Improved isolation and purification of functional human Fas receptor extracellular domain using baculovirus – silkworm expression system

Protein Expression and Purification 80 (2011) 102–109

Contents lists available at ScienceDirect

Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep

Improved isolation and purification of functional human Fas receptor extracellular domain using baculovirus – silkworm expression system Michiro Muraki ⇑, Shinya Honda Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Central 6, 1-1-1, Higashi, Tsukuba, Ibaraki 305-8566, Japan

a r t i c l e

i n f o

Article history: Received 9 May 2011 and in revised form 4 July 2011 Available online 14 July 2011 Keywords: Fas receptor Extracellular domain Purification Thrombin Baculovirus Silkworm

a b s t r a c t To achieve an efficient isolation of human Fas receptor extracellular domain (hFasRECD), a fusion protein of hFasRECD with human IgG1 heavy chain Fc domain containing thrombin cleavage sequence at the junction site was overexpressed using baculovirus – silkworm larvae expression system. The hFasRECD part was separated from the fusion protein by the effective cleavage of the recognition site with bovine thrombin. Protein G column treatment of the reaction mixture and the subsequent cation-exchange chromatography provided purified hFasRECD with a final yield of 13.5 mg from 25.0 ml silkworm hemolymph. The functional activity of the product was examined by size-exclusion chromatography analysis. The isolated hFasRECD less strongly interacted with human Fas ligand extracellular domain (hFasLECD) than the Fc domain-bridged counterpart, showing the contribution of antibody-like avidity in the latter case. The purified glycosylated hFasRECD presented several discrete bands in the disulphide-bridge non-reducing SDS-PAGE analysis, and virtually all of the components were considered to participate in the binding to hFasLECD. The attached glycans were susceptible to PNGase F digestion, but mostly resistant to Endo Hf digestion under denaturing conditions. One of the components exhibited a higher susceptibility to PNGase F digestion under non-denaturing conditions. Ó 2011 Elsevier Inc. All rights reserved.

Introduction Biochemical studies targeted on clinically important human cell-surface receptor extracellular domains have considerable significance in the development of biopharmaceuticals. Human Fas receptor (hFasR)1 was originally identified as a cell-surface antigen, against which a cell-killing monoclonal antibody was raised [1]. Presently, many roles of hFasR signaling in the immune system are still being clarified, which includes studies not only on the conventional apoptotic processes, but also on non-apoptotic processes such as cellular activation, differentiation and proliferation [2,3]. Physiologically, the expression of signaling activities of hFasR is triggered by the interaction of the extracellular domain of hFasR with that of human Fas ligand (hFasL) [4]. The potential clinical significance of hFasR function has been demonstrated through a number of evaluation studies on its usefulness in terms of diagnostics and therapeutics. In particular, the circulating level of soluble hFasR in serum and its ratio to soluble hFasL have been extensively examined for their applicability as monitoring markers in relation to the stage, prognosis and response to chemotherapy with various ⇑ Corresponding author. Fax: +81 29 861 6194. E-mail address: [email protected] (M. Muraki). Abbreviations used: hFasR, human Fas receptor; hFasL, human Fas ligand; ECD, extracellular domain; PNGase F, peptide N-glycosidase F; Endo Hf, endo-b-Nacetylglucosaminidase Hf; SDS, sodium dodecyl sulfate; DTT, dithiothreitol. 1

1046-5928/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.pep.2011.07.002

types of cancer [5–7] and other diseases [8–10], and have proved to be useful in many cases. Recently, practical information on treatment efficacy using hFasR mediated signaling system has been collected, and several types of proteins including the hFasLECD derivative [11], the specific monoclonal antibody targeted on hFasRECD [12] and the fusion protein of hFasRECD with human IgG Fc domain [13] have already entered clinical trials. Detailed characterization including three-dimensional structural analysis of human Fas receptor extracellular domain (hFasRECD) and further engineering of the molecule based on the precise analysis have been hampered partly due to the unavailability of a large amount of purified product at a reasonable cost. The basic structural feature of the cysteine-rich motif in hFasRECD is completely shared with the FasRECDs of other animal’s origin [14]. To date, the direct production of the non-Fc fusion type recombinant extracellular domain has been reported with the mouse Fas receptor holding hexahistidine tag using baculovirus – insect cell line secretory expression system [15], and with the rat Fas receptor holding an additional 41 amino acid hydrophilic domain using Escherichia coli intracellular expression procedure followed by refolding of the insoluble product [16]. The isolation of the hFasRECD part from the fusion protein with human IgG1 Fc domain (hFasRECD-Fc) was also performed by PreScission protease using the product expressed in human HeLa cells, but the ligand binding function of the liberated receptor was not characterized [17].

