Improved fermentative production of the compatible solute ectoine by Corynebacterium glutamicum from glucose and alternative carbon sources

Accepted Manuscript Title: Improved fermentative production of the compatible solute ectoine by Corynebacterium glutamicum from glucose and alternative carbon sources Authors: Fernando P´erez-Garc´ıa, Christian Ziert, Joe Max Risse, Volker F. Wendisch PII: DOI: Reference:

S0168-1656(17)30202-X http://dx.doi.org/doi:10.1016/j.jbiotec.2017.04.039 BIOTEC 7882

To appear in:

Journal of Biotechnology

Received date: Revised date: Accepted date:

18-12-2016 30-4-2017 30-4-2017

Please cite this article as: P´erez-Garc´ıa, Fernando, Ziert, Christian, Risse, Joe Max, Wendisch, Volker F., Improved fermentative production of the compatible solute ectoine by Corynebacterium glutamicum from glucose and alternative carbon sources.Journal of Biotechnology http://dx.doi.org/10.1016/j.jbiotec.2017.04.039 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Improved fermentative production of the compatible solute ectoine by Corynebacterium glutamicum from glucose and alternative carbon sources Fernando Pérez-Garcíaa,&, Christian Zierta,&,§, Joe Max Risseb, Volker F. Wendischa,# &

Both authors contributed equally.

§ current address: Eurofins Medigenomix Forensik GmbH a

Genetics of Prokaryotes, Faculty of Biology & CeBiTec, Bielefeld University, Universitätsstr. 25, 33615

Bielefeld, Germany b

Fermentation Technology, Technical Faculty & CeBiTec, Bielefeld University, Universitätsstr. 25, 33615

Bielefeld, Germany #Corresponding

author: Volker F. Wendisch, Chair of Genetics of Prokaryotes, Faculty of Biology &

CeBiTec, Bielefeld University, Germany; phone: +49-521-106 5611; fax: +49-521-106 5626; [email protected]

Highlights   

Ectoine production by Corynebacterium glutamicum with highest reported yield Avoidance of L-lysine export led to production of pure ectoine Ectoine production from alternative non-native carbon sources established

ABSTRACT The cyclic amino acid ectoine is a compatible solute serving as a protective substance against osmotic stress. Ectoine finds various applications due to its moisturizing effect. To avoid the disadvantages of the prevailing so-called “bacterial milking ectoine production process” caused by the high salt concentration, low salt fermentation strategies are sought after. As L-lysine and ectoine biosynthesis share L-aspartate-semialdehyde as common precursor, L-lysine producing strains can be converted to ectoine producing strains. Corynebacterium glutamicum, which is used for L-lysine production in the million-ton-scale, was engineered for ectoine production by heterologous expression of the ectoine biosynthesis operon ectABC from Chromohalobacter salexigens. Derepression of glucose metabolism by deletion of the regulatory gene sugR and avoiding L-lactate formation by deletion of the lactate dehydrogenase gene ldhA increased ectoine productivity. In bioreactor fed-batch cultivations an ectoine titer of 22 g L-1 and a volumetric productivity of 0.32 g L-1 h-1 were obtained. The ectoine yield of 0.16 g g -1, to the best of our knowledge, exceeded previously reported yields. Moreover, ectoine production from the alternative carbon sources glycerol, glucosamine, xylose, arabinose, and soluble starch was achieved.

1. INTRODUCTION Ectoine is a compatible solute that was first discovered in Halorhodospira halochloris, but is widespread among γ-proteobacteria like Halomonas and Chromohalobacter, actinobacteria like Brevibacterium and Streptomyces or firmicutes like Bacillus and Marinococcus (Galinski et al., 1985; Kuhlmann and Bremer, 2002; Louis and Galinski, 1997; Onraedt et al., 2005). In three enzymatic steps ectoine is synthesized from L-aspartate-semialdehyde, an intermediate of Llysine biosynthesis. Glutamate is the amino group donor for the transamination of L-aspartatesemialdehyde by diaminobutyrate transaminase (EctB) to diaminobutyrate, which is subsequently acetylated by diaminobutyrate acetyl transferase (EctA). In the last step, ring closure of acetyl diaminobutyrate by ectoine synthase (EctC) yields ectoine. Hydroxylation of ectoine by ectoine hydroxylase (EctD) leads to hydroxyectoine, a related compatible solute which, for example, plays an important role in heat stress protection (García-Estepa et al., 2006). Ectoine has several protective functions on macromolecules, cells, or tissues since it was shown to improve protein folding and activity or to decrease the melting temperature of DNA. It is used in sun blockers to quench singlet oxygen derived from ultraviolet light, and was shown to moisturize human skin (Botta et al., 2008; Buenger and Driller, 2004; Heinrich et al., 2007; Pastor et al., 2010). Ectoine has been commercialized and is produced with Halomonas elongata by a process called “bacterial milking”. The natural producer H. elongata is cultivated under high salt conditions to induce ectoine synthesis to increase water activity within the cell. After reaching an appropriate cell density, a hypoosmotic shock is applied by addition of distilled water after reduction of the culture volume. This hypoosmotic shock induces the release of ectoine to the culture medium in order to reduce the water activity within the cell. The product is separated

from the cells which are recycled for repeated growth in fresh medium under high salt conditions (Sauer and Galinski, 1998). Subsequently, a two-reactor system was developed for C. salexigens, which maintains cells under optimal growth conditions in one bioreactor and constantly drains off culture to a second bioreactor, where the hypoosmotic shock is applied (Fallet et al., 2010). Both “bacterial milking” techniques have several drawbacks arising from the high salt media, thus, there was a need to develop a low-salt fermentation approach. A recombinant approach was possible since the biosynthesis of ectoine was studied in detail in H. halochloris, H. elongata and C. salexigens (Cánovas et al., 1998; Ono et al., 1999; Peters et al., 1990). The ectoine biosynthesis genes ectA, ectB and ectC are typically clustered on the genome co-transcribed as operons. Moreover, the basic ectABC gene cluster is frequently associated with an aspartokinase gene (Pastor et al., 2010; Widderich et al., 2014). If in addition to the basic ectABC gene cluster a gene encoding ectoine hydroxylase (ectD) is present in the organism, it may be part of the ectABC operon or may be present as a separate transcription unit somewhere else in the genome as in the case of C. salexigens. Since ectoine biosynthesis starts from L-aspartate-semialdehyde, an intermediate of L-lysine biosynthesis, L-lysine overproducing strains of the Gram-positive Corynebacterium glutamicum were considered as ectoine production hosts. C. glutamicum is genetically amenable and has been already engineered for the production of a very wide range of metabolites such as vitamins (Hüser et al., 2005), alcohols (Inui

et al., 2004; Jojima et al., 2015; Siebert and Wendisch, 2015; Wendisch et al., 2006), diamines like cadaverine (Mimitsuka et al., 2007) and putrescine (Schneider and Wendisch, 2010), organic acids (Litsanov et al., 2012; Okino et al., 2005; Tsuge et al., 2015; Wieschalka et al., 2013), and non-proteinogenic amino acids (Jorge et al., 2016a, 2016b; Kim et al., 2013; Pérez-García et al.,

2016). Since decades, C. glutamicum is used for the biotechnological amino acid production and especially for production of L-glutamate and L-lysine (Eggeling and Bott, 2015; Hermann, 2003; Lee et al., 2016; Wendisch et al., 2016). For example, the annual production of L-lysine exceeds 2 million tons (Hirasawa and Shimizu, 2016; Wendisch et al., 2016). Not surprisingly, C. glutamicum was used as a basis to engineer strains for the production of L-lysine-derived products such as cadaverine (Mimitsuka et al., 2007), L-pipecolic acid (Pérez-García et al., 2016) or -aminovalerate (Rohles et al., 2016). Recently, also an ectoine producing C. glutamicum strain has been described (Becker et al., 2013). In this work, C. glutamicum wild type was used as a basis and ectABCD from Pseudomonas stutzeri was integrated into the genome disrupting ddh, encoding the diaminopimelate dehydrogenase. Introduction of the amino acid exchange T311I in the lysC gene led to feedback-resistant aspartokinase and deletion of lysE avoided L-lysine export. In a fed-batch cultivation, this strain produced 4.5 g L-1 ectoine with a volumetric productivity of 0.28 g L-1 h-1 (Becker et al., 2013). Here, we describe ectoine producing C. glutamicum strains based on the previously described Llysine producing strains DM1800 and DM1729 (Georgi et al., 2005). Both, DM1800 and DM1729 possess L-lysine feedback-resistant aspartokinase (encoded by lysCT311I) (Kalinowski et al., 1991; Schrumpf et al., 1992) and a variant of pyruvate carboxylase (encoded by pycP458S) for increased provision of oxaloacetate as precursor for L-lysine biosynthesis (Peters-Wendisch et al., 2001). In addition, strain DM1729 possesses a mutated version of the homoserine dehydrogenase (encoded by homV59A). The resulting reduced homoserine dehydrogenase enzyme levels and reduced threonine concentrations improve L-lysine production and avoid conversion of Laspartate-semialdehyde in threonine and methionine biosynthesis (Eikmanns et al., 1991;

Follettie et al., 1988). To increase the glycolytic flux deletion of the genes coding for transcriptional repressor SugR (Engels et al., 2008; Engels and Wendisch, 2007; Gaigalat et al., 2007) and fermentative L-lactate dehydrogenase (Engels et al., 2008; Toyoda et al., 2009) were chosen as a suitable strategy (Pérez-García et al., 2016) (Figure 1). Upon expression of the ectoine biosynthetic genes from C. salexigens in this strain, efficient production of ectoine from glucose and the alternative carbon sources glycerol, glucosamine, xylose, arabinose, and soluble starch was established.

