Improve Ethanol Yield Through Minimizing Glycerol Yield in Ethanol Fermentation of Saccharomyces cerevisiae

Chinese Journal of Chemical Engineering, 16(4) 620ü625 (2008)

Improve Ethanol Yield Through Minimizing Glycerol Yield in Ethanol Fermentation of Saccharomyces cerevisiae* ZHANG Aili (჆̙ॆ) and CHEN Xun (чᘫ)**

School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072, China

Abstract In ethanol fermentation of Saccharomyces cerevisiae (S. cerevisiae), glycerol is one of the main by-products. The purpose of this investigation was to increase ethanol yield through minimizing glycerol yield by using mutants in which FPS1 encoding a channel protein that mediates glycerol export and GPD2 encoding one of glycerol-3-phosphate dehydrogenase were knocked-out using one-step gene replacement. GLT1 and GLN1 that encode glutamate synthase and glutamine synthetase, respectively, were overexpressed using two-step gene replacement in fps1¨gpd2¨ mutant. The fermentation properties of ZAL69(fps1¨::LEU2 gpd2¨::URA3) and ZAL808 (fps1¨::LEU2 gpd2¨::URA3 PPGK1-GLT1 PPGK1-GLN1) under microaerobic conditions were investigated and compared with those of wild type(DC124). Consumption of glucose, yield of ethanol, yield of glycerol, acetic acid, and pyruvic acid were monitored. Compared with wild type, the ethanol yield of ZAL69 and ZAL808 were improved by 13.17% and 6.66 %, respectively, whereas glycerol yield decreased by 37.4 % and 41.7 %. Meanwhile, acetic acid yield and pyruvic acid yield decreased dramatically compared to wild type. Our results indicate that FPS1 and GPD2 deletion of S. cerevisiae resulted in reduced glycerol yield and increased ethanol yield, but simultaneous overexpression of GLT1 and GLN1 in fps1¨gpd2¨ mutant did not have a higher ethanol yield than fps1¨gpd2¨ mutant. Keywords Saccharomyces cerevisiae, ethanol yield, glycerol yield, gene knock-out, gene over-express, FPS1, GPD2, GLN1, GLT1

1

INTRODUCTION

In ethanol fermentation of Saccharomyces cerevisiae (S. cerevisiae), in addition to biomass and carbon dioxide, a number of byproducts are produced, such as glycerol and organic acids (e.g., acetic acid and pyruvic acid, succinic acid). Approximately 5% carbon source is converted into glycerol in ethanol fermentation. Eliminating formation of glycerol can be used to increase ethanol yield of S. cerevisiae without increasing the overall cost of carbon source. Fig. 1 presents important pathways of glycerol and ethanol metabolism in S. cerevisiae. Glycerol formation has two roles in the fermentation of S. cerevisiae [1]. Under anaerobic fermentations when the respiratory chain is not functioning, net formation of NADH produced during synthesis of biomass and organic acids, i.e., acetic acid, and pyruvic acid, must be reoxidized to NAD+ by formation of glycerol in order to avoid a serious imbalance in the NAD+/NADH ratio. Synthesis of 1 mol glycerol from glucose leads to reoxidation of 1 mol NADH. Furthermore, during growth under osmotic stress conditions, glycerol is formed and accumulated inside the cell where it works as an efficient osmolyte that protects the cell against lysis. The yield of glycerol is controlled by its biosynthetic pathway as well as by regulated transmembrane transport systems. Glycerol is produced from the glycolytic intermediate dihydroxyacetone phosphate in two steps catalyzed by NAD+-dependent glycerol-3phosphate dehydrogenase and glycerol-3-phosphate phosphatase. Both enzymes are encoded by two similar isogenes, GPD1 plus GPD2 and GPP1 plus GPP2, respectively. Expression of GPD1 and GPP2 is induced by high osmolarity, whereas that of GPD2 and

