bulloch, Somatostatin enhances neurite outgrowth and electrical coupling of regenerating neurons in Helisoma, Brain Res. 412 (1987) 6–17. [9] J.N. Crawley, R. Paylor, A proposed test battery and constellations of specific behavioral paradigms to investigate the behavioral phenotypes of transgenic and knockout mice, Horm. Behav. 31 (1997) 197–211. [10] P.E. Danielson, S. Forss-Petter, M.A. Brow, L. Calavetta, J. Douglass, R.J. Milner, J.G. Sutcliffe, p1b15: a cDNA clone of the rat mRNA encoding cyclophilin, DNA 7 (1988) 261–267. [11] L. de Lecea, J.R. Criado, O. Prospero-Garcia, K.M. Gautvik, P. Schweitzer, P.E. Danielson, C.L. Dunlop, G.R. Siggins, S.J. Henriksen, J.G. Sutcliffe, A cortical neuropeptide with neuronal depressant and sleep-modulating properties, Nature 381 (1996) 242–245. [12] L. Ferland, F. Labrie, M. Jobin, A. Arimura, A.V. Schally, Physiological role of somatostatin in the control of growth hormone and thyrotropin secretion, Biochem. Biophys. Res. Commun. 68 (1976) 149–156. [13] L.W. Fitzgerald, C.P. Dokla, Morris water task impairment and hypoactivity following cysteamine-induced reductions of somatostatin-like immunoreactivity, Brain Res. 505 (1989) 246–250. [14] G. Forloni, C. Hohmann, J.T. Coyle, Developmental expression of somatostatin in mouse brain. I. Immunocytochemical studies, Brain Res. Dev. Brain Res. 53 (1990) 6–25. [15] G. Fuhrmann, R. Heilig, J. Kempf, A. Ebel, Nucleotide sequence of the mouse preprosomatostatin gene, Nucleic Acids Res. 18 (1990) 1287. [16] J.E. Gerich, Somatostatin and diabetes, Am. J. Med. 70 (1981) 619–626.

113

[17] G. Gillies, Somatostatin: the neuroendocrine story, Trends Pharmacol. Sci. 18 (1997) 87–95. [18] B. Gonzalez, P. Leroux, M. Lamacz, C. Bodenant, R. Balazs, H. Vaudry, Somatostatin receptors are expressed by immature cerebellar granule cells: evidence for a direct inhibitory effect of somatostatin on neuroblast activity, Proc. Natl. Acad. Sci. USA 89 (1992) 9627–9631. [19] R.E. Hammer, R.L. Brinster, M.G. Rosenfeld, R.M. Evans, K.E. Mayo, Expression of human growth hormone-releasing factor in transgenic mice results in increased somatic growth, Nature 315 (1985) 413–416. [20] G.E. Handelmann, Neuropeptide effects on brain development, J. Physiol. (Paris) 80 (1985) 268–274. [21] V. Heidet, A. Faivre-Bauman, C. Kordon, C. Loudes, S. Rasolonjanahary, J. Epelbaum, Functional maturation of somatostatin neurons and somatostatin receptors during development of mouse hypothalamus in vivo and in vitro, Brain Res. Dev. Brain Res. 57 (1990) 85–92. [22] J.S. Hong, K. Yoshikawa, R.W. Hendren, Measurement of betaendorphin and enkephalins in biological tissues and fluids, Methods Enzymol. 103 (1983) 547–564. [23] O. Johansson, T. Hokfelt, R.P. Elde, Immunohistochemical distribution of somatostatin-like immunoreactivity in the central nervous system of the adult rat, Neuroscience 13 (1984) 265–339. [24] M. Kano, K. Hashimoto, C. Chen, A. Abeliovich, A. Aiba, H. Kurihara, M. Watanabe, Y. Inoue, S. Tonegawa, Impaired synapse elimination during cerebellar development in PKC gamma mutant mice, Cell 83 (1995) 1223–1231. [25] N. Kashiwabuchi, K. Ikeda, K. Araki, T. Hirano, K. Shibuki, C. Takayama, Y. Inoue, T. Kutsuwada, T. Yagi, Y. Kang et al., Impairment of motor coordination, Purkinje cell synapse formation, and cerebellar long-term depression in GluR delta 2 mutant mice, Cell 81 (1995) 245–252. [26] L. Krulich, A.P. Dhariwal, S.M. McCann, Stimulatory and inhibitory effects of purified hypothalamic extracts on growth hormone release from rat pituitary in vitro, Endocrinology 83 (1968) 783–790. [27] M. Kungel, M. Koch, E. Friauf, Cysteamine impairs the development of the acoustic startle response in rats: possible role of somatostatin, Neurosci. Lett. 202 (1996) 181–184. [28] P. Leroux, C. Bodenant, E. Bologna, B. Gonzalez, H. Vaudry, Transient expression of somatostatin receptors in the brain during development, in: D. Chadwick, G. Cardew (Eds.), Somatostatin and Its Receptors, Wiley, New York, 1995, pp. 127–136. [29] E. Li, T.H. Bestor, R. Jaenisch, Targeted mutation of the DNA methyltransferase gene results in embryonic lethality, Cell 69 (1992) 915–926. [30] A.L. Lublin, N.L. Diehl, U. Hochgeschwender, Isolation and characterization of the gene encoding the type 5 mouse (Mus musculus) somatostatin receptor (msst5), Gene 195 (1997) 63–66. [31] R. Paylor, J.N. Crawley, Inbred strain differences in prepulse inhibition of the mouse startle response, Psychopharmacology (Berl.) 132 (1997) 169–180. [32] R. Paylor, R. Tracy, J. Wehner, J.W. Rudy, DBA / 2 and C57BL / 6 mice differ in contextual fear but not auditory fear conditioning, Behav. Neurosci. 108 (1994) 810–817. [33] R. Ramirez-Solis, A.C. Davis, A. Bradley, Gene targeting in embryonic stem cells, Methods Enzymol. 225 (1993) 855–878. [34] S. Raptis, W. Schlegel, E.E. Pfeiffer, Effects of somatostatin on gut and pancreas, in: S. Bloom (Ed.), Gut Hormones, Livingstone, Edinburgh, 1978, pp. 446–452. [35] J.L. Raymond, S.G. Lisberger, M.D. Mauk, The cerebellum: a neuronal learning machine?, Science 272 (1996) 1126–1131. [36] S. Reichlin, Somatostatin, in: D. Krieger, M. Brownstein, J.B. Martin (Eds.), Brain Peptides, Wiley, New York, 1982, pp. 712–752. [37] S. Reichlin, Somatostatin, N. Engl. J. Med. 309 (1983) 1495–1501. [38] S. Reichlin, Somatostatin (second of two parts), N. Engl. J. Med. 309 (1983) 1556–1563.

