Importance of PPARα for the effects of growth hormone on hepatic lipid and lipoprotein metabolism

Growth Hormone & IGF Research 17 (2007) 154–164 www.elsevier.com/locate/ghir

Importance of PPARa for the effects of growth hormone on hepatic lipid and lipoprotein metabolism Anna Ljungberg a,b, Daniel Linde´n a,d, Caroline Ame´en Go¨ran Bergstro¨m c, Jan Oscarsson a,b,d,*

a,b

,

a

c

Wallenberg Laboratory for Cardiovascular Research, The Sahlgrenska Academy at Go¨teborg University, SE-413 45 Go¨teborg, Sweden b Department of Physiology, The Sahlgrenska Academy at Go¨teborg University, SE-413 45 Go¨teborg, Sweden Department of Clinical Physiology, Cardiovascular Institute, The Sahlgrenska Academy at Go¨teborg University, SE-413 45 Go¨teborg, Sweden d AstraZeneca R&D, SE-431 83 Mo¨lndal, Sweden Received 14 August 2006; revised 5 January 2007; accepted 11 January 2007 Available online 20 February 2007

Abstract Objective: Growth hormone (GH) enhances lipolysis in adipose tissue, thereby increasing the flux of fatty acids to other tissues. Moreover, GH increases hepatic triglyceride synthesis and secretion in rats and decreases the action of peroxisome proliferator-activated receptor (PPAR)a. PPARa is activated by fatty acids and regulates hepatic lipid metabolism in rodents. The aim of this study was to investigate the importance of PPARa for the effects of GH on hepatic gene expression and lipoprotein metabolism. Design: Bovine GH was given as a continuous infusion (5 mg/kg/day) for 7 days to PPARa-null and wild-type (wt) mice. Plasma and liver lipids and hepatic gene expression were measured. In separate experiments, hepatic triglyceride secretion was measured. Results: GH treatment decreased hepatic triglyceride content and increased hepatic triglyceride secretion rate and serum cholesterol levels. Furthermore, GH increased hepatic acylCoA:diacylglycerol acyltransferase (DGAT)2 mRNA levels, but decreased the hepatic mRNA expression of acyl-CoA oxidase, medium-chain acyl-CoA dehydrogenase and PPARc1. All these GH effects were independent of PPARa. However, the effect of GH on Cyp4a10, PPARc2, and DGAT1 was different between the genotypes. GH treatment decreased Cyp4a10 mRNA expression in wt mice, but increased the expression in PPARa-null mice. In contrast, GH decreased the expression of DGAT1 and PPARc2 in PPARa-null mice, but not in wt mice. Conclusions: Most of the effects of GH on lipid and lipoprotein metabolism were independent of PPARa. However, GH had unique effects on Cyp4a10, DGAT1, and PPARc2 gene expression in PPARa-null mice showing cross-talk between GH and PPARa signalling in vivo. Ó 2007 Elsevier Ltd. All rights reserved. Keywords: Apolipoprotein B; Triglycerides; Cyp4a10; MTP; PPARc; DGAT; Liver

1. Introduction In addition to its well-known effect on longitudinal bone growth, growth hormone (GH) plays an important role in the regulation of lipid metabolism. GH influences *

Corresponding author. Address: AstraZeneca R&D, SE-431 83 Mo¨lndal, Sweden. Tel.: +46 31 706 57 85; fax: +46 31 776 37 61. E-mail address: [email protected] (J. Oscarsson). 1096-6374/$ - see front matter Ó 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.ghir.2007.01.003

body composition in terms of a moderate increase in lean body mass and a more marked decrease in body fat mass [1]. Decreased body fat mass is due to the lipolytic and anti-lipogenic action of GH in adipose tissue [2] that results in increased flux of fatty acids to other tissues [3]. In contrast to the effect of GH in adipose tissue, GH increases lipid synthesis in the liver. GH treatment in vivo increased hepatic triglyceride synthesis and very low-density lipoprotein (VLDL) secretion in rats

A. Ljungberg et al. / Growth Hormone & IGF Research 17 (2007) 154–164

[4–6] and VLDL secretion in man [7]. These effects of GH could be direct on hepatocytes or indirect via increased flux of fatty acids to the liver, since GH and oleic acid incubation of primary rat hepatocytes had similar effects on triglyceride synthesis and VLDL secretion [8]. Moreover, continuous GH infusion to hypophysectomized rats increased hepatic expression of SREBP-1c and most of its downstream target genes [9], indicating that GH also increases hepatic de novo lipogenesis. Thus, continuous GH administration could result in both increased flux of fatty acids to the liver and increased hepatic lipogenesis. Unsaturated long-chain fatty acids and their derivatives are potent endogenous activators of the nuclear receptor peroxisome proliferator-activated receptor (PPAR)a [10]. PPARa is mainly expressed in tissues with a high degree of fatty acid metabolism, such as liver, heart, brown adipose tissue, kidney and skeletal muscle [11]. Although PPARa expression is highest in liver in rodents, this is not the case for human [12] or non-human primates [13]. PPARa agonists, i.e. fibrates, are used in the treatment of hypertriglyceridemia [14]. Activation of PPARa in the liver increases transcription of genes involved in mitochondrial, peroxisomal and microsomal fatty acid oxidation [15]. In addition, the hepatic expression of apolipoprotein (apo) A-I/A-II, apoC-III [15] and microsomal triglyceride transfer protein (MTP) [16] is regulated by PPARa. Furthermore, PPARa activation by fibrates leads to increased hepatic fatty acid oxidation and decreased VLDL-triglyceride secretion from primary rat hepatocytes [17]. There are a few studies showing that GH and PPARa interact in the regulation of hepatic metabolism. A continuous infusion of GH has been found to suppress the peroxisome proliferator induction of hepatic peroxisomal b-oxidation [18,19] and acyl-CoA oxidase (ACO) mRNA [20] as well as cytochrome P450 (CYP) 4A-mediated x-oxidation [19] and CYP4A mRNA [21]. Moreover, GH decreased PPARa mRNA in cultured rat hepatocytes [22,23] and hepatic PPARa mRNA and protein expression in hypophysectomized rats [24]. GH has also been shown to decrease PPARa transcriptional activity [25] at the ligand-independent N-terminal activation function region-1 (AF-1 region) domain of PPARa [26]. Thus, GH may counteract PPARa signalling by decreasing the expression level of PPARa or interfering with PPARa signalling by other means. On the other hand, GH may increase the supply of ligands for PPARa, either via increased lipolysis in adipose tissue or via de novo synthesized fatty acids in the liver. Thus, GH and PPARa may interact in a complex manner in the regulation of hepatic lipid metabolism. The aim of this study was to determine the importance of PPARa for the effects of GH on lipid and lipoprotein metabolism. GH was administered as a continuous infu-

155

sion (5 mg/kg/day) to both PPARa-null and wild-type (wt) mice for 7 days. The effect of GH on hepatic triglyceride secretion rate, serum and liver lipid levels, as well as hepatic expression of several genes of importance for lipid and lipoprotein metabolism, was investigated.