2. MATERIALS AND METHODS 2.1.

Bacterial strains and growth conditions

The strains and plasmids employed in this study are listed in Table 1. Escherichia coli DH5α (Hanahan, 1983) was used for the genetic engineering work of vector construction. C. glutamicum and E. coli were routinely grown in Brain-heart infusion broth (BHI) (ROTH®) in 500mL baffled flasks at 30 °C or 37 °C inoculated from a fresh LB agar plate. For growth experiments of C. glutamicum strains 50 mL of CGXII medium (Eggeling and Bott, 2005) with glucose 40 g L-1 was inoculated to an optical density (OD600) of 1 and routinely incubated at 30 °C and 120 rpm (shaking diameter: 16.5 cm) in 500 mL baffled flasks. Growth was followed by measuring the optical density using V-1200 Spectrophotometer at 600 nm (VWR, Radnor, PA, USA). C. glutamicum biomass calculations were done according to the correlation CDW = 0.353 OD (Bolten et al., 2007). E. coli cultures were routinely incubated at 37 °C and 200 rpm (shaking diameter: 16.5 cm) in 500 mL baffled flasks. When necessary, the growth medium was supplemented with kanamycin (25 μg mL-1), spectinomycin (100 μg mL-1), and/or tetracycline (5 μg mL-1). Isopropyl-β-D-1-thiogalactopyranoside (IPTG) was added when necessary to the minimal medium to induce gene expression from the vector pVWEx1 (Peters-Wendisch et al., 2001). 2.2.

In-frame deletion of sugR, ldhA, and lysE

All in-frame deletions of this work were performed following the two-steps homologous recombination procedure (Rittmann et al., 2003). For that purpose the vectors pK19mobsacBΔsugR (Engels and Wendisch, 2007), pK19mobsacB-ΔldhA (Blombach et al., 2011), and pK19mobsacB-ΔlysEG (Vrljic et al., 1996) were used as described elsewhere (Engels and

Wendisch, 2007). The deletions were verified by PCR using the primers ΔsugR-Ver-fw (GTTCGTCGCGGCAATGATTGACG), ΔsugR-Ver-rv (CTCACCACATCCACAAACCACGC), ΔldhA-Ver-fw (TGATGGCACCAGTTGCGATGT),

ΔldhA-Ver-rv

(CCATGATGCAGGATGGAGTA),

ΔlysE-Ver-fw

(CGCGAGCAAGGAGAGTACG), and ΔlysE-Ver-rv (AAATCAAGCAGCACTACTACA). 2.3.

Molecular genetic techniques and strains construction

Standard molecular genetic techniques were carried out as described elsewhere (Sambrook et al., 1989). E. coli were transformed by heat shock (Sambrook et al., 1989) and C. glutamicum by electroporation (Eggeling and Bott, 2005). The operon ectABC was amplified from C. salexigens DSM 3043T genomic DNA using the primers ectA-fw

(CAGGGATCCGAAAGGAGGCCCTTCAGATGACGCCTACAACCGAG)

and

ectC-rv

(CAGGGATCCTCAATCGACCGGTGCG) which carry the restriction site sequence for BamHI (underlined); ectA-fw also carries the RBS sequence (italics). The PCR product and the vector pVWEx1 were treated with BamHI and ligated as described elsewhere (Sambrook et al., 1989). The vector pVWEx1-ectABC was further used to transform C. glutamicum strains. 2.4.

Analytical procedures

For the quantification of extracellular amino acids, carbohydrates, and ectoine a high-pressure liquid chromatography system was used (1200 series, Agilent Technologies Deutschland GmbH, Böblingen, Germany). The supernatants of the cell cultures were collected by centrifugation (13,000 × g, 10 min), and further used for analysis. For detection of L-lysine and other amino acids, samples were derivatised with orthophthaldialdehyde (OPA) (Schneider and Wendisch, 2010). The amino acid separation was performed by a pre-column (LiChrospher 100 RP18 EC-5μ (40 mm × 4 mm), CS-Chromatographie

Service GmbH, Langerwehe, Germany) and a column (LiChrospher 100 RP18 EC-5μ (125 mm × 4 mm), CS Chromatographie Service GmbH). The detection was carried out with a fluorescence detector (FLD G1321A, 1200 series, Agilent Technologies) with the excitation and emission wavelengths of 230 nm and 450 nm, respectively. For quantification of carbohydrates, a column for organic acids (300 mm × 8 mm, 10 μm particle size, 25 Å pore diameter, CS Chromatographie Service GmbH) and a refractive index detector (RID G1362A, 1200 series, Agilent Technologies) was used (Peters-Wendisch et al., 2014). The detection of ectoine was performed isocratically in 80 % acetonitrile. The separation was performed in a Multospher APS-HP 5 μ Hilic column (125 mm x 4 mm, CS Chromatographie Service GmbH). The detection was carried out with the Diode Array Detector (DAD, 1200 series, Agilent Technologies) at 210 nm (Kuhlmann and Bremer, 2002). 200 μL of sample or standard was mixed with 800 μL of 100 % acetonitrile. 2.5.

Fed-batch fermentation

The production of ectoine by Ecto5 strain was evaluated in a fed-batch fermentation process. For that purpose, a baffled bioreactor with a total volume of 3.6 L was used (KLF, Bioengineering AG, Switzerland). The stirrer axis was equipped with three six-bladed rushton turbines in a distance of 6 cm, 12 cm, and 18 cm from the bottom of the bioreactor. The aspect ratio of the reactor was 2.6:1.0 and the stirrer to reactor diameter ratio was 0.39. By controlled addition of KOH (4 M) and phosphoric acid (10 % (w/w)) the pH was kept at 7.0. The temperature was also controlled and maintained at 30 °C. Stirrer speed was regulated to keep the relative dissolved oxygen saturation at 30 %. The fermentation was performed in overpressure conditions at 0.4 bar and constant 2.0 NL min-1 of air flow. Struktol® J647 was used as antifoam and added automatically

when necessary to avoid foaming. The bioreactor filled with 2 L medium was inoculated with 50 mL of overnight shake flask culture in complex medium BHI (ROTH®). Samples were collected every 3 hours by an autosampler and cooled down to 4 °C until use. Optical density, amino acids, and carbohydrates were further quantified. The fermentation medium contained per liter: 40 g (NH4)2SO4, 1.25 g KH2PO4, 1.125 mL H3PO4 (85 % (w/w)), 1 mL PKS-solution (30 mg mL−1 of 3,4-dihydroxybenzoic acid), 0.55 mL FeSO4-citrate solution (20 gL-1 FeSO4 heptahydrate and 20.2 gL-1 citrate monohydrate), 100 g D-glucose monohydrate, 7 mL vitamin solution (0.3 g L−1 biotin, 0.5 g L−1 thiamin hydrochloride, 2 g L−1 calcium pantothenate, and 0.6 g L−1 nicotinamide), 25 mg L-1 of kanamycin and 0.5 mM of IPTG (modified from (Becker et al., 2011)). The feed-medium contained per liter: 150 g L-1 D-glucose monohydrate, as well as 40 g L-1 (NH4)2SO4 (autoclaved separately), and 0.4 mL L-1 sterile filtered vitamin solution. The on-off feeding profile was activated when the relative dissolved oxygen signal raised from 30 % above 60 % for the first time.