GPP1 is stimulated under anaerobic conditions [26]. Glycerol-3-phosphate dehydrogenase, and not glycerol phosphatase, is rate-limiting for glycerol production in S. cerevisiae [7]. Ammonium is often used as nitrogen source in industrial fermentations of S. cerevisiae. Transported across the membrane into the cytoplasm, ammonium is assimilated into glutamate by reaction with Į-oxoglutarate. This consists of two coupled reactions, catalyzed by glutamate synthase (GOGAT) (Reaction 1), encoded by GLT1, and glutamine synthetase (GS) (Reaction 2), encoded by GLN1. The expression and regulation of glutamate synthase (GOGAT) have been reported. Į-oxoglutarate + glutamine + NADH  o glutamate + NAD+ glutamate

+ NH 4

(1)

+ ATP  o gutamine + ADP + Pi (2)

Į-oxoglutarate

+ NH 4

+ NADH + ATP  o

(3) glutamate + NAD+ + ADP + Pi By over-expressing both GLT1 and GLN1 it should be possible to convert NADH to NAD+ in the synthesis of glutamate from ammonium and 2-oxoglutarate resulting in a reduced surplus formation of NADH and, thus, a lower glycerol production. The genetically modified strain probably will have an additional requirement for synthesis of ATP because Reaction 2 requires ATP. Presumably the larger drain of ATP will be compensated by a higher ethanol production [8]. Strategies had been used for construction of higher ethanol yield strains of S. cerevisiae, for example, deletion of GPD1 and GPD2 which encode glycerol-3-phosphate dehydrogenase resulting higher

Received 2007-08-13, accepted 2008-03-26. * Supported by the National High Technology Research and Development Program of China (2002AA647040). ** To whom correspondence should be addressed. E-mail: [email protected]

Chin. J. Chem. Eng., Vol. 16, No. 4, August 2008

621

Figure 1 Important pathways of glycerol and ethanol metabolism in S. cerevisiave important enzyme: 1ühexokinase (glucokinase); 2üphosphoglucose isomerase; 3üphasphofructokinase; 4üaldolase; 5ütriose phosphate isomerase; 6üNAD-dependent glycerol-3-phosphate dehydrogenase; 7üglycerol-3-phosphatase; 8üglycerolaldehyd-3-phosphate dehydrogenase; 9üphosphoglycerate kinase; 10üphosphoglycerate mutase; 11ü enolase; 12üpyruvate kinase; 13üpyruvate decarboxylase; 14üalcohol dehydrogenase; 15üaldehyde dehydrogenase; 16üglycerol kinase; 17üFAD-dependent glycerol-3-phosphate dehydrogenase

ethanol yield [911], deletion of FPS1 to increase ethanol yield [12], and simultaneous overexpression of GLT1 and GLN1 resulting in higher ethanol yield [8]. But there have been no reports about the applications of deletion of both FPS1 and GPD2 or simultaneous overexpression of GLT1 and GLN1 in fps1¨gpd2¨ mutant. Hence, the purpose of this study was to investigate whether deletion of both FPS1 and GPD2 or simultaneous overexpression of GLT1 and GLN1 in fps1¨gpd2¨ mutant would result in reduced glycerol yield and higher ethanol yield. 2 2.1

MATERIALS AND METHODS Yeast strains and media

The Saccharomyces cerevisiae strains used in this study were all isogonics to DC124 as described in Table 1. The strains of S. cerevisiae cells were routinely grown in medium containing 2% peptone and 1% yeast extract supplemented with 2% glucose as carbon source (YPD). Selective media SC [13] minus leucine or uracil were used for selection of transformants containing LEU2 or URA3 selective marker.