2. Materials and methods 2.1. Animals and hormonal treatment Homozygous PPARa-null mice on pure Sv/129 genetic background and corresponding wt Sv/129 control mice were kindly provided by Dr. F.J. Gonzalez (NIH, Bethesda, MD, USA) [27] and kept on the Sv/ 129 background. The mice were maintained under standardized conditions of temperature (24–26 °C) and humidity (50–60%), with lights on between 0500 and 1900 h. The animals had free access to water and standard laboratory chow containing (w/w) 4% fat, 58% carbohydrates, 16.5% protein and 6% ashes with a total energy content of 12.6 kJ/g (R-34, Lactamin AB, Kimstad, Sweden). Recombinant bovine GH (2.5 or 5 mg/kg/ day) was given as a continuous infusion by means of Alzet osmotic minipumps (model 2001, Alza, Palo Alto, CA) implanted subcutaneously between the scapulae. The mice were anesthetized with a combination of ketamine hydrochloride (77 mg/kg; Ketalar, Parke-Davis, Detroit, MI) and xylazine (9 mg/kg; Rompun, Bayer, Lever-Kusen, Germany) during implantation of the osmotic minipumps. The recombinant bovine GH was a generous gift from Dr. Parlow (NIH, Torrance, CA). The hormone was diluted in 0.05 M phosphate buffer (pH 8.6) with 1.6% glycerol and 0.02% sodium azide. The hormonal treatment continued for 7 days. Two different experimental protocols were used. To obtain blood and tissues for measurements of plasma parameters and mRNA in the liver, mice were anesthetized with isoflurane (Forene, Abbot Scandinavia AB, Sweden) and killed between 0900 and 1100 h. Blood was collected by cardiac puncture and tissues were rapidly removed, frozen in liquid nitrogen and stored at 80 °C until analysis. The other protocol was used to determine hepatic triglyceride secretion (see below). These two experimental protocols were used to investigate both male and female mice. Altogether, 28 wt females, 26 PPARa-null females, 26 wt males and 29 PPARa-null males were used. The Ethics Committee of Go¨teborg University approved this study. All animal experimentation was conducted in accordance with accepted standards of humane animal care. 2.2. Serum lipids and hepatic triglyceride content Serum apoB concentrations were determined with an electroimmunoassay as previously described [28]. Serum

156

A. Ljungberg et al. / Growth Hormone & IGF Research 17 (2007) 154–164

triglyceride and cholesterol concentrations were determined with enzymatic colorimetric assays (TG and chol; Roche, Mannheim, Germany). The size distribution profiles of serum lipoproteins were measured using a high performance liquid chromatography system, SMART, as described before [28]. In brief, 10 ll pooled serum from 4 to 7 mice in each group was loaded on a Superose 6 PC 3.2/30 column (Amersham Pharmacia Biotech, Uppsala, Sweden). The chromatographic system was linked to an air segmented continuous flow system for on-line post-derivatization analysis of total cholesterol. Frozen livers were homogenized in isopropanol (1 ml/50 mg tissue) and incubated at 4 °C for 1 h. The samples were centrifuged in 4 °C for 5 min at 2500 rpm and triglyceride concentrations in the supernatants were measured as described above. 2.3. Hepatic triglyceride secretion rate Triglyceride secretion rate in vivo was measured by intravenous administration of Triton WR-1339 (Sigma, St. Louis, MO, USA) [29] that blocks the peripheral hydrolysis of triglycerides. The animals were fasted for 4 h (0800–1200 h) to avoid the influence of chylomicrons from the intestine. Thereafter, the mice were anesthetized with a combination of ketamine hydrochloride and xylazine, and injected intravenously with Triton WR-1339 diluted in saline (200 mg/ml) via the jugular vein (500 mg/kg body weight). Blood samples were taken before the injection (baseline fasting triglyceride concentration) and 30, 60 and 90 min after Triton WR-1339 administration. The triglyceride accumulation was linear during this time period. Plasma triglyceride levels were analyzed as described above, and plasma content of triglycerides was calculated using published plasma volume in normal female mice (0.09 ml/g body weight) and male mice (0.071 ml/g) [29]. Hepatic triglyceride secretion rate, expressed as lmol/min/kg body weight, was calculated from the slope of the curve. The triglyceride clearance rate (ml/min) was calculated as the ratio of hepatic triglyceride secretion rate (lmol/min) to baseline fasting triglyceride concentration (lmol/ml). 2.4. cDNA synthesis and real-time PCR Total liver RNA was isolated from frozen liver with TriReagentä (Sigma). DNA-freeä (Ambion, Austin, TX, USA) was used to remove contaminating DNA from the RNA preparations. First strand cDNA was synthesized from 0.4 lg of total RNA with TaqManÒ Reverse Transcription Reagents (Applied Biosystems, Foster City, CA, USA). Quantitative real-time PCR was performed with the ABI Prism 7700 Sequence Detection System, using the SYBR Green labelling system (Applied Biosystems). All samples were analyzed in

triplicate and the expression data were normalized to the endogenous control acidic ribosomal phosphoprotein P0 (36B4). Specific primers for each gene (Table 1) were designed with Primer Expressä software (Applied Biosystems) and gene sequences available from GenBank database. To avoid amplification of genomic DNA, primers were positioned to span exon junctions when possible. The correct sizes of the amplicons were verified by gel electrophoresis. 2.5. Statistics Values are expressed as means ± SEM. Comparisons between groups were made by 2-way ANOVA using genotype and GH treatment as factors. An interaction term was used to investigate if the interaction between the factors was significant. If significant, the interaction term was kept in the model. A significant interaction shows that the response was different between genotypes. Values were transformed to logarithms when appropriate. P < 0.05 was considered significant.

3. Results In initial studies, 20 weeks old male and female mice (Sv/129) were given either vehicle or two different doses of bovine GH (2.5 mg/kg/day or 5 mg/kg/day) for 7 days via osmotic minipumps. Neither dose of GH significantly influenced PPARa mRNA expression (data not shown). The higher dose was chosen for the subsequent experiments since this dose increased plasma cholesterol levels (data not shown). 3.1. Effects on body and tissue weights In the next experiments, 25–35 weeks old female PPARa-null and wt mice were given either vehicle or GH (5 mg/kg/day) via osmotic minipumps. Before the start of the experiments, body weights were comparable between the genotypes (wt: 27.1 ± 1.4 g, n = 13, PPARa-null: 26.8 ± 0.8 g, n = 9). One week of GH treatment increased body weight gain and liver weights, but did not change gonadal fat weights. The response to GH treatment was not different between the genotypes (Table 2). In another experiment, 25–35 weeks old male mice (wt males: 31.6 ± 1.19 g, n = 12, PPARa-null males: 32.2 ± 1.12 g, n = 16) were investigated. However, most effects of GH treatment and PPARa-deficiency were similar in males and females. Therefore, the effects in females are presented in detail, and in case of sex-differentiated effects of GH treatment or PPARadeficiency, results from males are also presented (see also Supplementary files).