3. RESULTS AND DISCUSSION 3.1.

Construction of L-lysine producing strains that can be converted to ectoine producing strains

L-aspartate-semialdehyde is an intermediate of L-lysine biosynthesis in C. glutamicum and, thus, L-lysine producing C. glutamicum strains are suitable as basis for ectoine producing strains since ectoine biosynthesis initiates with L-aspartate-semialdehyde. De‐bottlenecking L-lysine biosynthesis by feedback-resistant aspartokinase, improving precursor and redox cofactor supply and avoiding by-product formation are known strategies to improve L-lysine production by C. glutamicum (Becker et al., 2013, 2011; Blombach et al., 2009; Cremer et al., 1991; Kabus et al., 2007; Kalinowski et al., 1991; Marx et al., 2003; Peters-Wendisch et al., 2001; Riedel et al., 2001; Takeno et al., 2010; Vrljic et al., 1996). The L-lysine producing strains DM1800 and DM1729 have been described (Georgi et al., 2005) and they share feedback-resistant aspartokinase and improved pyruvate carboxylase activity but only DM1729 also shows decreased conversion of Laspartate-semialdehyde towards L-methionine and L-threonine biosynthesis. No gene of L-lysine biosynthesis after the intermediate L-aspartate-semialdehyde has been amplified to avoid competition with ectoine biosynthesis. As deletions of sugR and ldhA have previously been shown to be beneficial for L-lysine production due to derepressed glycolytic genes without Llactate formation as by-product (Pérez-García et al., 2016), strains DM1800ΔsugRΔldhA and DM1729ΔsugRΔldhA were constructed. With CGXII minimal medium containing 40 g L -1 glucose DM1800 and DM1729 produced 2.8 ± 0.1 g L -1 and 4.2 ± 0.1 g L -1 of L-lysine respectively, while DM1800ΔsugRΔldhA and DM1729ΔsugRΔldhA accumulated L-lysine to a titer of 3.9 ± 0.2 g L-1 and 5.0 ± 0.2 g L-1, respectively (Figure 2). Since no gene of L-lysine biosynthesis after L-aspartate-

semialdehyde has been amplified it was assumed that L-aspartate-semialdehyde is available for ectoine biosynthesis and the latter strains were considered suitable as basis to express the ectoine biosynthesis genes. The transcriptional regulator SugR is a general repressor of the gene encoding the PTS (phosphotransferase system), glycolysis and fermentative L-lactate dehydrogenase in C. glutamicum (Engels et al., 2008; Engels and Wendisch, 2007; Teramoto et al., 2011) and overexpression of sugR reduced glucose utilization (Engels et al., 2008). On the other hand, deletion of sugR accelerated glucose utilization (Bartek et al., 2010; Blombach et al., 2009; Teramoto et al., 2011). However, this occurs at the expense of L-lactate formation since the gene ldhA for NAD-dependent lactate dehydrogenase (Bott and Niebisch, 2003; Inui et al., 2004) is also derepressed by deletion of sugR (Engels et al., 2008; Engels and Wendisch, 2007; Teramoto et al., 2011). This was amended by additional deletion of ldhA as shown previously (Pérez-García et al., 2016). 3.2.

Construction of strains for production of ectoine from glucose

Fermentative production of ectoine using L-lysine producing strains has previously been shown (Becker et al., 2013; Ning et al., 2016), however the potential of C. glutamicum as a host for ectoine has not fully exploited and above all is far from the best producers of ectoine today (Fallet et al., 2010; Ning et al., 2016; Sauer and Galinski, 1998). In this work, the ectABC gene cluster from C. salexigens was cloned into the vector pVWEx1 (Peters-Wendisch et al., 2001) and the resulting vector was used to transform C. glutamicum wild-type, DM1800, DM1729, DM1800ΔsugRΔldhA, and DM1729ΔsugRΔldhA, respectively, resulting in strains Ecto1, Ecto2, Ecto3, Ecto4, and Ecto5, respectively. In CGXII minimal medium

containing 40 g L-1 glucose, the highest ectoine titer of 2.4 ± 0.1 g L-1 was observed with Ecto5 (Figure 3). Ecto3 differs from Ecto5 only by the lack of the hom mutation and the finding that this strain produced less ectoine (1.6 ± 0.1 g L-1) indicated that reduced conversion of L-aspartatesemialdehyde to L-methionine and L-threonine improved conversion of L-aspartatesemialdehyde to ectoine (Figure 3). The finding that Ecto5 produced more ectoine than Ecto4 (2.4 ± 0.1 g L-1 as compared to 1.7 ± 0.1 g L-1) and with a higher volumetric productivity (0.13 ± 0.00 g L-1 h-1 as compared to 0.09 ± 0.00 g L-1 h-1; figure 3) was expected according to the results of Perez Garcia et al. (2016) for enhanced L-lysine production. For example, C. glutamicum Ecto5 grew faster than Ecto4 (specific growth rates of 0.33 ± 0.01 h-1 and 0.29 ± 0.01 h-1, respectively) and Ecto3 grew faster than Ecto2 (specific growth rates of 0.38 ± 0.02 h-1 and 0.35 ± 0.02 h-1, respectively; Figure 3). Concomitantly, glucose consumption rates increased and formation of lactate as by-product was avoided as consequence of sugR and ldhA deletion. In general, the ectoine producers carrying sugR and ldhA deletions showed faster specific growth rates and higher volumetric and specific ectoine productivities (Figure 3). Final dried biomass concentrations decreased (10.9 ± 0.4, 12.1 ± 1.0, 9.1 ± 0.6, and 9.4 ± 0.4 g L 1

, respectively, for strains Ecto2, Ecto3, Ecto4 and Ecto5, respectively) with increasing ectoine

titers (Figure 3). C. glutamicum strain Ecto5 showed the highest product yield (0.06 ± 0.00 g g-1), volumetric and specific productivity (0.13 ± 0.00 g-1 L-1 h-1 and 0.014 ± 0.001 g-1 g-1 h-1, respectively) of the strains constructed here (Figure 3). Notably, L-lysine was observed as considerable byproduct (2.0 ± 0.1 g L-1 for Ecto5). To avoid the problems associated with the “bacterial milking” operated with the natural, Gramnegative producers Halomonas elongata (Schwibbert et al., 2011) or C. salexigens (Fallet et al.,

2010) that involves steps with high-salinity conditions (Sauer and Galinski, 1998), causing i.e. low work life of fermenters and other equipment, a low salt fermentative option of ectoine production was chosen. Similar strategies have been followed for P. stutzeri (Stöveken et al., 2011), E. coli (Ning et al., 2016), and C. glutamicum (Becker et al., 2013). Since C. glutamicum is not a natural ectoine/hydroxyectoine producer (Varela et al., 2003) metabolic engineering was required. Previously, the ectABCD operon of P. stutzeri A1501 was integrated into the C. glutamicum genome (Becker et al., 2013) and an ectoine titer of 0.2 ± 0.0 g L-1 was reported (Becker et al., 2013). C. glutamicum and C. salexigens possess GC-rich genomes with an average of 54.7% and 63.9%, respectively, and codons ending in C or G are predominant in both species (Copeland et al., 2011)(Liu et al., 2010). Plasmid-borne expression of the ectABC operon of C. salexigens (Fallet et al., 2010) as reported here resulted in an about tenfold increased ectoine titer (Figure 3). 3.3.

Elimination of L-lysine as the main by-product

The engineered strains Ecto2, Ecto3, Ecto4 and Ecto5 produced about as much ectoine as L-lysine (Figure 3). As compared to the parent strains that do not express ectABC, formation of L-lysine was reduced to about half (compare figures 2 and 3), which indicated that the available Laspartate-semialdehyde was converted to ectoine and L-lysine in a ratio of about 1:1. Deletion of lysE is a valid strategy to avoid export of L-lysine (Vrljic et al., 1996) and it has been applied to ectoine production (Becker et al., 2013). In C. glutamicum export of L-lysine and L-arginine is catalyzed by LysE (Vrljic et al., 1996). While L-arginine may also be exported by CgmA, LysE is the only export carrier for L-lysine (Lubitz et al., 2016; Vrljic et al., 1996). Therefore, lysE was deleted in strains Ecto3 and Ecto5 resulting in strains Ecto6 (Ecto3ΔlysE) and Ecto7 (Ecto5ΔlysE). As

expected, strains Ecto6 and Ecto7 did not accumulate L-lysine (Figure 4). However, ectoine production and growth was perturbed leading to four to five times reduced titers (0.4 ± 0.1 g L -1 and 0.5 ± 0.1 g L-1 ectoine for strains Ecto6 and Ecto7, respectively; Figure 4). Moreover, growth was slowed, final dried biomass concentrations were reduced (Figure 4), and glucose was not utilized completely. It is conceivable that intracellular accumulation of L-lysine to high concentrations occurred as consequence of lysE deletion and impaired growth as has been observed previously (Lubitz et al., 2016; Vrljic et al., 1996). Deletion of lysE proved beneficial for production of compounds that are derived from L-lysine, e.g. cadaverine (Kim et al., 2013) or -amino valerate (Rohles et al., 2016). Under conditions of a low flux towards L-lysine (due to integration of ectABCD into ddh and low precursor supply since sugR and ldhA were not deleted) deletion of lysE improved ectoine production as well (Becker et al., 2013). Irrespective of the lower ectoine titers, the strains constructed in this study allow for the production of ectoine without concomitant formation of L-lysine as side product (Figure 4). It is tempting to speculate that leaky expression of dapA that encodes dihydrodipicolinate synthase, the enzyme converting L-aspartate-semialdehyde to L2,3-dihydropicolinate in L-lysine biosynthesis (Cremer et al., 1991) and, thus, competing with ectoine production, may be a suitable target. Increased expression dapA from a plasmid or due to promoter up mutations was shown to improve L-lysine production (Vasicová et al., 1999). Possibly, leaky expression of dapA may increase L-aspartate-semialdehyde availability for ectoine production. 3.4.