2.2

Plasmids and strains constructions

The primers and plasmids used in this study were described in Table 2 and Table 3, respectively. 2.3

Deletion of GPD2

Primer KGPD2-U containing nucleotides 40 to 1 upstream of the ATG start codon of GPD2 at the 5’ end and 20 nucleotides of the YEplac195 at the 3’ end, and KGPD2-D containing nucleotides 1363 to 1324 of the complementary strand downstream of the ATG start codon of GPD2 at the 5’ end and 20bp nucleotides of the complementary strand of the YEplac195 at the 3’ end, were used to clone a 1.36kb fragment containing the open reading frame of URA3 by PCR with the Taq DNA polymerase (TAKARA). The PCR products were transformed into yeast, and the transformation mixture were incubated on SC minus uracil plates for 23 d. Correct deletion of GPD2 was verified by PCR analysis and the PCR products were digested with EcoR I. For this purpose, primers CGPD2-U containing restriction enzyme site for Xba I and BamH I in front of nucleotides 486 to 467

622

Chin. J. Chem. Eng., Vol. 16, No. 4, August 2008

Table 1

Strains used in this study

Strain

Complete genotype

Reference or source

DC124 (isogenic. to SP1)

MatĮ leu2 ura3 trp1 his3 ade8 can1

M. Wigler (Cold Spring Harbor, NY, USA)

L-2

MatĮ leu2 ura3 trp1 his3 ade8 can1 fps1ǻ:: LEU2

Zhang et al. [12]

ZAL69

MatĮ leu2 ura3 trp1 his3 ade8 can1 fps1ǻ:: LEU2 gpd2ǻ::URA3

this work

ZAL808

MatĮ leu2 ura3 trp1 his3 ade8 can1 fps1ǻ:: LEU2 gpd2ǻ::URA3 PPGK1-GLT1 PPGK1-GLN1

this work

Table 2

Primers used in this study Oligonucleotide

Primer name KGPD2-U

5’CTCTTTCCCTTTCCTTTTCCTTCGCTCCCCTTCCTTATCAGTAGTCTAGTACTCCTGTG3’

KGPD2-D

5’GCAACAGGAAAGATCAGAGGGGGAGGGGGGGGGAGAGTGTGAAAAGTGCCACCTGACGTC3’

CGPD2-U

5’TCTAGAGGATCCATAGCCATCATGCAAGCGTG3’ (Xba I and BamH I)

CGPD2-D

5’TAGCGCTCTTATCTCAGTGG3’

Glt1-U

5’GGGCCCGTCGACATGCCAGTGTTGAAATCAGA3’ (Sal I)

Glt1-D

5’ GGGCCCCTGCAGTTTTAGTATCGACCATTTCA3’ (Pst I)

Glt1prom.-U

5’GGGCCCGGTACCTTTCTGAGCA CTGTCAGGAG3’ (Kpn I)

Glt1prom.-D

5’GGGCCCGGATCCTGATTTCAACAC TGGCATGC3’ (BamH I)

PGK1 prom.-U

5’GGGCCCGGATCCAGGCATTTGCAAGAATTACTC3’ (BamH I)

PGK1 prom.-D

5’GGGCCCGTCGACTGTTTTATATTTGTTGTAAAAAGTAG3’ (Sal I)

Gln1 P-U

5’GGGCCCGAGCTCGACCCATTTTTCTCAGCGCC3’ (Sac I)

Gln1 P-D

5’GGGCCCAGATCTTCGATGCTTG CTTCAGCCAT3’ (Bgl II)

Gln1-U

5’GGGCCCGTCGACATGGCTGAAGCAAGCATCGA3’ (Sal I)

Gln1-D

5’ GGGCCCCTGCAGATATACAACACAGCG TCGCT3’ (Pst I)

Table 3

Plasmids used in this study

Plasmids name

Description

Reference or source

YEplac195

Ampr,URA3

Gietz et al. [14]

r

YIplac211

Amp ,URA3

Gietz et al. [14]

YIplac211-p-GLN1

Ampr,URA3

this work

YIplac211-p-GLT1

r

Amp ,URA3

this work

upstream of the ATG start codon of GPD2, and CGPD2-D containing nucleotides 1693 to 1674 of the complementary strand downstream of the ATG start codon of GPD2 were used. 2.4