M. Muraki, S. Honda / Protein Expression and Purification 80 (2011) 102–109

In a previous study, we developed an efficient system for the secretory production of functional hFasRECD-Fc using baculovirus – silkworm larvae expression strategy [18]. As a further adaptation of this approach, isolation of hFasRECD was achieved by means of the effective cleavage of the inserted thrombin recognition site following the hFasRECD domain part of the hFasRECD-Fc in this study. The isolated hFasRECD was efficiently purified by the combination of Protein G column treatment and cation-exchange chromatography, and showed hFasLECD binding activity. Materials and methods Materials The expression plasmid, pM02-hFasRECD-Fc, was obtained as described in the previous paper [18]. Custom services by Takarabio Inc., Dragon-Genomics Center and by Katakura Co., Research Institute of Biological Science were used in the construction of the expression plasmid and in the transfection and cultivation of silkworm larvae, respectively. Hi-Trap Protein G column and bovine thrombin were purchased from GE Healthcare Bioscience. The centrifuging ultrafiltration device, Amicon Ultra 15 (Nominal molecular weight limit: 10 kDa), was from Millipore Co. The tag-free hFasLECD sample was obtained as described [18,19]. SDSPAGE analysis was conducted using 10–20% gradient polyacrylamide gels (SuperSep, Wako Pure Chemicals Ind. Ltd.), and was visualized by 2D-silver stain kit from Cosmo-bio Co. Chromatography columns and other reagents of analytical grade were supplied as described [18]. PNGase F and Endo Hf were the products of New England Biolabs, Inc. Construction of the expression plasmid The expression plasmid, pM02-hFasRECD-T-Fc, was prepared by introducing the insertion mutation of the coding DNA sequence for thrombin recognition site (GCTGCGGCTCCCAGAGGCAGCGCT) just after the hFasRECD gene at the junction site between the hFasRECD gene part and the human IgG1 Fc domain gene part. In Fig. 1a, the expression unit in pM02-hFasRECD-T-Fc is schematically shown.

103

The consensus amino acid sequence for thrombin recognition is generally considered to be either ABPRXY (A and B: hydrophobic amino acids, X and Y: non-acidic amino acids) or GRG [20], and the most common sequence adopted in the commercial expression plasmid vectors for removal of the tag is LVPRGS [21]. In this study, the LV was altered to AA and two additional alanine residues were included in both terminals of the original sequence in order to expose the cleavage site as much as possible to bovine thrombin for the purpose of enhancement of attack by increasing the hydrophilicity of the recognition site, at the same time avoiding the increase of steric hindrance. The resulting recognition sequence in pM02hFasRECD-T-Fc consisted of AAAPRGSA. A similar sequence (AAAPRGAA) was used in the isolation of human interleukin-4 receptor a-chain and interleukin-13 receptor a-chain from the fusion protein with mouse IgG2a Fc [22]. Expression of the hFasRECD-T-Fc in silkworm larvae The experimental procedures for the secretory expression of hFasRECD-T-Fc in silkworm larvae and the detection of production level in the hemolymph by Western blotting using anti-human IgG goat polyclonal antibody were the same as described for hFasRECD-Fc [18]. In brief, the recombinant baculovirus for the production of the hFasRECD-T-Fc in silkworm larvae hemolymph was obtained by the simultaneous transfection of pM02-hFasRECDT-Fc transfer plasmid and the linearized Bombyx mori nuclear polyhedrovirus genomic DNA lacking the cysteine protease gene [23]. The hemolymph of the fifth instar silkworm larvae infected with the above recombinant baculovirus was collected after six days breeding in the presence of saturated concentration of Nphenylthiourea, and then ultra-centrifuged under the condition of 100,000 g  1 h, at 4 °C prior to the purification. The Western blotting analysis using the anti-human IgG antibody exhibited a similar detection profile to the case of the hFasRECD-Fc [18]. Purification of the hFasRECD-T-Fc and cleavage with thrombin The recovery of the secreted hFasRECD-T-Fc in the silkworm larvae hemolymph using Protein G immobilized agarose-gel