Production of ectoine in fed-batch cultivation

To evaluate if decoupling ectoine production from growth is suitable to enhance ectoine titer and productivity, C. glutamicum strain Ecto5 was cultivated in a stirred tank bioreactor in fed-batch fermentation mode. After the initial glucose concentration of 100 g L-1 was depleted after 33 h, a linear feeding phase started (Figure 5). At the end of the fermentation (69 h), 22 g L -1 of sugar remained with a total glucose consumed of 134 g L-1. The final ectoine titer peaked at 22 g L-1 and an overall volumetric productivity of 0.32 g L-1 h-1 and a yield of 0.16 g g-1 were reached. Notably, L-lysine accumulated to a threefold lower titer (6.2 g L-1) than ectoine (22.0 g L-1). This is due to the fact that L-lysine formation occurred mainly during growth whereas ectoine continued to accumulate after growth ceased, i.e. in the feeding phase (Figure 5). L-glutamate as secondary by-product reached a maximum concentration of 1.3 g L-1 after 54 h of cultivation (Figure 5). During the batch-phase an ectoine titer, volumetric productivity, and yield of 6.5 g L -1, 0.19 g L-1 h-1, and 0.065 g g-1, respectively, were reached. During the feeding-phase a shift from biomass formation to production occurred, since the ectoine yield in this phase was 0.456 g g-1, i.e. about seven times higher than the yield during the batch-phase. The titer and volumetric productivity associated with the feeding-phase were of 15.5 g L-1 and 0.43 g L-1 h-1 respectively. The robustness of C. glutamicum under fed-batch cultivation have been tested several times, not only for L-lysine, but for other amino acids like L-arginine, L-methionine, or L-isoleucine (Li et al., 2016; Man et al., 2016; Ma et al., 2015), non-proteinogenic amino acids like -aminobutyric acid or -aminovalerate (Jorge et al., 2016b; Rohles et al., 2016), diamines like putrescine or cadaverine (Kind et al., 2011; Schneider et al., 2012), organic acids like succinate and pyruvate (Wieschalka et al., 2012; Xu et al., 2016), and alcohols like isobutanol and ethanol (Blombach et

al., 2011; Jojima et al., 2015). As shown here, ectoine production could be efficiently enhanced via fed-batch cultivation in various microorganisms Halomonas elongata, E. coli and C. glutamicum (Becker et al., 2013; Ning et al., 2016; Sauer and Galinski, 1998). The strain described here produced ectoine to a higher titer (22.0 g L-1) than obtained previously with C. glutamicum (4.5 g L-1) or the natural ectoine producer H. elongata (7.4 g L-1), while an E. coli-based process led to 25.1 g L-1 ectoine (Becker et al., 2013; Ning et al., 2016; Sauer and Galinski, 1998). The volumetric productivity of strain Ecto5 (0.32 g L-1 h-1) was higher than those obtained with other strains of C. glutamicum or with H. elongata (0.28 g L-1 h-1 and 0.22 g L-1 h-1, respectively), but lower than with E. coli (0.84 g L-1 h-1) (Becker et al., 2013; Ning et al., 2016; Sauer and Galinski, 1998). Ectoine production by Ecto5 was characterized by the highest yield (0.16 g g -1) reported in fed-batch cultivation to date (Becker et al., 2013; Ning et al., 2016; Sauer and Galinski, 1998). Previously, a yield of 0.08 g g-1 has been described for C. glutamicum, 0.11 g g-1 for H. elongata and 0.11 g g-1 for E. coli (Becker et al., 2013; Ning et al., 2016; Sauer and Galinski, 1998). Although the ectoine yield obtained here was the highest reported, room for improvement is certainly left since a maximum theoretical yield of 0.63 grams ectoine per gram of glucose has been estimated (Ning et al., 2016). In addition, the medium could be optimized in order to increase the maximum cell concentration and therefore product concentration. 3.5.

Ectoine production from alternative carbon sources

To enable ectoine production by C. glutamicum from alternative carbon sources, C. glutamicum strain Ecto5 was further engineered for utilization of the non-native carbon sources glycerol, glucosamine, xylose, arabinose, and starch. Crude glycerol is a stoichiometric waste product of the biodiesel process. Overexpression of the E. coli genes coding for glycerol kinase, glycerol 3-

phosphate dehydrogenase, and glycerol facilitator, respectively, as synthetic operon enabled growth on glycerol for C. glutamicum (Rittmann et al., 2008). Ecto5 carrying the vector pEKEx3glpKDF grew with 10 g L-1 glycerol as sole carbon source and produced up to 0.6 ± 0.0 g L-1 ectoine. A volumetric productivity of 0.034 ± 0.002 g L -1 h-1 and a yield of 0.055 ± 0.003 g g-1 were obtained (Figure 6; Table 2). The aminosugar glucosamine is a derivative of glucose and a monosaccharide component of the polysaccharide chitin, one of the most abundant polymers in nature (Chen et al., 2010). Overexpression of the endogenous gene encoding glucosamine 6-phosphate deaminase (nagB) of C. glutamicum allowed utilization of glucosamine (Uhde et al., 2013a). Thus, Ecto5(pEKEx3-nagB) was constructed and tested in CGXII minimal medium containing 10 g L -1 of glucosamine as sole carbon source. This strain produced 0.8 ± 0.1 g L -1 ectoine from 10 g L-1 glucosamine, which is 25 % higher than the empty vector carrying control strain produced from 10 g L-1 of glucose (Figure 6; Table 2). Due to the specific growth rate of Ecto5 (pEKEx3-nagB) with glucosamine (0.17 ± 0.02 h-1 as compared to 0.26 ± 0.01 h -1 with glucose) the volumetric productivity with glucosamine (0.045 ± 0.003 g L-1 h-1) was comparable to that with glucose (0.046 ± 0.003 g L-1 h-1). Of the sugars found in lignocellulose C. glutamicum can utilize glucose and mannose, but neither xylose nor arabinose (Whitman et al., 2012). Utilization of xylose by C. glutamicum required heterologous expression of a xylose isomerase gene (e.g. xylA from Xanthomonas campestris) and overexpression of the endogenous xylulokinase gene xylB (Meiswinkel et al., 2013a). After Ecto5 was transformed with plasmid pEKEx3-xylAB, it grew in xylose minimal medium with a specific growth rate of 0.08 ± 0.00 h-1 and produced 0.4 ± 0.1 g L1

of ectoine. The introduction of the arabinose utilization operon araBAD from E. coli enables C.

glutamicum to utilize arabinose (Sasaki et al., 2011; Schneider et al., 2011). C. glutamicum Ecto5

expressing araBAD grew with arabinose as sole carbon source and produced 0.4 ± 0.1 g L -1 ectoine (Figure 6; Table 2). The polymeric carbohydrate starch can be degraded by α-amylase if this is not branched. Expression of gene amyA coding for α-amylase from Streptomyces griseus enabled C. glutamicum to grow with soluble starch (Seibold et al., 2006). The strain Ecto5(pECXT99A-amyA) constructed here utilized starch as a co-substrate with glucose and accumulated 0.5 ± 0.1 g L -1 ectoine, whereas the empty vector carrying control strain that could only utilize glucose produced less than 0.1 g L-1 ectoine (Figure 6; Table 2). Thus, it could be shown that ectoine can be produced from the alternative carbon sources glycerol, xylose, arabinose, and starch. To this end, strategies previously developed for growth and L-lysine production (Meiswinkel et al., 2013a, 2013b; Schneider et al., 2011; Tateno et al., 2007; Uhde et al., 2013a) were applied to broaden the feedstock range for ectoine production. Among the alternatives carbon sources tested glucosamine supported the highest ectoine yield, which may be due to the fact that glucosamine can be used as combined sources of carbon and nitrogen by C. glutamicum, thus, providing a nitrogen sources for production of the nitrogencontaining ectoine. 4. CONCLUSION The C. glutamicum strains described here allowed for fermentative production of ectoine with the, to the best of our knowledge, highest yield reported to date. Deletion of the gene encoding the L-lysine and arginine export system LysE abrogated accumulation of L-lysine as by-product. Strains able to produce ectoine from the alternative carbon sources glycerol, glucosamine, xylose, arabinose, and starch were constructed.

Acknowledgments This work was supported in part by a fellowship from the CLIB Graduate Cluster to Fernando Pérez-García and by EVONIK (Halle, Germany). The authors thank Karl Friehs and Thomas Schäffer from the Technical Faculty & Center for Biotechnology of Bielefeld University for the help and support regarding fed-batch fermentation. Compliance with ethical standards The authors declare that they have no conflicts of interest. The research performed did not involve human participants and/or animals.