Overexpression of GLT1

Primer Glt1-U, containing restriction enzyme site for Sal I in front of nucleotides 1 to 20 downstream of the ATG start codon of GLT1, and Glt1-D containing restriction enzyme site for Pst I in front of nucleotides 1390 to 1371 of the complementary strand downstream of the start codon of GLT1, were used to clone parts of the structure gene of GLT1 by PCR with the Pyrobest DNA polymerase (TARARA). The fragment was digested with Sal I and Pst I and ligated into the Sal I and Pst I digestion sites of the plasmid YIplac211, resulting in the plasmid YIplac211-GLT1

truncation. Primer Glt1prom.-U containing restriction enzyme site for Kpn I in front of nucleotides 920 to 911 upstream of the ATG start codon of GLT1, and Glt1prom.-D containing restriction enzyme site for BamH I in front of nucleotides of the complementary strand from18bp downstream of the ATG start codon to 2bp upstream of the ATG start codon of GLT1, were used to clone parts of the promoter sequence of GLT1 by PCR with the Pyrobest DNA polymerase (TARARA).The fragment was digested with Kpn I and BamH I , and ligated into the Kpn I and BamH I digestion sites of the plasmid YIplac211-GLT1 truncation, resulting in the plasmid YIplac211-GLT1 truncation-GLT1 promoter. PGK1 prom.-U, containing restriction enzyme site for BamH I in front of nucleotides 721 to 701 upstream of the start codon of PGK1, and PGK1 prom.-D containing restriction enzyme site for Sal I in front of nucleotides 26 to 1 of the complementary strand upstream of the start codon of PGK1, were used to clone parts of the promoter gene of PGK1 by PCR with the Pyrobest DNA polymerase (TARARA). The fragment was digested with Sal I and BamH I , and ligated into the Sal I and BamH I digestion sites of the plasmid YIplac211GLT1 truncation, resulting in the plasmid YIplac211p-GLT1. The plasmid was linearized by digestion with Bgl II before transformation of yeast to SC minus uracil medium plates. Correct insertion of the plasmid into the GLT1 locus on chromosome IV was verified by PCR. For these purpose primers Glt1 prom.-U and

Chin. J. Chem. Eng., Vol. 16, No. 4, August 2008

Glt1-D were used. Loop-out of the URA3 marker gene by homologous recombination of the two direct GLT1 promoter sequence was obtained by cultivating the correct transformations on 5-FOA plates. Correct loop-out of the URA3 gene was verified by PCR, and the primers Glt1 prom.-U and Glt1-D were used. 2.5