A. Ljungberg et al. / Growth Hormone & IGF Research 17 (2007) 154–164

157

Table 1 Primers used for real-time PCR Gene

Acc. Number

Forward primer (5 0 ! 3 0 )

Reverse primer (5 0 ! 3 0 )

ACO Cyp4a10 IGF-I LXRa MCAD MTP PPARa PPARc PPARc1 PPARc2 SREBP-1 SCD-1 DGAT1 DGAT2 36B4

AF006688 XM_204116 NM_010512 AF085745 BC008951 L47970 NM_011144 U01841 U01841 U09138 AB017337 BC007474 NM_010046 AF384160 NM_007475

CAGCAGGAGAAATGGATGCA CAACACATCTCCTTAATGACCCTAGAC GCTGGTGGATGCTCTTCAGTT CAATGCCTGATGTTTCTCCTGAT GCCCTCCGCAGGCTCT GCTCCCTCAGCTGGTGGAT CACGATGCTGCTCTCCTTGA TGACAGGAAAGACAACGGACAA GCGGCTGAGAAATCACGTTC AACTCTGGGAGATTCTCCTGTTGA GCAGACCCTGGTGAGTGGA CCTGCGGATCTTCCTTATCATT CGTGGGCGACGGCTACT GCCCGCAGCGAAAACA GAGGAATCAGATGAGGATATGGGA

GGGCGTAGGTGCCAATTATCT CCTGTAATTTCCATCTACCTGAACACT CGAATGCTGGAGCCATAGC CCTGCATCTTGAGGTTCTGTCTT ACCCTTCTTCTCTGCTTTGGTCT CAGGATGGCTTCTAGCGAGTCT GTGTGATAAAGCCATTGCCGTA ATCTTCTCCCATCATTAAGGAATTCAT GAATATCAGTGGTTCACCGCTTC GAAGTGCTCATAGGCAGTGCAT GTCGGTGGATGGGCAGTTT GATCTCGGGCCCATTCG GAAACCACTGTCTGAGCTGAACA GTCTTGGAGGGCTGAGAGGAT AAGCAGGCTGACTTGGTTGC

Table 2 Effects of GH on body weight and tissue weights in PPARa-null mice and wt mice Group

Body weight gain (g)

Liver weight (% bw)

Gonadal fat weight (% bw)

Wt vehicle Wt GH

0.60 ± 0.36 1.91 ± 0.22*

3.52 ± 0.38 4.10 ± 0.22*

3.81 ± 0.45 3.29 ± 0.27

KO vehicle KO GH

0.15 ± 2.21 1.28 ± 0.12*

3.22 ± 0.15 4.32 ± 0.10*

4.71 ± 0.28 3.91 ± 0.97

Female PPARa-null mice (KO) and wt mice were administered bovine GH (5 mg/kg/day) for 7 days as a continuous infusion. Values are means ± SEM (n = 4–7). Comparisons between groups were made by 2-way ANOVA using GH treatment and genotype as factors. * p < 0.05 GH treated mice vs. vehicle treated mice including both genotypes.

3.2. Effects on serum lipids and hepatic triglycerides GH treatment had no effect on serum triglycerides, whereas serum cholesterol levels increased (Table 3). PPARa-null mice had higher serum triglycerides than wt mice, while cholesterol levels were similar between the genotypes (Table 3). The lipoprotein size distribution profiles were measured in pooled serum from 4 to 7 mice in each group (Fig. 1a). In both genotypes, GH

Table 3 Effects of GH on serum lipids in PPARa-null mice and wt mice Group

Triglycerides (mM)

Cholesterol (mM)

Wt vehicle Wt GH

1.13 ± 0.16 0.74 ± 0.05

2.80 ± 0.21 4.13 ± 0.42*

KO vehicle KO GH

#

1.46 ± 0.29 1.33 ± 0.06#

2.83 ± 0.13 4.36 ± 0.35*

Female PPARa-null mice (KO) and wt mice were administered bovine GH (5 mg/kg/day) for 7 days as a continuous infusion. Values are means ± SEM (n = 4–7). Comparisons between groups were made by 2-way ANOVA using GH treatment and genotype as factors. * p < 0.05 GH treated mice vs. vehicle treated mice including both genotypes. # p < 0.05 PPARa-null mice vs. wt mice including both GH treated and vehicle treated mice.

treatment increased total serum cholesterol and shifted the large peak, representing mainly HDL, to the left, i.e. towards less dense particles. Moreover, the height of the main peak increased by GH, indicating increased HDL cholesterol levels. Serum apoB levels increased by GH treatment (Fig. 1b). In addition, serum apoB levels were higher in PPARa-null mice compared to wt mice, as previously observed [28]. Thus, low PPARa expression and high GH levels have additive effect on serum apoB levels. GH treatment decreased hepatic triglyceride content, especially in PPARa-null mice, while PPARa-deficiency had no significant effect (Fig. 1c). 3.3. Effects on hepatic triglyceride secretion To study the effects of GH on hepatic triglyceride secretion and triglyceride clearance rates in vivo, female PPARa-null (n = 17) and wt mice (n = 15) of 25–35 weeks of age were given either vehicle or GH (5 mg/ kg/day) via osmotic minipumps for 7 days in a separate experiment. GH treatment as well as PPARa-deficiency increased hepatic triglyceride secretion (Fig. 2a). Thus, PPARa-deficiency and GH treatment have additive effects on hepatic triglyceride secretion. Since the serum triglyceride levels were unchanged by GH treatment, the

158

A. Ljungberg et al. / Growth Hormone & IGF Research 17 (2007) 154–164

Fig. 1. Serum lipoproteins (a), serum apoB (b) and hepatic triglyceride content (c) in PPARa-null and wt mice treated with GH. Female PPARa-null mice (KO) and wt mice were administered bovine GH (5 mg/kg/day) for 7 days as a continuous infusion. The cholesterol profiles were determined in pooled serum from 4 to 7 mice in each group as described in section 2. Serum apoB (n = 4–5) and hepatic TG (n = 4–7) content was measured as described in Section 2. Values are means ± SEM. Comparisons between groups were made by 2-way ANOVA using GH treatment and genotype as factors.*p < 0.05 GH treated mice vs. wt mice including both genotypes. #p < 0.05 PPARa-null mice vs. wt mice including both GH treated and vehicle treated mice.