REFERENCES Bartek, T., Rudolf, C., Kerssen, U., Klein, B., Blombach, B., Lang, S., Eikmanns, B.J., Oldiges, M., 2010. Studies on substrate utilisation in L-valine-producing Corynebacterium glutamicum strains deficient in pyruvate dehydrogenase complex. Bioprocess Biosyst. Eng. 33, 873– 883, http://dx.doi.org/10.1007/s00449-010-0410-1. Becker, J., Schäfer, R., Kohlstedt, M., Harder, B.J., Borchert, N.S., Stöveken, N., Bremer, E., Wittmann, C., 2013. Systems metabolic engineering of Corynebacterium glutamicum for production of the chemical chaperone ectoine. Microb. Cell Factories 12, 110, http://dx.doi.org/10.1186/1475-2859-12-110. Becker, J., Zelder, O., Häfner, S., Schröder, H., Wittmann, C., 2011. From zero to hero--designbased systems metabolic engineering of Corynebacterium glutamicum for L-lysine production. Metab. Eng. 13, 159–168, http://dx.doi.org/10.1016/j.ymben.2011.01.003. Blombach, B., Hans, S., Bathe, B., Eikmanns, B.J., 2009. Acetohydroxyacid synthase, a novel target for improvement of L-lysine production by Corynebacterium glutamicum. Appl. Environ. Microbiol. 75, 419–427, http://dx.doi.org/10.1128/AEM.01844-08. Blombach, B., Riester, T., Wieschalka, S., Ziert, C., Youn, J.-W., Wendisch, V.F., Eikmanns, B.J., 2011. Corynebacterium glutamicum tailored for efficient isobutanol production. Appl. Environ. Microbiol. 77, 3300–3310, http://dx.doi.org/10.1128/AEM.02972-10. Bolten, C.J., Kiefer, P., Letisse, F., Portais, J.-C., Wittmann, C., 2007. Sampling for metabolome analysis

of

microorganisms.

Anal.

Chem.

79,

3843–3849,

http://dx.doi.org/10.1021/ac0623888. Botta, C., Di Giorgio, C., Sabatier, A.-S., De Méo, M., 2008. Genotoxicity of visible light (400-800 nm) and photoprotection assessment of ectoin, L-ergothioneine and mannitol and four sunscreens.

J.

Photochem.

Photobiol.

B

91,

24–34,

http://dx.doi.org/10.1016/j.jphotobiol.2008.01.008. Bott, M., Niebisch, A., 2003. The respiratory chain of Corynebacterium glutamicum. J. Biotechnol. 104, 129–153.

Buenger, J., Driller, H., 2004. Ectoin: an effective natural substance to prevent UVA-induced premature

photoaging.

Skin

Pharmacol.

Physiol.

17,

232–237,

http://dx.doi.org/10.1159/000080216. Cánovas, D., Vargas, C., Calderón, M.I., Ventosa, A., Nieto, J.J., 1998. Characterization of the genes for the biosynthesis of the compatible solute ectoine in the moderately halophilic bacterium Halomonas elongata DSM 3043. Syst. Appl. Microbiol. 21, 487–497, http://dx.doi.org/10.1016/S0723-2020(98)80060-X. Chen, J.-K., Shen, C.-R., Liu, C.-L., 2010. N-acetylglucosamine: production and applications. Mar. Drugs 8, 2493–2516, http://dx.doi.org/10.3390/md8092493. Copeland, A., O’Connor, K., Lucas, S., Lapidus, A., Berry, K.W., Detter, J.C., Del Rio, T.G., Hammon, N., Dalin, E., Tice, H., Pitluck, S., Bruce, D., Goodwin, L., Han, C., Tapia, R., Saunders, E., Schmutz, J., Brettin, T., Larimer, F., Land, M., Hauser, L., Vargas, C., Nieto, J.J., Kyrpides, N.C., Ivanova, N., Göker, M., Klenk, H.-P., Csonka, L.N., Woyke, T., 2011. Complete genome sequence of the halophilic and highly halotolerant Chromohalobacter salexigens type strain (1H11(T)). Stand. Genomic Sci. 5, 379–388. doi:10.4056/sigs.2285059 Cremer, J., Eggeling, L., Sahm, H., 1991. Control of the Lysine Biosynthesis Sequence in Corynebacterium glutamicum as Analyzed by Overexpression of the Individual Corresponding Genes. Appl. Environ. Microbiol. 57, 1746–1752. Eggeling, L., Bott, M., 2015. A giant market and a powerful metabolism: L-lysine provided by Corynebacterium

glutamicum.

Appl.

Microbiol.

Biotechnol.

99,

3387–3394,

http://dx.doi.org/10.1007/s00253-015-6508-2. Eggeling, L., Bott, M., 2005. Handbook of Corynebacterium glutamicum. CRC Press. Eikmanns, B.J., Metzger, M., Reinscheid, D., Kircher, M., Sahm, H., 1991. Amplification of three threonine biosynthesis genes in Corynebacterium glutamicum and its influence on carbon flux in different strains. Appl. Microbiol. Biotechnol. 34, 617–622.

Engels, V., Lindner, S.N., Wendisch, V.F., 2008. The global repressor SugR controls expression of genes of glycolysis and of the L-lactate dehydrogenase LdhA in Corynebacterium glutamicum. J. Bacteriol. 190, 8033–8044, http://dx.doi.org/10.1128/JB.00705-08. Engels, V., Wendisch, V.F., 2007. The DeoR-type regulator SugR represses expression of ptsG in Corynebacterium

glutamicum.

J.

Bacteriol.

189,

2955–2966,

http://dx.doi.org/10.1128/JB.01596-06. Fallet, C., Rohe, P., Franco-Lara, E., 2010. Process optimization of the integrated synthesis and secretion of ectoine and hydroxyectoine under hyper/hypo-osmotic stress. Biotechnol. Bioeng. 107, 124–133, http://dx.doi.org/10.1002/bit.22750. Follettie, M.T., Shin, H.K., Sinskey, A.J., 1988. Organization and regulation of the Corynebacterium glutamicum hom-thrB and thrC loci. Mol. Microbiol. 2, 53–62. Gaigalat, L., Schlüter, J.-P., Hartmann, M., Mormann, S., Tauch, A., Pühler, A., Kalinowski, J., 2007. The DeoR-type transcriptional regulator SugR acts as a repressor for genes encoding the phosphoenolpyruvate:sugar phosphotransferase system (PTS) in Corynebacterium glutamicum. BMC Mol. Biol. 8, 104, http://dx.doi.org/10.1186/1471-2199-8-104. Galinski,

E.A.,

Pfeiffer,

H.P.,

Trüper,

H.G.,

1985.

1,4,5,6-Tetrahydro-2-methyl-4-

pyrimidinecarboxylic acid. A novel cyclic amino acid from halophilic phototrophic bacteria of the genus Ectothiorhodospira. Eur. J. Biochem. 149, 135–139. García-Estepa, R., Argandoña, M., Reina-Bueno, M., Capote, N., Iglesias-Guerra, F., Nieto, J.J., Vargas, C., 2006. The ectD gene, which is involved in the synthesis of the compatible solute hydroxyectoine, is essential for thermoprotection of the halophilic bacterium Chromohalobacter

salexigens.

J.

Bacteriol.

188,

3774–3784,

http://dx.doi.org/10.1128/JB.00136-06. Georgi, T., Rittmann, D., Wendisch, V.F., 2005. Lysine and glutamate production by Corynebacterium glutamicum on glucose, fructose and sucrose: roles of malic enzyme and fructose-1,6-bisphosphatase.

Metab.

http://dx.doi.org/10.1016/j.ymben.2005.05.001.

Eng.

7,

291–301,

Hanahan, D., 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 557–580. Heinrich, U., Garbe, B., Tronnier, H., 2007. In vivo assessment of Ectoin: a randomized, vehiclecontrolled

clinical

trial.

Skin

Pharmacol.

Physiol.

20,

211–218,

http://dx.doi.org/10.1159/000103204. Hermann, T., 2003. Industrial production of amino acids by coryneform bacteria. J. Biotechnol. 104, 155–172. Hirasawa, T., Shimizu, H., 2016. Recent advances in amino acid production by microbial cells. Curr. Opin. Biotechnol. 42, 133–146, http://dx.doi.org/10.1016/j.copbio.2016.04.017. Hüser, A.T., Chassagnole, C., Lindley, N.D., Merkamm, M., Guyonvarch, A., Elisáková, V., Pátek, M., Kalinowski, J., Brune, I., Pühler, A., Tauch, A., 2005. Rational design of a Corynebacterium glutamicum pantothenate production strain and its characterization by metabolic flux analysis and genome-wide transcriptional profiling. Appl. Environ. Microbiol. 71, 3255–3268, http://dx.doi.org/10.1128/AEM.71.6.3255-3268.2005. Inui, M., Kawaguchi, H., Murakami, S., Vertès, A.A., Yukawa, H., 2004. Metabolic engineering of Corynebacterium glutamicum for fuel ethanol production under oxygen-deprivation conditions.

J.

Mol.

Microbiol.

Biotechnol.