Overexpression of GLN1

Gln1 P-U containing restriction enzyme site for Sac I in front of nucleotides 1192 to 1173 upstream of the ATG start codon of GLN1, and Gln1P-D containing restriction enzyme site for Bgl II in front of nucleotides 20 to 1 of the complementary strand downstream of the ATG start codon of GLN1, were used to clone parts of the promoter gene of GLN1 by PCR with the Pyrobest DNA polymerase(TARARA).The fragment was digested with Sac I and Bgl II , and ligated into the Sac I and Bgl II digestion sites of the plasmid YIplac211, resulting in the plasmid YIplac211-GLN1 promoter. Primer Gln1-U containing restriction enzyme site for Sal I in front of nucleotides 1 to 20 of downstream of the ATG start codon( +1 bp to +20 bp)of GLN1, and Gln1-D containing restriction enzyme site for Pst I in front of nucleotides 1400 to 1381 of the complementary strand downstream of the ATG start codon of GLN1, were used to clone the structure gene of GLN1 by PCR with the Pyrobest DNA polymerase (TARARA).The fragment was digested with Sal I and Pst I , and ligated into the Sal I and Pst I digestion sites of the plasmid YIplac211-GLN1 promoter, resulting in the plasmid YIplac211-GLN1 ORF-GLN1 promoter. PGK1 prom.-U containing restriction enzyme site for BamH I in front of nucleotides 721 to 701 upstream of the start codon of PGK1, and PGK1 prom.-D containing restriction enzyme site for Sal I in front of nucleotides 26 to 1 of the complementary strand upstream of the start codon of PGK1, were used to clone parts of the promoter gene of PGK1 by PCR with the Pyrobest DNA polymerase (TARARA). The fragment was digested with Sal I and BamH I , and ligated into the Sal I and BamH I digestion sites of the plasmid YIplac211-GLN1 truncation, resulting in the plasmid YIplac211-p-GLN1. The plasmid was linearized by digestion with Kpn I before transformation of yeast to SC minus uracil medium plates. Correct insertion of the plasmid into the GLN1 locus on chromosome XVI was verified by PCR. For these purposes primers Gln1 prom.-U and Gln1-D were used. Loop-out of the URA3 gene by homologous recombination of the two direct GLN1 promoter sequence was obtained by cultivating the correct transformations on 5-FOA plates. Correct loop-out of the URA3 gene was verified by PCR, and the primers Gln1 prom.-U and Gln1-D were used. 2.6 Growth conditions and experimental procedures Incubation conditions were standardized at 30°C ˉ and 200 r·min 1 orbital shaking. Standard techniques were applied as described in Ref. [15] for all gene clon-

623

ing experiments. DNA fragments were purified using DNA recycle kits and PCR products were purified using phenol deproteinization and ethanol precipitation. Restriction and modification enzymes were used according to the manufacturers’ instruction. Yeast transformation was performed by the lithium acetate method. Escherichia coli Top10’ was used for subcloning. All yeast strains were maintained at 4°C on YPD plates (containing 2% peptone and 1% yeast extract supplemented with 2% glucose as carbon source), and monthly prepared from a glycerol stock kept at ˉ75°C. 2.7

Fermentation conditions

Microanaerobic cultivations were performed at 30°C in the 250 ml unbaffled shake flasks kept at conˉ stant stirring speed of 100 r·min 1 with 100 ml medium (containing 2% peptone and 1% yeast extract supplemented with 6% glucose as carbon source). Initial biomass concentrations were set at OD660nm 1.0 after inoculation. Fermentation experiments were performed in triplicate and one representative experiment was shown. 2.8

Growth determination

Growth was followed by measuring the absorbance of the cultures at 660 nm in a Bioquest CE2502 spectrophotometer (Progen Scientific Ltd, UK). 2.9 Measurement of glucose, ethanol, glycerol, acetic acid, and pyruvic acid [16] The samples (1.5 ml each) were centrifuged for 5 min at 18000 g and the resulting supernatants were frozen (ˉ20°C) until analysis. The contents of glycerol and glucose in the fermentation broth were determined by HPLC using differential refractive index detector and Agilent ZORBAX carbohydrate column (Agilent Technologies Co. Ltd, Beijing, China) eluted ˉ by 75% acetonitrile with 1.0 ml·min 1. The content of acetic acid and ethanol was determined using a gas chromatograph (Shimadzu GC-2010) with a DB-WAX capillary column and a FID detector (Flame Ionization Detector). The temperatures of inlet, oven, and detector were kept at 200°C, 150°C and 200°C, respectively. The content of pyruvic acid was determined using an RP18 column (Waters, Milford, USA) eluted with 0.1 ˉ ˉ mol·L 1 KH2PO4 (pH 3.0) at a flow rate of 0.6 ml·min 1 at 30°C and a PDA (Photodiode Array) detector. 2.10

Determination of biomass concentration

Samples (50 ml) were centrifuged at 5000 g for 10 min and washed twice with water, and subsequently the pellets were kept at 110°C for 24 h and weighed after cooling. 3

RESULTS The fermentation properties of DC124 (wild

624

Chin. J. Chem. Eng., Vol. 16, No. 4, August 2008

type), ZAL69, and ZAL808 were studied under microaerobic condition. As described in Fig. 2, the growth of ZAL808 is slower than DC124, but the growth of ZAL69 fast than DC124. According to Table 4, the biomass concentration of ZAL69 and ZAL808 did not have great change compared to that of wild type.