Fig. 2. In vivo hepatic triglyceride secretion rate (a) and triglyceride clearance rate (b) in PPARa-null mice and wt mice treated with GH. Female PPARa-null mice and wt mice were administered bovine GH (5 mg/kg/day) for 7 days as a continuous infusion. Hepatic TG secretion rate and clearance were determined and calculated as described in Section 2. Values are means ± SEM, (n = 6–10). Comparisons between groups were made by 2-way ANOVA using GH treatment and genotype as factors. *p < 0.05 GH treated mice vs. wt mice including both genotypes. #p < 0.05 PPARanull mice vs. wt mice including both GH treated and vehicle treated mice.

calculated triglyceride clearance rate was increased by GH treatment (Fig. 2b). However, PPARa-deficiency did not influence calculated triglyceride clearance. 3.4. Effects on IGF-I and genes involved in VLDL secretion and fatty acid oxidation To further study the importance of PPARa for the effects of GH, known GH or PPARa-sensitive genes, representing different aspects of hepatic lipid metabo-

lism, were measured with quantitative real-time PCR. GH treatment had no significant effect on PPARa mRNA expression (data not shown), while the hepatic expression of IGF-I mRNA increased after GH treatment (Fig. 3a). MTP is essential and rate-limiting for the assembly and secretion of apoB-containing lipoproteins [30,31]. The increased triglyceride secretion rate following GH treatment was not associated with increased MTP gene expression (Fig. 3b). However, the higher triglyceride secretion in PPARa-null mice

A. Ljungberg et al. / Growth Hormone & IGF Research 17 (2007) 154–164

159

Fig. 3. Hepatic mRNA expression of IGF-I (a), MTP (b), ACO (c), MCAD (d) and Cyp4a10 (e) in PPARa-null mice and wt mice treated with GH. Female PPARa-null mice and wt mice were administered bovine GH (5 mg/kg/day) for 7 days as a continuous infusion. Hepatic mRNA expression was determined with quantitative real-time PCR. Values are means ± SEM (n = 4–7). Comparisons between groups were made by 2-way ANOVA using GH treatment and genotype as factors. *p < 0.05 GH treated mice vs. wt mice including both genotypes. #p < 0.05 PPARa-null mice vs. wt mice including both GH treated and vehicle treated mice. §p < 0.05 different responses in wt and PPARa-null mice.

than their wt controls correlated with higher MTP mRNA levels. GH treatment resulted in decreased mRNA expression of ACO (Fig. 3c) and medium-chain acyl-CoA dehydrogenase (MCAD; Fig. 3d), indicating decreased peroxisomal and mitochondrial b-oxidation, respectively. However, the effect of GH on these genes was not influenced by PPARa-deficiency. Cyp4a10, which is involved in microsomal x-oxidation of fatty acids, was expressed at very low levels in PPARa-null mice (Fig. 3e). Interestingly, there was an interaction between GH and PPARa in the regulation of Cyp4a10. GH decreased Cyp4a10 mRNA levels in wt mice (59%), while the expression was increased by GH in PPARa-null mice (+210%). Thus, the effect of GH on Cyp4a10 mRNA expression is PPARa-dependent. 3.5. Effects on genes involved in lipid synthesis To examine whether the stimulated triglyceride secretion was associated with changed expression of genes involved in hepatic lipogenesis, we measured the lipogenic transcription factors SREBP-1 and LXRa. GH treatment had no effect on SREBP-1 (Fig. 4a) or LXRa mRNA (Fig. 4b), while PPARa-deficiency induced the expression of both genes. Furthermore, hepatic PPARc was measured since it has been shown to be important for liver triglycerides [32] and plasma triglyceride clearance [33]. In line with the decreased hepatic triglyceride content, GH treatment resulted in decreased expression of PPARc1 (Fig. 4c) and PPARc2 (Fig. 4d). The regulation of total PPARc (data not shown) was similar to

PPARc1 as expected since the hepatic expression level of PPARc1 mRNA is higher than that of PPARc2. Interestingly, statistical analysis of PPARc2 mRNA expression showed an interaction between GH treatment and genotype. Thus, presence of PPARa blunted an effect of GH on PPARc2 mRNA expression (Fig. 4d). Stearoyl-CoA desaturase-1 (SCD-1) is a down-stream target gene of SREBP-1 and LXRa [34]. In Fig. 4e, it is shown that GH markedly down-regulated expression of SCD-1, while PPARa-deficiency had no effect. These results indicated that enhanced lipogenesis is probably not important for the effect of GH on hepatic triglyceride secretion. The last step in triglyceride biosynthesis is governed by acylCoA:diacylglycerol acyltransferase (DGAT) activity. Two different enzymes with this activity have been cloned and characterized [35,36]. In Fig. 4f and g, the effect of GH treatment and PPARa-deficiency on the hepatic expression of DGAT1 and DGAT2 is shown. DGAT1 mRNA expression was differently regulated by GH in wt and PPARa null-mice (Fig. 4f). In contrast, GH increased DGAT2 mRNA expression in both genotypes, but PPARa-deficiency did not influence expression of the gene (Fig. 4g). 3.6. Sex-specific effects of GH treatment and PPARadeficiency The secretory pattern of GH is different between male and female mice [37]. Therefore, the continuous infusion of GH used in this study would not alter the female-spe-

160

A. Ljungberg et al. / Growth Hormone & IGF Research 17 (2007) 154–164

Fig. 4. Hepatic mRNA expression of SREBP-1 (a), LXRa (b), PPARc1 (c) and PPARc2 (d), SCD-1 (e), DGAT1 (f) and DGAT2 (g) in PPARa-null mice and wt mice treated with GH. Female PPARa-null mice and wt mice were administered bovine GH (5 mg/kg/day) for 7 days as a continuous infusion. Hepatic mRNA expression was determined with quantitative real-time PCR. Values are means ± SEM (n = 4–7). Comparisons between groups were made by 2-way ANOVA using GH treatment and genotype as factors. *p < 0.05 GH treated mice vs. wt mice including both genotypes. # p < 0.05 PPARa-null mice vs. wt mice including both GH treated and vehicle treated mice. §p < 0.05 different responses in wt and PPARa-null mice.

cific plasma pattern of GH to the same extent as the male-specific pattern [38]. In contrast to the situation in females, PPARa-deficiency in males resulted in higher gonadal fat pad weight than in wt males (Suppl. Table 1). The effects of PPARadeficiency and GH treatment on plasma lipids and lipoproteins were similar between the sexes (Suppl. Table 2 and Fig. 1A). However, serum apoB levels were not influenced by GH or PPARa-deficiency in males (Suppl. Fig. 1B). Thus, the effect of GH and PPARa-deficiency on serum apoB levels is female-specific. Similarly, the effect of PPARa-deficiency on MTP mRNA expression was specific for females, since no up-regulation was observed in male PPARa-null mice (Suppl. Fig. 2). GH decreased hepatic triglyceride content also in males (Suppl. Fig 1C). However, in contrast to females, male PPARa-null mice had markedly higher liver triglycerides than wt mice. The effect of GH on hepatic triglyceride secretion in males was similar to that in females but more pronounced (Suppl. Fig. 1D). In contrast to females, PPARa-null males showed a higher plasma triglyceride clearance than their wt controls (Suppl. Fig. 1E).