8,

243–254,

http://dx.doi.org/10.1159/000086705. Jojima, T., Noburyu, R., Sasaki, M., Tajima, T., Suda, M., Yukawa, H., Inui, M., 2015. Metabolic engineering for improved production of ethanol by Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 99, 1165–1172, http://dx.doi.org/10.1007/s00253-014-6223-4. Jorge, J.M.P., Leggewie, C., Wendisch, V.F., 2016a. A new metabolic route for the production of gamma-aminobutyric acid by Corynebacterium glutamicum from glucose. Amino Acids 48, 2519–2531, http://dx.doi.org/10.1007/s00726-016-2272-6. Jorge, J.M.P., Nguyen, A.Q.D., Pérez-García, F., Kind, S., Wendisch, V.F., 2016b. Improved fermentative production of gamma-aminobutyric acid via the putrescine route: systems

metabolic engineering for production from glucose, amino sugars and xylose. Biotechnol. Bioeng, http://dx.doi.org/10.1002/bit.26211. Kabus, A., Niebisch, A., Bott, M., 2007. Role of cytochrome bd oxidase from Corynebacterium glutamicum in growth and lysine production. Appl. Environ. Microbiol. 73, 861–868, http://dx.doi.org/10.1128/AEM.01818-06. Kalinowski, J., Cremer, J., Bachmann, B., Eggeling, L., Sahm, H., Pühler, A., 1991. Genetic and biochemical analysis of the aspartokinase from Corynebacterium glutamicum. Mol. Microbiol. 5, 1197–1204. Kim, J.-Y., Lee, Y.-A., Wittmann, C., Park, J.-B., 2013. Production of non-proteinogenic amino acids from α-keto acid precursors with recombinant Corynebacterium glutamicum. Biotechnol. Bioeng. 110, 2846–2855, http://dx.doi.org/10.1002/bit.24962. Kind, S., Kreye, S., Wittmann, C., 2011. Metabolic engineering of cellular transport for overproduction of the platform chemical 1,5-diaminopentane in Corynebacterium glutamicum. Metab. Eng. 13, 617–627, http://dx.doi.org/10.1016/j.ymben.2011.07.006. Kirchner, O., Tauch, A., 2003. Tools for genetic engineering in the amino acid-producing bacterium Corynebacterium glutamicum. J. Biotechnol. 104, 287–299. Kuhlmann, A.U., Bremer, E., 2002. Osmotically regulated synthesis of the compatible solute ectoine in Bacillus pasteurii and related Bacillus spp. Appl. Environ. Microbiol. 68, 772– 783. Lee, J.-Y., Na, Y.-A., Kim, E., Lee, H.-S., Kim, P., 2016. The Actinobacterium Corynebacterium glutamicum, an Industrial Workhorse. J. Microbiol. Biotechnol. 26, 807–822, http://dx.doi.org/10.4014/jmb.1601.01053. Litsanov, B., Kabus, A., Brocker, M., Bott, M., 2012. Efficient aerobic succinate production from glucose in minimal medium with Corynebacterium glutamicum. Microb. Biotechnol. 5, 116–128, http://dx.doi.org/10.1111/j.1751-7915.2011.00310.x. Li, Y., Cong, H., Liu, B., Song, J., Sun, X., Zhang, J., Yang, Q., 2016. Metabolic engineering of Corynebacterium glutamicum for methionine production by removing feedback inhibition

and

increasing

NADPH

level.

Antonie

Van

Leeuwenhoek

109,

1185–1197,

http://dx.doi.org/10.1007/s10482-016-0719-0. Louis, P., Galinski, E.A., 1997. Characterization of genes for the biosynthesis of the compatible solute ectoine from Marinococcus halophilus and osmoregulated expression in Escherichia

coli.

Microbiol.

Read.

Engl.

143,

1141–1149,

http://dx.doi.org/10.1099/00221287-143-4-1141. Lubitz, D., Jorge, J.M.P., Pérez-García, F., Taniguchi, H., Wendisch, V.F., 2016. Roles of export genes cgmA and lysE for the production of L-arginine and L-citrulline by Corynebacterium glutamicum.

Appl.

Microbiol.

Biotechnol.

100,

8465–8474,

http://dx.doi.org/10.1007/s00253-016-7695-1. Liu, G., Wu, J., Yang, H., Bao, Q., 2010. Codon Usage Patterns in Corynebacterium glutamicum: Mutational Bias, Natural Selection and Amino Acid Conservation. Comp. Funct. Genomics 2010, 343569. doi:10.1155/2010/343569 Man, Z., Xu, M., Rao, Z., Guo, J., Yang, T., Zhang, X., Xu, Z., 2016. Systems pathway engineering of Corynebacterium crenatum for improved L-arginine production. Sci. Rep. 6, 28629, http://dx.doi.org/10.1038/srep28629. Marx, A., Hans, S., Möckel, B., Bathe, B., de Graaf, A.A., McCormack, A.C., Stapleton, C., Burke, K., O’Donohue, M., Dunican, L.K., 2003. Metabolic phenotype of phosphoglucose isomerase mutants of Corynebacterium glutamicum. J. Biotechnol. 104, 185–197. Ma, W., Wang, J., Li, Y., Hu, X., Shi, F., Wang, X., 2015. Enhancing pentose phosphate pathway in Corynebacterium glutamicum to improve L-isoleucine production. Biotechnol. Appl. Biochem, http://dx.doi.org/10.1002/bab.1442. Meiswinkel, T.M., Gopinath, V., Lindner, S.N., Nampoothiri, K.M., Wendisch, V.F., 2013a. Accelerated pentose utilization by Corynebacterium glutamicum for accelerated production of lysine, glutamate, ornithine and putrescine. Microb. Biotechnol. 6, 131– 140, http://dx.doi.org/10.1111/1751-7915.12001.

Meiswinkel, T.M., Rittmann, D., Lindner, S.N., Wendisch, V.F., 2013b. Crude glycerol-based production of amino acids and putrescine by Corynebacterium glutamicum. Bioresour. Technol. 145, 254–258, http://dx.doi.org/10.1016/j.biortech.2013.02.053. Mimitsuka, T., Sawai, H., Hatsu, M., Yamada, K., 2007. Metabolic engineering of Corynebacterium glutamicum for cadaverine fermentation. Biosci. Biotechnol. Biochem. 71, 2130–2135, http://dx.doi.org/10.1271/bbb.60699. Ning, Y., Wu, X., Zhang, C., Xu, Q., Chen, N., Xie, X., 2016. Pathway construction and metabolic engineering for fermentative production of ectoine in Escherichia coli. Metab. Eng. 36, 10–18, http://dx.doi.org/10.1016/j.ymben.2016.02.013. Okino, S., Inui, M., Yukawa, H., 2005. Production of organic acids by Corynebacterium glutamicum under

oxygen

deprivation.

Appl.

Microbiol.

Biotechnol.

68,

475–480,

http://dx.doi.org/10.1007/s00253-005-1900-y. Ono, H., Sawada, K., Khunajakr, N., Tao, T., Yamamoto, M., Hiramoto, M., Shinmyo, A., Takano, M., Murooka, Y., 1999. Characterization of biosynthetic enzymes for ectoine as a compatible solute in a moderately halophilic eubacterium, Halomonas elongata. J. Bacteriol. 181, 91–99. Onraedt, A.E., Walcarius, B.A., Soetaert, W.K., Vandamme, E.J., 2005. Optimization of ectoine synthesis through fed-batch fermentation of Brevibacterium epidermis. Biotechnol. Prog. 21, 1206–1212, http://dx.doi.org/10.1021/bp0500967. Pastor, J.M., Salvador, M., Argandoña, M., Bernal, V., Reina-Bueno, M., Csonka, L.N., Iborra, J.L., Vargas, C., Nieto, J.J., Cánovas, M., 2010. Ectoines in cell stress protection: uses and biotechnological

production.

Biotechnol.

Adv.

28,

782–801,

http://dx.doi.org/10.1016/j.biotechadv.2010.06.005. Pérez-García, F., Peters-Wendisch, P., Wendisch, V.F., 2016. Engineering Corynebacterium glutamicum for fast production of L-lysine and L-pipecolic acid. Appl. Microbiol. Biotechnol. 100, 8075–8090, http://dx.doi.org/10.1007/s00253-016-7682-6.

Peters, P., Galinski, E. a., Trüper, H. g., 1990. The biosynthesis of ectoine. FEMS Microbiol. Lett. 71, 157–162, http://dx.doi.org/10.1111/j.1574-6968.1990.tb03815.x. Peters-Wendisch, P., Götker, S., Heider, S. a. E., Komati Reddy, G., Nguyen, A.Q., Stansen, K.C., Wendisch, V.F., 2014. Engineering biotin prototrophic Corynebacterium glutamicum strains for amino acid, diamine and carotenoid production. J. Biotechnol. 192 Pt B, 346– 354, http://dx.doi.org/10.1016/j.jbiotec.2014.01.023. Peters-Wendisch, P.G., Schiel, B., Wendisch, V.F., Katsoulidis, E., Möckel, B., Sahm, H., Eikmanns, B.J., 2001. Pyruvate carboxylase is a major bottleneck for glutamate and lysine production by Corynebacterium glutamicum. J. Mol. Microbiol. Biotechnol. 3, 295–300. Riedel, C., Rittmann, D., Dangel, P., Möckel, B., Petersen, S., Sahm, H., Eikmanns, B.J., 2001. Characterization of the phosphoenolpyruvate carboxykinase gene from Corynebacterium glutamicum and significance of the enzyme for growth and amino acid production. J. Mol. Microbiol. Biotechnol. 3, 573–583. Rittmann, D., Lindner, S.N., Wendisch, V.F., 2008. Engineering of a glycerol utilization pathway for amino acid production by Corynebacterium glutamicum. Appl. Environ. Microbiol. 74, 6216–6222, http://dx.doi.org/10.1128/AEM.00963-08. Rittmann, D., Schaffer, S., Wendisch, V.F., Sahm, H., 2003. Fructose-1,6-bisphosphatase from Corynebacterium glutamicum: expression and deletion of the fbp gene and biochemical characterization

of

the

enzyme.