ZAL808 decreased 63.4% and 68.8 %, respectively, as shown in Table 4. Pyruvic acid yield of ZAL69 and ZAL808 decreased 61.1% and 54% as shown in Table 4. However, glucose consumption profiles of ZAL69 mutant were similar compared with wild type during the growth phases according to Fig. 3 (c), but the glucose consumption profiles of ZAL808 lagged a little. 4

Figure 2 The biomass concentrations of strains DC124 (Ƹ), ZAL69 (ƶ) and ZAL808 (ƹ) during exponential growth in the microaerobic conditions

As given in Fig. 3 (a), ethanol yield of ZAL69 and ZAL808 did not shows great changes compared with DC124 during the first ten hours of the fermentations, but increased sharply during the following hours. At the end point of the fermentations (24 h), ethanol yield of ZAL69 and ZAL808 was improved by13.17% and 6.66%, respectively. As shown in Fig. 3 (b), glycerol yield of ZAL69 and ZAL808 decreased significantly during the fermentations, and at the end point of the fermentations (24 h), glycerol yield of ZAL69 and ZAL808 decreased by 37.4% and 41.7 % compared with DC124. Meanwhile, acetic acid yield of ZAL69 and

(a)

DISCUSSION

Investigations on improving ethanol yield by FPS1 deletion of S. cerevisiae have been reported recently [12]. Other strategies had been used for construction of higher ethanol-producing yield strains of S. cerevisiae, for example, deletion of GPD1 and GDP2 that encode glycerol-3-phosphate dehydrogenase result in higher ethanol yield [911], and simultaneous over-expression of GLT1 and GLN1 result in higher ethanol yield [8]. But there have been no reports about the applications of deletion of both FPS1 and GPD2 or simultaneous overexpression of GLT1 and GLN1 in fps1¨gpd2¨ mutant. In this study, the effects of deletion of both FPS1 and GPD2 or simultaneous over-expression of GLT1 and GLN1 in fps1¨gpd2¨ mutant on the fermentation properties were investigated. The strain ZAL69 and ZAL808, along with wild type strain DC124, were characterized with respect to several parameters (Table 4). There was an increase in ˉ the maximum specific growth rate from 0.1276 h 1 in ˉ1 strain DC124 to 0.1342 h in strain ZAL69, but the ˉ maximum specific growth rate decreased to 0.1253 h 1 in strain ZAL808 (Fig. 2, Table 4). This result was further more supported by the fact that the consumption of glucose in ZAL808 lagged a little compared to DC124 [Fig. 3 (c)]. Similarly, the biomass content in

(b)

(c)

Figure 3 Time course of the measured parameters during microanaerobic conditions of S. cerevisiae DC124 (Ƹ), ZAL69 (ƶ), ZAL808 (ƹ), with 6% glucose as carbon and energy source Table 4

Comparison of growth and compound yields of DC124, ZAL69 and ZAL808 in batch fermentations Specific growth ķ ˉ rate /h 1

Biomass concentraˉ tion/g·(100 ml) 1

Glycerol yield ˉ /g·(100 ml) 1

Ethanol yield/ ˉ g·(100 ml) 1

Acetic acid yield ˉ /g·(100 ml) 1

Pyruvic acid yield ˉ /g·(100 ml) 1

DC124

0.1276

0.66f0.002

0.211f0.01

2.62f0.005

0.093f0.005

1.6287f0.02

ZAL69

0.1342

0.688f0.0021

0.132f0.01

2.965f0.005

0.034f0.005

0.5521f0.02

ZAL808

0.1253

0.68f0.018

0.123f0.01

2.794f0.005

0.029f0.005

0.75f0.02

Note: Standard deviations were calculated for at least three independent fermentations. ķCalculated using measurements of optical density at 660 nm.