The expression of Cyp4a10 was markedly higher in female wt mice compared to males (data not shown). In males, GH treatment increased Cyp4a10 mRNA in both genotypes (Suppl. Fig. 2) and no interaction between GH and PPARa in Cyp4a10 mRNA regulation was observed. GH treatment decreased the expression of PPARc mRNA in males as also observed in females (data not shown). PPARc1 and PPARc2 mRNA were regulated in a similar manner by GH as total PPARc, but the effect of GH did not reach statistical significance (Suppl. Fig. 2). Interestingly, male PPARa-null mice had higher levels of hepatic PPARc mRNA compared to wt males; an effect of PPARa-deficiency that was not seen in females.

4. Discussion The main finding in this study was that PPARa plays a minor role for the overall effect of GH on hepatic lipid and lipoprotein metabolism, including hepatic expression of genes involved in different aspects of fatty acid

A. Ljungberg et al. / Growth Hormone & IGF Research 17 (2007) 154–164

metabolism. Stimulation of hepatic triglyceride secretion or down-regulation of ACO and MCAD mRNA by GH was not dependent on PPARa. However, hepatic expression of PPARa was important for GH-mediated down-regulation of Cyp4a10 and up-regulation of DGAT1 as well as maintenance of PPARc2 expression in the liver following GH treatment. Together these results indicate that the presence of PPARa could faciliate the flux of fatty acids from x-oxidation to triglyceride synthesis following GH treatment. Thus, the effects on gene expression are compatible with the observation that GH treatment of wt mice had no effect on hepatic triglyceride content while triglyceride content decreased following GH treatment of PPARa-deficient mice. GH treatment increased body weight gain and liver weights, demonstrating that the given dose was sufficient to induce effects of GH on top of the physiological exposure. However, in contrast to studies in GH treated hypophysectomized rats [24] and bGH transgenic mice [39], no effect on PPARa mRNA expression was observed. Thus, GH treatment resulted in an expected increase in body weight gain and IGF-I mRNA [40] but was not sufficient to decrease PPARa mRNA expression. The reason for this is unclear, but may be due to the duration of GH treatment as compared to bGH transgenic mice [39] or to the fact that the control mice in this study have a physiological GH secretion in contrast to hypophysectomized rats [24]. In line with findings in bGH transgenic mice [41], GH treatment increased total serum cholesterol levels, mainly as a result of increased HDL cholesterol levels. GH increased serum apoB levels, showing increased number of LDL-VLDL particles. This finding is in line with the increased hepatic triglyceride secretion observed after GH treatment, indicating increased secretion of apoB [5]. Moreover, the increased serum level of apoB following GH treatment is in line with the observation of markedly decreased serum levels of apoB in GH receptor-deficient mice [42]. However, these observations are in contrast to the dose-dependent decrease in serum apoB levels following GH treatment of hypophysectomized rats [43]. The present study shows for the first time that GH treatment results in stimulated hepatic triglyceride secretion in mice. In contrast to hypophysectomized rats [44], this effect was not associated with elevated expression of MTP. Thus, increased expression of MTP is not required for increased hepatic triglyceride secretion following continuous infusion of GH to intact mice. Also female PPARa-null mice had stimulated hepatic triglyceride secretion along with increased serum triglycerides and apoB compared to wt controls, as described before [28]. However, in this case, the increased triglyceride secretion was accompanied with increased levels of MTP mRNA. Since MTP is rate-limiting for the assembly and secretion of apoB-containing lipoproteins

161

[30,31], the increased MTP expression might contribute to the increased hepatic triglyceride secretion in PPARadeficient female mice. In line with a previous study [45], MTP mRNA expression in male PPARa-null males was not different from wt males. The triglyceride secretion rate was slightly elevated also in male PPARa-null mice, but the increase was less pronounced as compared to females. Thus, other factors than MTP must explain the higher triglyceride secretion in male PPARa-null mice. SREBP-1 or LXRa expression was not changed, but SCD-1 mRNA expression decreased by GH treatment in females. Decreased SCD-1 mRNA was previously observed in bGH transgenic mice [39]. These findings indicate that the GH treatment did not induce lipogenesis, in contrast to the situation in hypophysectomized rat [9]. However, DGAT2 mRNA expression increased to a similar extent in wt and PPARa-null mice, indicating that hepatic triglyceride synthesis from circulating fatty acids increased as a consequence of GH treatment. The observation that GH induces DGAT2 expression is a novel finding. However, we have previously shown that DGAT1 mRNA is increased in bGH transgenic mice [39]. Interestingly, DGAT1 mRNA regulation was different in wt and PPARa-null mice, indicating that PPARa is important for GH stimulation of DGAT1. Another study has shown that hepatic DGAT2 expression was regulated by fasting-refeeding but not DGAT1 [46]. Since DGAT2 is more abundant than DGAT1 in the liver [46], the physiological importance of the divergent regulation of DGAT1 in the two genotypes is unclear. However, it is likely that increased DGAT2 expression is important for the effect of GH on hepatic triglyceride secretion. To the best of our knowledge, this study shows for the first time that GH regulates hepatic PPARc mRNA levels. It has previously been shown that incubation of primary rat preadipocytes with GH markedly reduced triglyceride content in parallel with decreased expression of PPARc [47]. GH treatment decreased the hepatic expression of both PPARc1 and PPARc2. Interestingly, there was an interaction between GH and PPARa in the regulation of PPARc2. PPARa prevented down-regulation of PPARc2 expression by GH since the down-regulation was only observed in GH treated PPARa-null mice. Hepatic overexpression of PPARc1 in vivo [32] and PPARc2 in vitro [48] showed that PPARc increases hepatic triglyceride synthesis and accumulation. Subjects with liver steatosis have increased hepatic expression of PPARc mRNA [49], indicating a possible role of PPARc also in development of fatty liver in humans. An increased prevalence of hepatic steatosis has been observed in patients with GH-deficiency [50]. It is therefore tempting to speculate that the effect of GH on PPARc has a role for liver triglyceride content also in man. Based on the present