Arch.

Microbiol.

180,

285–292,

http://dx.doi.org/10.1007/s00203-003-0588-6. Rohles, C.M., Gießelmann, G., Kohlstedt, M., Wittmann, C., Becker, J., 2016. Systems metabolic engineering of Corynebacterium glutamicum for the production of the carbon-5 platform chemicals

5-aminovalerate

and

glutarate.

Microb.

Cell

Factories

15,

154,

http://dx.doi.org/10.1186/s12934-016-0553-0. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory.

Sasaki, M., Teramoto, H., Inui, M., Yukawa, H., 2011. Identification of mannose uptake and catabolism genes in Corynebacterium glutamicum and genetic engineering for simultaneous utilization of mannose and glucose. Appl. Microbiol. Biotechnol. 89, 1905– 1916, http://dx.doi.org/10.1007/s00253-010-3002-8. Sauer, T., Galinski, E.A., 1998. Bacterial milking: A novel bioprocess for production of compatible solutes. Biotechnol. Bioeng. 57, 306–313. Schneider, J., Eberhardt, D., Wendisch, V.F., 2012. Improving putrescine production by Corynebacterium glutamicum by fine-tuning ornithine transcarbamoylase activity using a plasmid

addiction

system.

Appl.

Microbiol.

Biotechnol.

95,

169–178,

http://dx.doi.org/10.1007/s00253-012-3956-9. Schneider, J., Niermann, K., Wendisch, V.F., 2011. Production of the amino acids l-glutamate, llysine, l-ornithine and l-arginine from arabinose by recombinant Corynebacterium glutamicum.

J.

Biotechnol.

154,

191–198,

http://dx.doi.org/10.1016/j.jbiotec.2010.07.009. Schneider, J., Wendisch, V.F., 2010. Putrescine production by engineered Corynebacterium glutamicum.

Appl.

Microbiol.

Biotechnol.

88,

859–868,

http://dx.doi.org/10.1007/s00253-010-2778-x. Schrumpf, B., Eggeling, L., Sahm, H., 1992. Isolation and prominent characteristics of an L-lysine hyperproducing strain of Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 37, 566–571, http://dx.doi.org/10.1007/BF00240726. Schwibbert, K., Marin-Sanguino, A., Bagyan, I., Heidrich, G., Lentzen, G., Seitz, H., Rampp, M., Schuster, S.C., Klenk, H.-P., Pfeiffer, F., Oesterhelt, D., Kunte, H.J., 2011. A blueprint of ectoine metabolism from the genome of the industrial producer Halomonas elongata DSM 2581 T. Environ. Microbiol. 13, 1973–1994, http://dx.doi.org/10.1111/j.14622920.2010.02336.x. Seibold, G., Auchter, M., Berens, S., Kalinowski, J., Eikmanns, B.J., 2006. Utilization of soluble starch by a recombinant Corynebacterium glutamicum strain: growth and lysine

production.

J.

Biotechnol.

124,

381–391,

http://dx.doi.org/10.1016/j.jbiotec.2005.12.027. Siebert, D., Wendisch, V.F., 2015. Metabolic pathway engineering for production of 1,2propanediol and 1-propanol by Corynebacterium glutamicum. Biotechnol. Biofuels 8, 91, http://dx.doi.org/10.1186/s13068-015-0269-0. Stansen, C., Uy, D., Delaunay, S., Eggeling, L., Goergen, J.-L., Wendisch, V.F., 2005. Characterization of a Corynebacterium glutamicum lactate utilization operon induced during temperature-triggered glutamate production. Appl. Environ. Microbiol. 71, 5920– 5928, http://dx.doi.org/10.1128/AEM.71.10.5920-5928.2005. Stöveken, N., Pittelkow, M., Sinner, T., Jensen, R.A., Heider, J., Bremer, E., 2011. A specialized aspartokinase enhances the biosynthesis of the osmoprotectants ectoine and hydroxyectoine in Pseudomonas stutzeri A1501. J. Bacteriol. 193, 4456–4468, http://dx.doi.org/10.1128/JB.00345-11. Takeno, S., Murata, R., Kobayashi, R., Mitsuhashi, S., Ikeda, M., 2010. Engineering of Corynebacterium glutamicum with an NADPH-generating glycolytic pathway for L-lysine production.

Appl.

Environ.

Microbiol.

76,

7154–7160,

http://dx.doi.org/10.1128/AEM.01464-10. Tateno, T., Fukuda, H., Kondo, A., 2007. Production of L-Lysine from starch by Corynebacterium glutamicum displaying alpha-amylase on its cell surface. Appl. Microbiol. Biotechnol. 74, 1213–1220, http://dx.doi.org/10.1007/s00253-006-0766-y. Teramoto, H., Inui, M., Yukawa, H., 2011. Transcriptional regulators of multiple genes involved in carbon metabolism in Corynebacterium glutamicum. J. Biotechnol. 154, 114–125, http://dx.doi.org/10.1016/j.jbiotec.2011.01.016. Toyoda, K., Teramoto, H., Inui, M., Yukawa, H., 2009. The ldhA gene, encoding fermentative Llactate dehydrogenase of Corynebacterium glutamicum, is under the control of positive feedback

regulation

mediated

by

http://dx.doi.org/10.1128/JB.00303-09.

LldR.

J.

Bacteriol.

191,

4251–4258,

Tsuge, Y., Hasunuma, T., Kondo, A., 2015. Recent advances in the metabolic engineering of Corynebacterium glutamicum for the production of lactate and succinate from renewable resources. J. Ind. Microbiol. Biotechnol. 42, 375–389, http://dx.doi.org/10.1007/s10295014-1538-9. Uhde, A., Youn, J.-W., Maeda, T., Clermont, L., Matano, C., Krämer, R., Wendisch, V.F., Seibold, G.M., Marin, K., 2013a. Glucosamine as carbon source for amino acid-producing Corynebacterium

glutamicum.

Appl.

Microbiol.

Biotechnol.

97,

1679–1687,

http://dx.doi.org/10.1007/s00253-012-4313-8. Varela, C., Agosin, E., Baez, M., Klapa, M., Stephanopoulos, G., 2003. Metabolic flux redistribution in Corynebacterium glutamicum in response to osmotic stress. Appl. Microbiol. Biotechnol. 60, 547–555, http://dx.doi.org/10.1007/s00253-002-1120-7. Vasicová, P., Pátek, M., Nesvera, J., Sahm, H., Eikmanns, B., 1999. Analysis of the Corynebacterium glutamicum dapA promoter. J. Bacteriol. 181, 6188–6191. Vrljic, M., Sahm, H., Eggeling, L., 1996. A new type of transporter with a new type of cellular function: L-lysine export from Corynebacterium glutamicum. Mol. Microbiol. 22, 815– 826. Wendisch, V.F., Bott, M., Kalinowski, J., Oldiges, M., Wiechert, W., 2006. Emerging Corynebacterium

glutamicum

systems

biology.

J.

Biotechnol.

124,

74–92,

http://dx.doi.org/10.1016/j.jbiotec.2005.12.002. Wendisch, V.F., Jorge, J.M.P., Pérez-García, F., Sgobba, E., 2016. Updates on industrial production of amino acids using Corynebacterium glutamicum. World J. Microbiol. Biotechnol. 32, 105, http://dx.doi.org/10.1007/s11274-016-2060-1. Whitman, W., Goodfellow, M., Kämpfer, P., Busse, H.-J., Trujillo, M., Ludwig, W., Suzuki, K., 2012. Bergey’s Manual of Systematic Bacteriology: Volume 5: The Actinobacteria. Springer Science & Business Media. Widderich, N., Höppner, A., Pittelkow, M., Heider, J., Smits, S.H.J., Bremer, E., 2014. Biochemical properties of ectoine hydroxylases from extremophiles and their wider taxonomic

distribution

among

microorganisms.

PloS

One

9,

e93809.

doi:10.1371/journal.pone.0093809 Wieschalka, S., Blombach, B., Bott, M., Eikmanns, B.J., 2013. Bio-based production of organic acids

with

Corynebacterium

glutamicum.

Microb.

Biotechnol.

6,

87–102,

http://dx.doi.org/10.1111/1751-7915.12013. Wieschalka, S., Blombach, B., Eikmanns, B.J., 2012. Engineering Corynebacterium glutamicum for the

production

of

pyruvate.

Appl.

Microbiol.

Biotechnol.

94,

449–459,

http://dx.doi.org/10.1007/s00253-011-3843-9.