Chin. J. Chem. Eng., Vol. 16, No. 4, August 2008

all three strains remained virtually unchanged (Table 4). Taken together, these results suggest that the cellular metabolic and biosynthetic pathways of ZAL69 and ZAL808 did not dramatically change compared to DC124. When FPS1 and GPD2 which encode glycerol export channel protein Fps1p and one of the two isoenzymes for yeast NAD+-dependent glycerol-3phosphate dehydrogenase Gpd2p of S. cerevisiae, respectively, were knocked-out, and glycerol biosynthesis and export were hampered. Glycerol yield might be decreased. Glycerol is one of the main by-products of ethanol fermentations and the decreased glycerol yield might be useful for increasing ethanol yield. Our investigations verified this. The ethanol yield and glycerol yield of ZAL69 increased 9.81% and decreased 37.4%, respectively (Table 4). This suggests that the substrate that would be used to form glycerol has been used to produce more ethanol by deletion of both FPS1 and GDP2. Because the two isoenzymes for yeast NAD+-dependent glycerol-3-phosphate dehydrogenase Gpd1p and Gpd2p can substitute each other, in the fps1¨gpd2¨ mutants (ZAL69) Gpd1p is active, and the cells have the ability to biosynthesis some glycerol to keep the redox balance and adapt to the osmotic stress conditions. The increased maximum specific growth rate of ZAL69 further more supported this. The ethanol yield and glycerol yield of ZAL808 increased 6.66% and decreased 41.7%, respectively. This suggested that simultaneous over-expression of GLT1 and GLN1 in fps1¨gpd2¨ mutant can increase ethanol yield compared with wild type. But the ethanol yield of ZAL808 is lower than that of ZAL69. One possibility might be that the combined effects of deletion of FPS1 and GDP2, and over-expression of GLN1 and GLT1 of S. cerevisiae to improve ethanol yield are not useful. As shown in Table 4, compared with wild type, acetic acid yield of ZAL69 and ZAL808 decreased 63.4% and 68.8%, respectively, and the pyruvic acid yield of ZAL69 and ZAL808 decreased 61.1 % and 54%. The decrease of acetic acid and pyruvic acid yield are the examples of a metabolic regulation by the cells to minimize the NADH surplus when glycerol synthesis capacity is hampered. According to metabolic flux analysis of Saccharomyces cerevisiae [17], when glycerol yield, acetic acid yield, and pyruvic acid yield decreased, the metabolism must shift towards ethanol. In our research, glycerol yield, acetic acid yield, and pyruvic acid yield of ZAL69 and ZAL808 decreased dramatically, whereas ethanol yield of ZAL69 and ZAL808 increased 9.81% and 3.48%, which verified the metabolic flux analysis of Nissen et al. [17]. In conclusion, our research demonstrates that ethanol yield of ZAL69 and ZAL808 increased 13.17% and 6.66%, respectively, whereas the glycerol yield, acetic acid yield, and pyruvic acid yield of ZAL69 and ZAL808 decreased dramatically. The ethanol yield of strain ZAL808 (fps1¨::LEU2 gpd2¨::URA3 PPGK1-GLT1 PPGK1-GLN1) was higher than that of DC124, but was lower than ZAL69

625

(fps1¨::LEU2 gpd2¨::URA3). In summary, the present study has demonstrated the proposed concept to increase the ethanol yield by minimizing glycerol yield under microaerobic conditions through deletion both FPS1 and GPD2 of S. cerevisiae. REFERENCES 1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