162

A. Ljungberg et al. / Growth Hormone & IGF Research 17 (2007) 154–164

findings, it could be speculated that low hepatic expression of PPARa would facilitate GH induced down-regulation of PPARc2 and subsequently the liver triglyceride content. Interestingly, the effect of GH on hepatic triglyceride content tended to be more pronounced in the PPARa-deficient mice, suggesting that the decreased PPARc2 expression could contribute to the effect of GH on hepatic triglyceride content. The decrease in hepatic triglyceride stores after GH treatment is probably not explained by increased peroxisomal or mitochondrial fatty acid oxidation, since ACO and MCAD mRNA expression decreased by GH, in line with previous studies [18–20]. Hepatic triglyceride content was 600% higher in male PPARa-null mice compared to male wt mice, whereas females displayed similar levels. Thus, the hepatic triglycerides are not targeted to VLDL secretion to the same extent in male PPARa-null mice, but rather accumulate in the liver leading to a sex-specific hepatic steatosis as described before in PPARa-null mice [51]. PPARc is known to be important for the development of hepatic steatosis [32], and in line with the study by Costet et al., we observed elevated hepatic PPARc2 mRNA expression in PPARa-null males compared to wt males. In addition, we show increased expression of total PPARc and PPARc1 mRNA that could contribute to the increased hepatic triglyceride content [32] and hepatic triglyceride clearance [33] of male PPARa-null mice. GH treatment decreased Cyp4a10 mRNA in wt mice, whereas the expression was up-regulated in response to GH in PPARa-null mice. Compared to the b-oxidation pathway, x-oxidation is a minor pathway for fatty acid oxidation. However, Cyp4a10 mRNA expression is induced in streptozotocin-induced diabetic mice [52] and obese (ob/ob) mice [53], which suggest that x-oxidation is of increased importance when fatty acid flux to the liver is increased. Therefore it is unexpected that the increased fatty acid flux following GH treatment [3] is associated with decreased Cyp4a10 expression in wt mice. Cyp4a10 activity is also involved in lipid peroxidation [54]. Thus, the results indicate that the presence of PPARa is important for GH induced down-regulation of hepatic x-oxidation and lipid peroxidation. In summary, GH treatment decreased hepatic triglyceride content and expression of PPARc as well as ACO and MCAD mRNA in the liver. In addition, GH increased hepatic triglyceride secretion, plasma triglyceride clearance and HDL cholesterol levels. These effects were not different between PPARa-null and wt mice, demonstrating that most of the studied effects of GH on hepatic lipid and lipoprotein metabolism were PPARa-independent. However, the effects of GH on Cyp4a10, DGAT1 and PPARc2 expression were dependent on PPARa indicating that PPARa is important for some aspects of GH regulation of hepatic lipid metabo-

lism, e.g. PPARc signalling, triglyceride synthesis and xoxidation.

Acknowledgements We thank Lennart Svensson and co-workers at AstraZeneca R&D, Mo¨lndal for the analyses of lipoprotein fractions. We also thank Jing Jia for excellent technical assistance and Karin Nelander for valuable help with the statistical analyses. This work was supported by Grant 14291 from the Swedish Medical Research Council, King Gustav V:s and Queen Victorias Foundation, AstraZeneca R&D and the Swedish Heart and Lung Foundation.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ghir. 2007.01.003.

References [1] B.A. Bengtsson, S. Ede´n, L. Lo¨nn, H. Kvist, A. Stokland, G. Lindstedt, I. Bosaeus, J. Tolli, L. Sjo¨strom, O.G. Isaksson, Treatment of adults with growth hormone (GH) deficiency with recombinant human GH, J. Clin. Endocrinol. Metab. 76 (1993) 309–317. [2] M.B. Davidson, Effect of growth hormone on carbohydrate and lipid metabolism, Endocr. Rev. 8 (1987) 115–131. [3] J.A. Kanaley, R. Dall, N. Moller, S.C. Nielsen, J.S. Christiansen, M.D. Jensen, J.O. Jorgensen, Acute exposure to GH during exercise stimulates the turnover of free fatty acids in GH-deficient men, J. Appl. Physiol. 96 (2004) 747–753. [4] M.B. Elam, C.P. Simkevich, S.S. Solomon, H.G. Wilcox, M. Heimberg, Stimulation of in vitro triglyceride synthesis in the rat hepatocyte by growth hormone treatment in vivo, Endocrinology 122 (1988) 1397–1402. [5] A. Sjo¨berg, J. Oscarsson, J. Bore´n, S. Ede´n, S.O. Olofsson, Mode of growth hormone administration influences triacylglycerol synthesis and assembly of apolipoprotein B-containing lipoproteins in cultured rat hepatocytes, J. Lipid Res. 37 (1996) 275–289. [6] F. Frick, D. Linde´n, C. Ame´en, S. Ede´n, A. Mode, J. Oscarsson, Interaction between growth hormone and insulin in the regulation of lipoprotein metabolism in the rat, Am. J. Physiol. Endocrinol. Metab. 283 (2002) E1023–E1031. [7] E.R. Christ, M.H. Cummings, E. Albany, A.M. Umpleby, P.J. Lumb, A.S. Wierzbicki, R.P. Naoumova, M.A. Boroujerdi, P.H. So¨nksen, D.L. Russell-Jones, Effects of growth hormone (GH) replacement therapy on very low density lipoprotein apolipoprotein B100 kinetics in patients with adult GH deficiency: a stable isotope study, J. Clin. Endocrinol. Metab. 84 (1999) 307–316. [8] D. Linde´n, A. Sjo¨berg, L. Asp, L. Carlsson, J. Oscarsson, Direct effects of growth hormone on production and secretion of apolipoprotein B from rat hepatocytes, Am. J. Physiol. Endocrinol. Metab. 279 (2000) E1335–E1346. [9] C. Ame´en, D. Linde´n, B.M. Larsson, A. Mode, A. Holma¨ng, J. Oscarsson, Effects of gender and growth hormone secretory pattern on sterol regulatory element binding protein-1c and its

A. Ljungberg et al. / Growth Hormone & IGF Research 17 (2007) 154–164

[10]

[11]

[12]

[13]