a Polh

SIG

NP

hFasRECD

T

Fc

b S-S S-S CHO

Fc

CHO CHO CHO

Fc

hFasRECD (16.4 kDa)

hFasRECD-T-Fc (87.3 kDa)

Fig. 1. Schematic representation of the expression unit and the structures of the relevant molecules in this study. Panel a: expression unit in pM02-hFasRECD-T-Fc. Polh, polyhedrin promoter; SIG, signal peptide sequence (MRLTLFAFVLAVCALASNA); NP, N-terminal extra peptide sequence (TDLEVQLLE); hFasRECD, human Fas receptor extracellular domain (R1–N157 [18]); T, thrombin recognition sequence (AAAPR"GSA, ‘‘"’’ indicates the putative cleavage position); Fc, human IgG1 Fc domain (T158–Q373 [18]). Panel b: structures of the hFasRECD-T-Fc (left) and the hFasRECD (right). Filled circle, thrombin cleavage site; Fc, human IgG1 Fc domain. The labels, ‘‘CHO’’ and ‘‘S-S’’, indicate the position of potential N-linked carbohydrate chain attachment site and that of inter-chain disulfide bond between IgG1 Fc domains, respectively. The molecular weight excluding carbohydrate moiety is shown in parentheses.

104

M. Muraki, S. Honda / Protein Expression and Purification 80 (2011) 102–109

column was performed as described for the hFasRECD-Fc [18] except for the use of Hi-Trap Protein G column (1 ml or 5 ml) and self-prepared buffers employed in the binding and elution steps. After the buffer-exchange with 50 mM Tris-HCl (pH 7.5) using PD-10 column, the sample was directly used for the cleavage reaction with bovine thrombin without further purification. The trial cleavage reaction was conducted under the condition of 50 lg each of either the hFasRECD-T-Fc or the hFasRECD-Fc in 100 ll of 50 mM Tris-HCl (pH 7.5) at 20 °C or 37 °C, and with or without the presence of 10 mM CaCl2 using various units of bovine thrombin (No/1.0/1.6/2.5/5.0 units). The preparative cleavage reaction was performed under the condition that 6.9 mg of the hFasRECD-T-Fc in 3 ml of 50 mM Tris-HCl (pH 7.5) was digested with 1944 units of bovine thrombin at 20 °C for 24 h. After the reaction, a small amount of precipitated material was removed by centrifugation (15,000 rpm  10 min, 4 °C). Then, the sample solution was subjected to Hi-Trap Protein G column (1 ml) pre-equilibrated with 50 mM Tris-HCl (pH 7.5) to trap the human IgG1 Fc domain containing materials. The flow-through sample containing the liberated hFasRECD was collected in 1 ml each fraction. The unbound material remaining in the column was eluted by further washing with the equilibration buffer, and combined with the flow-through fraction sample.