Nevoigt, E., Stahl, U., “Osmoregulation and glycerol metabolism in the yeast Saccharomyces cerevisiae”, FEMS Microbiol. Rev., 21, 231241 (1997). Albertyn, J., Hohmann, S., Thevelein, J.M., Prior, B.A., “GPD1, which encodes glycerol-3-phosphate dehydrogenase, is essential for growth under osmotic stress in Saccharomyces cerevisiae, and its expression is regulated by the high-osmolarity glycerol response pathway”, Mol. Cell Biol., 6, 41354144 (1994). Ansell, R., Granath, K., Homann, S., Thevelein, J.M., Adler, L., “The two isoenzymes for yeast NAD+-dependent glycerol-3-phosphate dehydrogenase encoded by GPD1 and GPD2 have distinct roles in osmoadaptation and redox regulation ”, EMBO J., 16, 21792187 (1997). Eriksson, P., Andre, L., Ansell, R., Blomberg, A., Adler, L., “Cloning and characterization of GPD2, a second gene encoding glycerol-3-phosphate dehydrogenase (NAD+) in Saccharomyces cerevisiae, and its comparison with GPD1 ”, Mol. Microbiol., 1, 95107 (1995). Martijn, R., Albertyn, J., Thevelein, J.M., “Different signaling pathways contribute to the control of GPD1 gene expression by osmotic stress in Saccharomyces cerevisiae”, Microbiol., 145, 715727 (1999). Ohmiya, R., Yamada, H., Nakashima, K., Aiba, H., Mizuno, T., “Osmoregulation of fission yeast: Cloning of two distinct genes encoding glycerol-3-phosphate dehydrogenase, one of which is responsible for osmotolerance for growth”, Mol. Microbiol., 5, 963973 (1995). Remize, F., Barnavon, L., Dequin, S., “Glycerol export and glycerol-3-phosphate dehydrogenase, but not glycerol phosphatase, are rate limiting for glycerol production in Saccharomyces cerevisiae ”, Metab. Eng., 3, 301312 (2001). Nissen, T.L., Kielland-Brandt, M.C., Nielsen, J., Villadsen, J., “Optimization of ethanol production in Saccharomyces cerevisiae by metabolic engineering of the ammonium assimilation”, Metab. Eng., 2, 6977 (2000). Bakker, B.M., Overkamp, K.M., van Maris, A.J., Kötter, P., Luttik, M.A., van Dijken, J.P., Pronk, J.T., “Stoichiometry and compartmentation of NADH metabolism in Saccharomyces cerevisiae”, FEMS Microbiol. Rev., 25, 1537 (2001). Nissen, T.L., Hamann, C.W., Kielland-Brandt, M.C., Nielsen, J., Villadsen, J., “Anaerobic and aerobic batch cultivations of Saccharomyces cerevisiae mutants impaired in glycerol synthesis”, Yeast, 16, 463474 (2000). Valadi, H., Larsson, C., Gustafsson, L., “Improved ethanol production by glycerol-3-phosphate dehydrogenase mutants of Saccharomyces cerevisiae”, Appl. Microbiol. Biotechnol., 4, 434439 (1998). Zhang, A., Kong, Q., Cao, L., Chen, X., “Effect of FPS1 deletion on the fermentation properties of Saccharomyces cerevisiae”, Lett. Appl. Microbiol., 44 (2), 212217 (2007). Burke, D., Dawson, D., Stearns, T., Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual, Cold Spring Harbor Laboratory Press, New York, 174 (2000). Gietz, R.D., Sugino, A., “New yeast Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites”, Gene, 74, 525534 (1988). Sambrook, J., Fritsch, E.F., Maniatis, T., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, New York (1989). Kong, Q.X., Cao, L.M., Zhang, A.L., Chen, X., “Overexpressing GLT1 in gpd1ǻ mutant to improve the production of ethanol of Saccharomyces cerevisiae”, Appl. Microbiol. Biotechnol., 73, 13821386 (2007). Nissen, T.L., Schulze, U., Nielsen, J., Villandsen, J., “Flux distributions in anaerobic, glucose-limited continuous cultures of Saccharomyces cerevisiae”, Microbiol., 143, 203218 (1997).