[14] [15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

target genes in rat liver, Am. J. Physiol. Endocrinol. Metab. 287 (2004) 1039–1048. S.A. Kliewer, S.S. Sundseth, S.A. Jones, P.J. Brown, G.B. Wisely, C.S. Koble, P. Devchand, W. Wahli, T.M. Willson, J.M. Lenhard, J.M. Lehmann, Fatty acids and eicosanoids regulate gene expression through direct interactions with peroxisome proliferatoractivated receptors alpha and gamma, Proc. Natl. Acad. Sci. USA 94 (1997) 4318–4323. O. Braissant, F. Foufelle, C. Scotto, M. Dauca, W. Wahli, Differential expression of peroxisome proliferator-activated receptors (PPARs): tissue distribution of PPAR-alpha, -beta, and gamma in the adult rat, Endocrinology 137 (1996) 354–366. R. Mukherjee, L. Jow, D. Noonan, D.P. McDonnell, Human and rat peroxisome proliferator activated receptors (PPARs) demonstrate similar tissue distribution but different responsiveness to PPAR activators, J. Steroid Biochem. Mol. Biol. 51 (1994) 157– 166. D.A. Winegar, P.J. Brown, W.O. Wilkison, M.C. Lewis, R.J. Ott, W.Q. Tong, H.R. Brown, J.M. Lehmann, S.A. Kliewer, K.D. Plunket, J.M. Way, N.L. Bodkin, B.C. Hansen, Effects of fenofibrate on lipid parameters in obese rhesus monkeys, J. Lipid Res. 42 (2001) 1543–1551. S. Colagiuri, J. Best, Lipid-lowering therapy in people with type 2 diabetes, Curr. Opin. Lipidol. 13 (2002) 617–623. K. Schoonjans, B. Staels, J. Auwerx, Role of the peroxisome proliferator-activated receptor (PPAR) in mediating the effects of fibrates and fatty acids on gene expression, J. Lipid Res. 37 (1996) 907–925. ˚ kerblad, A. C. Ame´en, U. Edvardsson, A. Ljungberg, L. Asp, P. A Tuneld, S.O. Olofsson, D. Linde´n, J. Oscarsson, Activation of peroxisome proliferator-activated receptor alpha increases the expression and activity of microsomal triglyceride transfer protein in the liver, J. Biol. Chem. 280 (2005) 1224–1229. D. Linde´n, K. Lindberg, J. Oscarsson, C. Claesson, L. Asp, L. Li, M. Gustafsson, J. Bore´n, S.O. Olofsson, Influence of peroxisome proliferator-activated receptor alpha agonists on the intracellular turnover and secretion of apolipoprotein (Apo) B-100 and ApoB48, J. Biol. Chem. 277 (2002) 23044–23053. H. Sugiyama, J. Yamada, T. Suga, Effects of testosterone, hypophysectomy and growth hormone treatment on clofibrate induction of peroxisomal beta-oxidation in female rat liver, Biochem. Pharmacol. 47 (1994) 918–921. T. Sato, N. Murayama, Y. Yamazoe, R. Kato, Suppression of clofibrate-induction of peroxisomal and microsomal fatty acidoxidizing enzymes by growth hormone and thyroid hormone in primary cultures of rat hepatocytes, Biochim. Biophys. Acta 1256 (1995) 327–333. J. Yamada, H. Sugiyama, H. Tamura, T. Suga, Hormonal modulation of peroxisomal enzyme induction caused by peroxisome proliferators: suppression by growth and thyroid hormones in cultured rat hepatocytes, Arch. Biochem. Biophys. 315 (1994) 555–557. S.S. Sundseth, D.J. Waxman, Sex-dependent expression and clofibrate inducibility of cytochrome P450 4A fatty acid omegahydroxylases. Male specificity of liver and kidney CYP4A2 mRNA and tissue-specific regulation by growth hormone and testosterone, J. Biol. Chem. 267 (1992) 3915–3921. J. Yamada, H. Sugiyama, T. Watanabe, T. Suga, Suppressive effect of growth hormone on the expression of peroxisome proliferator-activated receptor in cultured rat hepatocytes, Res. Commun. Mol. Pathol. Pharmacol. 90 (1995) 173–176. L. Carlsson, D. Linde´n, M. Jalouli, J. Oscarsson, Effects of fatty acids and growth hormone on liver fatty acid binding protein and PPARalpha in rat liver, Am. J. Physiol. Endocrinol. Metab. 281 (2001) E772–E781. M. Jalouli, L. Carlsson, C. Ame´en, D. Linde´n, A. Ljungberg, L. Michalik, S. Ede´n, W. Wahli, J. Oscarsson, Sex difference in

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34] [35]

[36]

[37]

[38]

163

hepatic peroxisome proliferator-activated receptor alpha expression: influence of pituitary and gonadal hormones, Endocrinology 144 (2003) 101–109. Y.C. Zhou, D.J. Waxman, Cross-talk between janus kinase-signal transducer and activator of transcription (JAK-STAT) and peroxisome proliferator-activated receptor- alpha (PPARalpha) signaling pathways. Growth hormone inhibition of PPARalpha transcriptional activity mediated by STAT5b, J. Biol. Chem. 274 (1999) 2672–2681. Y.C. Zhou, D.J. Waxman, STAT5b down-regulates peroxisome proliferator-activated receptor alpha transcription by inhibition of ligand-independent activation function region-1 trans-activation domain, J. Biol. Chem. 274 (1999) 29874–29882. S.S. Lee, T. Pineau, J. Drago, E.J. Lee, J.W. Owens, D.L. Kroetz, P.M. Fernandez-Salguero, H. Westphal, F.J. Gonzalez, Targeted disruption of the alpha isoform of the peroxisome proliferatoractivated receptor gene in mice results in abolishment of the pleiotropic effects of peroxisome proliferators, Mol. Cell Biol. 15 (1995) 3012–3022. D. Linde´n, M. Alsterholm, H. Wennbo, J. Oscarsson, PPARalpha deficiency increases secretion and serum levels of apolipoprotein B-containing lipoproteins, J. Lipid Res. 42 (2001) 1831–1840. X. Li, F. Catalina, S.M. Grundy, S. Patel, Method to measure apolipoprotein B-48 and B-100 secretion rates in an individual mouse: evidence for a very rapid turnover of VLDL and preferential removal of B-48- relative to B-100-containing lipoproteins, J. Lipid Res. 37 (1996) 210–220. M. Raabe, L.M. Flynn, C.H. Zlot, J.S. Wong, M.M. Veniant, R.L. Hamilton, S.G. Young, Knockout of the abetalipoproteinemia gene in mice: reduced lipoprotein secretion in heterozygotes and embryonic lethality in homozygotes, Proc. Natl. Acad. Sci. USA 95 (1998) 8686–8691. U.J. Tietge, A. Bakillah, C. Maugeais, K. Tsukamoto, M. Hussain, D.J. Rader, Hepatic overexpression of microsomal triglyceride transfer protein (MTP) results in increased in vivo secretion of VLDL triglycerides and apolipoprotein B, J. Lipid Res. 40 (1999) 2134–2139. S. Yu, K. Matsusue, P. Kashireddy, W.Q. Cao, V. Yeldandi, A.V. Yeldandi, M.S. Rao, F.J. Gonzalez, J.K. Reddy, Adipocytespecific gene expression and adipogenic steatosis in the mouse liver due to peroxisome proliferator-activated receptor gamma1 (PPARgamma1) overexpression, J. Biol. Chem. 278 (2003) 498– 505. O. Gavrilova, M. Haluzik, K. Matsusue, J.J. Cutson, L. Johnson, K.R. Dietz, C.J. Nicol, C. Vinson, F.J. Gonzalez, M.L. Reitman, Liver peroxisome proliferator-activated receptor gamma contributes to hepatic steatosis, triglyceride clearance, and regulation of body fat mass, J. Biol. Chem. 278 (2003) 34268–34276. J.M. Ntambi, M. Miyazaki, Regulation of stearoyl-CoA desaturases and role in metabolism, Progr. Lipid Res. 43 (2004) 91–104. S. Cases, S.J. Smith, Y.W. Zheng, H.M. Myers, S.R. Lear, E. Sande, S. Novak, C. Collins, C.B. Welch, A.J. Lusis, S.K. Erickson, R.V. Farese Jr., Identification of a gene encoding an acyl CoA:diacylglycerol acyltransferase, a key enzyme in triacylglycerol synthesis, Proc. Natl. Acad. Sci. USA 95 (1998) 13018– 13023. S. Cases, S.J. Stone, P. Zhou, E. Yen, B. Tow, K.D. Lardizabal, T. Voelker, R.V. Farese Jr., Cloning of DGAT2, a second mammalian diacylglycerol acyltransferase, and related family members, J. Biol. Chem. 276 (2001) 38870–38876. J.N. MacLeod, N.A. Pampori, B.H. Shapiro, Sex differences in the ultradian pattern of plasma growth hormone concentrations in mice, J. Endocrinol. 131 (1991) 395–399. G. Norstedt, R. Palmiter, Secretory rhythm of growth hormone regulates sexual differentiation of mouse liver, Cell 36 (1984) 805– 812.