excluding carbohydrate moieties of the hFasRECD-T-Fc, the hFasRECD (Fig. 1b) and the tag-free hFasLECD [18] were used for the calculation of their molarities. Quasi-equimolar amounts (0.61 nmol each) of the hFasRECD-T-Fc from silkworm larvae and the tag-free hFasLECD were mixed in solution. The mixture solution made from 55 lg of the hFasRECD-T-Fc and 30 lg of the hFasLECD in 230 ll of 50 mM Tris-HCl (pH 7.5) was injected into a Superdex 200 HR 10/300 size-exclusion chromatography column. The elution was conducted with 50 mM Tris-HCl plus 150 mM NaCl (pH 7.5) at the flow rate of 0.5 ml/min. On the other hand, the complex formation between the finally purified hFasRECD and the tag-free hFasLECD sample was analyzed by mixing the hFasLECD sample with a three-fold excess molar amount of the hFasRECD sample in the same buffer, column and elution conditions as described above. Three kinds of overall molar concentrations of the mixture (0.61 nmol, 1.77 nmol and 6.1 nmol as the concentration of the hFasLECD) were examined for the analysis, while keeping the ratio of hFasRECD to hFasLECD. To ensure the uniformity of the analytical condition, the molecular-weight standard mixture consisting of Aldolase (177 kDa), Ovalbumin (49.1 kDa) and Ribonuclease (15.2 kDa) were examined just before and after all the above experiments, and no change in the peak elution time (Aldolase, 25.81 min; Ovalbumin, 29.55 min; Ribonuclease, 35.12 min) was confirmed.

Purification of the hFasRECD The pooled sample solution containing the hFasRECD was divided into 1.8 ml aliquots, and buffer-exchanged with 50 mM sodium acetate (pH 5.0) using PD-10 column. The resulting solution was loaded on a Resource S 1 ml cation-exchange column pre-equilibrated with the same buffer. The recombinant protein was eluted with a linear salt gradient from 0 to 400 mM NaCl in 50 mM sodium acetate (pH 5.0) at the flow rate of 1 ml/min. One milliliter each of the elution sample was collected and analyzed by SDS-PAGE. The fractions containing the hFasRECD were pooled, then concentrated and buffer-exchanged with 50 mM Tris-HCl (pH 7.5) using an Amicon Ultra 15 centrifugation device at 4 °C for further analytical experiments. The recovery yield of hFasRECD was calculated under the assumption that the samples in each purification step were essentially pure (Table 1). Analysis of the complex formation between the hFasRECD-T-Fc/ hFasRECD and the hFasLECD An analysis of the complex formation between the Protein G column purified hFasRECD-T-Fc and the tag-free hFasLECD prepared by the secretory expression using Pichia pastoris [24] by means of size-exclusion chromatography was performed as described in the previous paper [18]. Individual components were also subjected to chromatography analysis for the determination of their independent peak elution time. The molecular weights

Treatment of the hFasRECD with endoglycosidases The glycosidase treatment of the hFasRECD under denaturing conditions was performed as follows. Ten micrograms each of the finally purified hFasRECD in the total volume of 50 ll was first denatured by heating at 100 °C for 10 min in the presence of 0.5% SDS and 40 mM DTT. To the solution containing the denatured hFasRECD, either 10 ll of 0.5 M sodium phosphate (pH 7.5) plus 10 ll of 10% NP40 and 20 ll of deionized water, or 10 ll of 0.5 M sodium citrate (pH 5.5) plus 35 ll of deionized water were added, then the digestion reaction was started by adding 5000 units each of PNGase F or Endo Hf, respectively. The reaction mixture in the total volume of 100 ll was kept at 37 °C for 1 h. The final pH of the reaction mixture with Endo Hf was 6.2–6.5, at which Endo Hf shows 50–65% of the maximum activity at pH 5.6. Ten microliters each of the reaction mixtures after 1 h were used for the SDS-PAGE analysis. The PNGase F (5000 units) treatment under non-denaturing conditions was conducted in the reaction mixture containing 10 lg of the hFasRECD in the total volume of 100 ll of 50 mM sodium phosphate (pH 7.5) at 37 °C. After 1 h, 8 h, 24 h, 48 h and 72 h, an aliquot (10 ll) of the reaction mixture was withdrawn and used for SDS-PAGE analysis. In either case, the withdrawn sample was mixed with 20 ll of (2) SDS-PAGE sample buffer without disulphide-bridge reducing reagent, and heated at 95 °C for 12 min. 0.33 lg of each sample in the denaturing reaction

Table 1 Purification of the hFasRECD-T-Fc and the hFasRECD from the silkworm larvae hemolymph.