114

T. Zeyda et al. / Brain Research 906 (2001) 107 – 114

[39] T. Reisine, D. Woulfe, K. Raynor, H. Kong, J. Heerding, J. Hines, M. Tallent, S. Law, Interaction of somatostatin receptors with G proteins and cellular effector systems, in: D. Chadwick, G. Cardew (Eds.), Somatostatin and Its Receptors, Wiley, New York, 1995, pp. 160–166. [40] T. Reisine, Somatostatin, Cell. Mol. Neurobiol. 15 (1995) 597–614. [41] D. Rubinow, C.L. Davis, R.M. Post, Somatostatin in neuropsychiatric disorders, Prog. Neuropsychopharmacol. Biol. Psychiatry 12 (1988) S137–155. [42] W. Schwabe, M.B. Brennan, U. Hochgeschwender, Isolation and characterization of the mouse (Mus musculus) somatostatin receptor type-4-encoding gene (mSSTR4), Gene 168 (1996) 233–235. [43] T. Taniwaki, J.P. Schwartz, Somatostatin enhances neurofilament expression and neurite outgrowth in cultured rat cerebellar granule cells, Brain Res. Dev. Brain Res. 88 (1995) 109–116. [44] G.S. Tannenbaum, J. Epelbaum, E. Colle, P. Brazeau, J.B. Martin, Antiserum to somatostatin reverses starvation-induced inhibition of

[45]

[46]

[47]

[48]

growth hormone but not insulin secretion, Endocrinology 102 (1978) 1909–1914. L. Vecsei, R. Ekman, C. Alling, E. Widerlov, Influence of cysteamine and cysteine on open-field behaviour, and on brain concentrations of catecholamines, somatostatin, neuropeptide Y, and corticotropin releasing hormone in the rat, J. Neural Transm. Gen. Sect. 78 (1989) 209–220. M.J. Villar, T. Hokfelt, J.C. Brown, Somatostatin expression in the cerebellar cortex during postnatal development. An immunohistochemical study in the rat, Anat. Embryol. (Berl.) 179 (1989) 257–267. C. Viollet, C. Bodenant, C. Prunotto, D. Roosterman, J. Schaefer, W. Meyerhof, J. Epelbaum, H. Vaudry, P. Leroux, Differential expression of multiple somatostatin receptors in the rat cerebellum during development, J. Neurochem. 68 (1997) 2263–2272. I. Wulfsen, W. Meyerhof, S. Fehr, D. Richter, Expression patterns of rat somatostatin receptor genes in pre- and postnatal brain and pituitary, J. Neurochem. 61 (1993) 1549–1552.