164

A. Ljungberg et al. / Growth Hormone & IGF Research 17 (2007) 154–164

[39] B. Olsson, Y.M. Bohlooly, O. Brusehed, O.G. Isaksson, B. Ahre´n, S.O. Olofsson, J. Oscarsson, J. To¨rnell, Bovine growth hormonetransgenic mice have major alterations in hepatic expression of metabolic genes, Am. J. Physiol. Endocrinol. Metab. 285 (2003) E504–E511. [40] R. Tao, F. Acquati, S.M. Marcovina, H.H. Hobbs, Human growth hormone increases apo(a) expression in transgenic mice, Arterioscler. Thromb. Vasc. Biol. 19 (1999) 2439–2447. [41] F. Frick, M. Bohlooly, D. Linde´n, B. Olsson, J. To¨rnell, S. Ede´n, J. Oscarsson, Long-term growth hormone excess induces marked alterations in lipoprotein metabolism in mice, Am. J. Physiol. Endocrinol. Metab. 281 (2001) E1230–E1239. [42] E. Egecioglu, M. Bjursell, A. Ljungberg, S.L. Dickson, J.J. Kopchick, G. Bergstro¨m, L. Svensson, J. Oscarsson, J. To¨rnell, Y.M. Bohlooly, Growth hormone receptor deficiency results in blunted ghrelin feeding response, obesity, and hypolipidemia in mice, Am. J. Physiol. Endocrinol. Metab. 290 (2006) E317– E325. [43] J. Oscarsson, S.O. Olofsson, K. Vikman, S. Ede´n, Growth hormone regulation of serum lipoproteins in the rat: different growth hormone regulatory principles for apolipoprotein (apo) B and the sexually dimorphic apo E concentrations, Metabolism 40 (1991) 1191–1198. [44] C. Ame´en, J. Oscarsson, Sex difference in hepatic microsomal triglyceride transfer protein expression is determined by the growth hormone secretory pattern in the rat, Endocrinology 144 (2003) 3914–3921. [45] S. Kersten, J. Seydoux, J.M. Peters, F.J. Gonzalez, B. Desvergne, W. Wahli, Peroxisome proliferator-activated receptor alpha mediates the adaptive response to fasting, J. Clin. Invest. 103 (1999) 1489–1498. [46] R.L. Meegalla, J.T. Billheimer, D. Cheng, Concerted elevation of acyl-coenzyme A:diacylglycerol acyltransferase (DGAT) activity through independent stimulation of mRNA expression of DGAT1

[47]

[48]

[49]

[50]

[51]

[52]

[53]

[54]

and DGAT2 by carbohydrate and insulin, Biochem. Biophys. Res. Commun. 298 (2002) 317–323. L.H. Hansen, B. Madsen, B. Teisner, J.H. Nielsen, N. Billestrup, Characterization of the inhibitory effect of growth hormone on primary preadipocyte differentiation, Mol. Endocrinol. 12 (1998) 1140–1149. S.E. Schadinger, N.L. Bucher, B.M. Schreiber, S.R. Farmer, PPARgamma2 regulates lipogenesis and lipid accumulation in steatotic hepatocytes, Am. J. Physiol. Endocrinol. Metab. 288 (2005) E1195–E1205. M. Nakamuta, M. Kohjima, S. Morizono, K. Kotoh, T. Yoshimoto, I. Miyagi, M. Enjoji, Evaluation of fatty acid metabolism-related gene expression in nonalcoholic fatty liver disease, Int. J. Mol. Med. 16 (2005) 631–635. T. Ichikawa, K. Hamasaki, H. Ishikawa, E. Ejima, K. Eguchi, K. Nakao, Non-alcoholic steatohepatitis and hepatic steatosis in patients with adult onset growth hormone deficiency, Gut 52 (2003) 914. P. Costet, C. Legendre, J. More, A. Edgar, P. Galtier, T. Pineau, Peroxisome proliferator-activated receptor alpha-isoform deficiency leads to progressive dyslipidemia with sexually dimorphic obesity and steatosis, J. Biol. Chem. 273 (1998) 29577–29585. T. Sakuma, R. Honma, S. Maguchi, H. Tamaki, N. Nemoto, Different expression of hepatic and renal cytochrome P450s between the streptozotocin-induced diabetic mouse and rat, Xenobiotica 31 (2001) 223–237. A. Enriquez, I. Leclercq, G.C. Farrell, G. Robertson, Altered expression of hepatic CYP2E1 and CYP4A in obese, diabetic ob/ ob mice, and fa/fa Zucker rats, Biochem. Biophys. Res. Commun. 255 (1999) 300–306. I.A. Leclercq, G.C. Farrell, J. Field, D.R. Bell, F.J. Gonzalez, G.R. Robertson, CYP2E1 and CYP4A as microsomal catalysts of lipid peroxides in murine nonalcoholic steatohepatitis, J. Clin. Invest. 105 (2000) 1067–1075.