a b c d e

Purification step

Volume (ml)

Total protein (mg)a

Recovery yield (%)b

Hemolymph Protein G affinity chromatography and buffer-exchangec Thrombin cleavage, Protein G column treatment and buffer-exchanged Cation-exchange chromatography, concentration and buffer-exchanged

25.0 24.5 74.4 18.4

1500 48.7 26.2e 13.5e

n.a. 100 123 63.4

Determined by BCA protein assay kit using bovine serum albumin as the standard. Calculated for hFasRECD part excluding carbohydrate chains. The samples in each purification step were assumed to be pure in the calculation. n.a. – not applicable. Target protein: hFasRECD-T-Fc. Target protein: hFasRECD. Normalized to the values starting from 25.0 ml hemolymph.

M. Muraki, S. Honda / Protein Expression and Purification 80 (2011) 102–109

condition and 0.16 lg of each sample in the non-denaturing condition were subjected to the analysis as shown in Fig. 5, respectively. Results Secretory expression of the hFasRECD-T-Fc The production level of the hFasRECD-T-Fc was almost equivalent to that of hFasRECD-Fc [18], and amounted to 48.7 mg after the purification using Protein G affinity column from 25.0 ml of the hemolymph. In Fig. 2a, SDS-PAGE analysis of the Protein G purified sample of the hFasRECD-T-Fc under non-reducing conditions and disulphide-bridge reducing conditions is presented. The secreted hFasRECD-T-Fc is considered to exist as a disulphidebridged molecule (Fig. 1b, left) from the difference in the migration position of the main band.

a

105

Isolation of the hFasRECD part from hFasRECD-T-Fc The hFasRECD part was isolated by the digestion of the hFasRECD-T-Fc with bovine thrombin. The cleavage reaction of the Protein G column purified hFasRECD-T-Fc sample by bovine thrombin was compared with that of the hFasRECD-Fc. As shown in Fig. 2b, the extent of cleavage progressed accordingly as the increase of the amount of used thrombin only with regard to the hFasRECDT-Fc, and 50 lg of the hFasRECD-T-Fc was completely digested within 24 h at 20 °C using 5.0 units of bovine thrombin. The difference in the reaction temperature (20 °C or 37 °C) and the presence of 10 mM CaCl2 did not affect the cleavage pattern significantly. The amount of the by-products indicated as ‘‘By’’ in the high molecular-weight region found with the hFasRECD-T-Fc sample, as well as with the hFasRECD-Fc sample, was obviously reduced during the digestion reaction even under conditions when only a

b

Fig. 2. SDS-PAGE analysis of the hFasRECD-T-Fc and the cleavage with bovine thrombin. The silkworm larvae hemolymph sample purified using Protein G affinity column chromatography was examined. Panel a: hFasRECD-T-Fc. Lanes: M, molecular-weight markers; 1, non-treated sample; 2, 2-mercaptoethanol treated sample. Panel b: Cleavage with bovine thrombin. Lanes: M, molecular-weight markers; 1–6, hFasRECD-T-Fc; 7–11, hFasRECD-Fc [18]. Used thrombin units: 1 and 7, none; 2, 0.5; 3 and 8, 1.0; 4 and 9, 1.6; 5 and 10, 2.5; 6 and 11, 5.0. The reaction was performed in the mixture volume of 100 ll at 20 °C for 24 h. By, high-molecular weight by-products; 2R + Fc, undigested hFasRECD-T-Fc; R + Fc, one hFasRECD removed hFasRECD-T-Fc; Fc, two hFasRECDs removed hFasRECD-T-Fc; R, liberated hFasRECD.

a

b

Fig. 3. Cation-exchange chromatography of Protein G column treated thrombin cleavage reaction mixture of the hFasRECD-T-Fc. Panel a, chromatographic resolution profile. Used column: Resource S 1 ml. The fraction shown in a thick underbar was collected as the final product. Inset: SDS-PAGE analysis gel. Lanes: M, molecular-weight markers (the same as in panel b); 1, before resolution; rightward arrowed lanes, the fractions (1 ml each) of rightward arrowed region in the chromatogram. Panel b, SDS-PAGE analysis of the purified product under non-denaturing conditions. Lanes: M, molecular-weight markers; 1, after Protein G column treatment; 2, after cation-exchange chromatography. R, hFasRECD.