Xu, H., Zhou, Z., Wang, C., Chen, Z., Cai, H., 2016. Enhanced succinic acid production in Corynebacterium glutamicum with increasing the available NADH supply and glucose consumption rate by decreasing H(+)-ATPase activity. Biotechnol. Lett. 38, 1181–1186, http://dx.doi.org/10.1007/s10529-016-2093-4.

TABLES Table 1: strains and vectors used in this work Strains and vectors Description

Source

Strains WT DM1800

C. glutamicum wild type, ATCC13032 C. glutamicum ATCC13032 pycP458S, lysCT311I

ATCC (Georgi et al., 2005)

In-frame deletion of sugR (cg2115) and ldhA (cg3219) in DM1800 In-frame deletion of lysE (cg1424) in DM1800ΔsugRΔldhA C. glutamicum ATCC13032 pycP458S, lysCT311I, homV59A In-frame deletion of sugR (cg2115) and ldhA (cg3219) in DM1729 In-frame deletion of lysE (cg1424) in DM1729ΔsugRΔldhA C. glutamicum ATCC13032 carrying pVWEx1ectABC DM1800 carrying pVWEx1-ectABC DM1800ΔsugRΔldhA carrying pVWEx1ectABC DM1729 carrying pVWEx1-ectABC DM1729ΔsugRΔldhA carrying pVWEx1ectABC DM1800ΔsugRΔldhAΔlysE carrying pVWEx1ectABC DM1729ΔsugRΔldhAΔlysE carrying pVWEx1ectABC

This work

KanR, mobilizable E. coli vector for the construction of insertion and deletion mutants of C. glutamicum (oriV, sacB, lacZ) with the deletion construct for sugR (cg2115) KanR, mobilizable E. coli vector for the construction of insertion and deletion mutants of C. glutamicum (oriV, sacB, lacZ) with the deletion construct for ldhA (cg3219) KanR, mobilizable E. coli vector for the construction of insertion and deletion mutants of C. glutamicum (oriV, sacB, lacZ) with the deletion construct for lysE (cg1424) KanR, C. glutamicum/E. coli shuttle vector (Ptac, lacI, pHM1519 oriVC.g.) SpecR, C. glutamicum/E. coli shuttle vector (Ptac, lacI, pBL1 OriVC.g.)

(Engels and Wendisch, 2007)

DM1800ΔsugRΔldhA DM1800ΔsugRΔldhAΔlysE DM1729 DM1729ΔsugRΔldhA DM1729ΔsugRΔldhAΔlysE Ecto1 Ecto2 Ecto3 Ecto4 Ecto5 Ecto6 Ecto7 Vectors pK19mobsacB-ΔsugR

pK19mobsacB-ΔldhA

pK19mobsacB-ΔlysEG

pVWEx1 pEKEx3

This work (Georgi et al., 2005) This work This work This work This work This work This work This work This work This work

(Blombach et al., 2011)

(Vrljic et al., 1996)

(Peters-Wendisch et al., 2001) (Stansen et al., 2005)

pECXT99A pVWEx1-ectABC pEKEx3-glpKDF pEKEx3-nagB pEKEx3-xylAB

pEKEx3-araBAD pECXT99A-amyA

TetR, C. glutamicum/E. coli shuttle vector (Ptrc, lacI, pGA1 OriVC.g.) KanR, pVWXe1 overexpressing ectABC operon from C. salexigens DSM 3043T SpecR, pEKEXe3 overexpressing glpK, glpD and glpF from E. coli MG1655 SpecR, pEKEXe3 overexpressing nagB from C. glutamicum ATCC 13032 SpecR, pEKEXe3 overexpressing xylA from Xanthomonas campestris SCC1758 and xylB from C. glutamicum ATCC 13032 SpecR, pEKEXe3 overexpressing araBAD from E. coli MG1655 TetR, pECXT99A overexpressing amyA from Streptomyces griseus IMRU3570

(Kirchner and Tauch, 2003) This work (Meiswinkel et al., 2013b) (Uhde et al., 2013b) (Meiswinkel 2013a)

et

al.,

This work (Seibold et al., 2006)

Table 2: Growth and yield values of Ecto5 when growing in shake flask on different carbon sources in minimal medium (lys: L-lysine; ect: ectoine, S: substrate Specific Biomas Strain Carbon source growth s conc. YX/S (g g-1) Ylys/S (g g-1) Yect/S (g g-1) rate (h-1) (g L-1) Ecto5(pEKEx3)

Glucose 10 g L-1

0.26 ± 0.01

2.7 ± 0.3

0.269 ± 0.029

0.058 ± 0.005

0.065 ± 0.004

Ecto5(pEKEx3-glpFKD)

Glycerol 10 g L-1

0.23 ± 0.01

2.5 ± 0.1

0.245 ± 0.014

0.054 ± 0.003

0.055 ± 0.003

Ecto5(pEKEx3-nagB)

Glucosamine 10 g L-1

0.17 ± 0.02

2.8 ± 0.1

0.276 ± 0.009

0.095 ± 0.008

0.082 ± 0.005

0.08 ± 0.00

2.4 ± 0.2

0.236 ± 0.018

0.030 ± 0.002

0.038 ± 0.005

0.06 ± 0.00

2.6 ± 0.1

0.260 ± 0.010

0.063 ± 0.005

0.042 ± 0.010

0.15 ± 0.02

0.8 ± 0.0

0.065 ± 0.002

0.011 ± 0.001

0.011 ± 0.001

0.21 ± 0.02

2.5 ± 0.1

0.201 ± 0.011

0.068 ± 0.004

0.037 ± 0.009

L-1

Ecto5(pEKEx3-xylAB)

Xylose 10 g

Ecto5(pEKEx3araBAD)

Arabinose 10 g L-1

Ecto5(pECXT99A) Ecto5(pECXT99AamyA)

L-1

Glucose 2.5 g + Starch 10 g L-1 Glucose 2.5 g L-1 + Starch 10 g L-1

Means and standard deviations of three replicates are given

Figure 1: Metabolic engineering strategies employed for ectoine production by C. glutamicum. Green shadowed genes are modifications improving L-aspartate-semialdehyde availability: derepressed glycolytic genes as consequence of deletion of sugR, improved pyruvate carboxylase activity due to pycP458S and feedback-resistant phosphorylation of aspartate to aspartyl phosphate due lysCT311I and reduced formation of the by-product L-lactate due to deletion of ldhA and decreased utilization of L-aspartate-semialdehyde in L-methionine and L-threonine biosynthesis due to homV59A. Blue shadowed genes are the heterologously expressed genes for the ectoine biosynthesis. Reactions leading to undesired by-products are depicted in red color.

Figure 2: L-Lysine and lactate production of the base strains used in this work. Final L-lysine and lactate titers of the strains C. glutamicum wild-type, DM1800, DM1729, DM1800ΔsugRΔldhA, and DM1729ΔsugRΔldhA, after growing in CGXII minimal medium containing 40 g L -1 glucose. Titers are given as means and standard deviations of three replicates. N.d.: not detected.

Figure 3: Growth and production data of Ecto1, Ecto2, Ecto3, Ecto4, and Ecto5. The following parameters are depicted from left to right and from top to bottom: Specific growth rate (h -1), maximum dried biomass concentration (g L-1), specific glucose consumption rate (g g -1 h-1),

ectoine yield (g g-1), L-lysine yield (g g-1), biomass yield (g g-1), ectoine and L-lysine titers (g L-1), ectoine volumetric productivity (g L-1 h-1), and ectoine specific productivity (g g -1 h-1). All strains were grown in glucose minimal medium. Values are given as means and standard deviations of three replicate cultivations.

Figure 4: L-lysine and ectoine production and growth of C. glutamicum strains Ecto3, Ecto5, Ecto6, and Ecto7. A) Titers for L-lysine and ectoine. B) Growth of strains Ecto3, Ecto5, Ecto6, and Ecto7 in CGXII minimal medium containing 40 g L-1 glucose. All values are given as means and standard deviations of three replicates.

Figure 5: Fed-batch cultivation with C. glutamicum strain Ecto5 using glucose as carbon source. Concentrations of dried biomass (open circles), ectoine (close triangles), glucose (open boxes), Lglutamate (closed circles), and L-lysine (closed diamonds) during cultivation are depicted. The grams of medium fed during the cultivation is indicated as a line.

Figure 6: Ectoine titer and productivities values of Ecto5 when growing on different carbon sources. From left to right values for ectoine and L-lysine titers, ectoine volumetric productivities, and ectoine specific productivities are depicted. Ecto5(pEKEx3) grew on glucose 10 g L -1 as sole carbon source. Ecto5(pEKEx3-glpFKD) grew on glycerol 10 g L-1 as sole carbon source. Ecto5(pEKEx3-nagB) grew on glucosamine 10 g L-1 as sole carbon source. Ecto5(pEKEx3-xylAB) grew on xylose 10 g L-1 as sole carbon source. Ecto5(pEKEx3-araBAD) grew on arabinose 10 g L-1 as sole carbon source. Ecto5(pECXT99A) and Ecto5(pECXT99A-amyA) grew on soluble glucose 2.5 g L-1 and starch 10 g L-1 as carbon sources. All values are given as means and standard deviations of three replicates.