106

M. Muraki, S. Honda / Protein Expression and Purification 80 (2011) 102–109

partial cleavage had occurred (Fig. 2b). This suggested that the byproducts originated from the relatively small aggregation of the Fc fusion proteins, in which the thrombin recognition site was easily accessible by the enzyme. Purification of the hFasRECD The isolated hFasRECD part in the thrombin cleavage reaction mixture was effectively purified by the passage through the Protein G agarose-gel column and the subsequent resolution by the cation-exchange chromatography. In Fig. 3a, the resolution profile of the Protein G column treated reaction mixture in the cationexchange chromatography is shown. The contaminated proteins in the reaction mixture after the Protein G column treatment were removed from the sample through this step (Fig. 3b). In Table 1, the course of purification of the hFasRECD-T-Fc and the hFasRECD in this study is summarized. 13.5 mg of the final product of the hFasRECD was obtained starting from 25.0 ml of the hemolymph,

a

b

d

e

g

which corresponded to the recovery yield of 63.4% based on the amount of the Protein G column purified hFasRECD-T-Fc. The resulting purified hFasRECD sample exhibited several discrete bands in the SDS-PAGE analysis under disulphide-bridge nonreducing conditions (Fig. 3b, lane 2), but appeared essentially as a broad single band after the treatment with DTT in the presence of SDS (Fig. 5a, lane 1). Evaluation of the hFasLECD binding activity The binding activity of either the hFasRECD-T-Fc or the hFasRECD to the hFasLECD was evaluated using size-exclusion chromatography (Fig. 4). In Fig. 4a and d, the elution profiles of the hFasRECD-T-Fc alone and its mixture with a quasi-equivalent molar amount of the hFasLECD are shown. Either component exhibited a strong peak at 280 nm (Fig. 4a and c). Some small peaks preceding the main peak existed in the profile of the hFasRECDT-Fc purified by Protein G column (Fig. 4a), which corresponded

c

f

h

Fig. 4. Chromatographic resolution profiles of the hFasRECD-T-Fc, the hFasRECD, the hFasLECD and their mixture using size-exclusion chromatography. Solid line, absorbance at 280 nm; broken line, absorbance at 215 nm. Used column: Superdex 200 HR 10/300. Elution buffer: 50 mM Tris-HCl plus 150 mM NaCl (pH 7.5). Panels: a, hFasRECD-T-Fc alone (30 lg, 0.34 nmol, after Protein G column purification); b, hFasRECD alone (30 lg, 1.60 nmol, final product); c, hFasLECD alone (30 lg, 0.61 nmol, final product [18]); d, mixture of a and c (0.61 nmol each); e, mixture of b (1.83 nmol) and c (0.61 nmol); f, mixture of b (5.31 nmol) and c (1.77 nmol); g, mixture of b (18.3 nmol) and c (6.1 nmol); h, SDS-PAGE analysis gel. Lane M, molecular-weight markers; lane 1, the peak fraction shown as a thick underbar in panel d; rightward arrowed lanes, the fractions (0.5 ml each) shown as rightward arrowed region in panel f. R, hFasRECD-T-Fc/hFasRECD; L, hFasLECD; lanes 2–5, artificial mixtures of the hFasRECD and the hFasLECD (the molar ratio of the ligand to the receptor are, 2, 1:0; 3, 1:1; 4, 1:2; 5, 1:3); lane 6, the peak fraction shown as a thick underbar in panel g.

M. Muraki, S. Honda / Protein Expression and Purification 80 (2011) 102–109

to the by-products in the high-molecular weight region shown in Fig. 2. The main peak (22.93 min) observed for the mixture with the hFasLECD (0.61 nmol each) (Fig. 4d) eluted earlier than that observed for the hFasRECD-T-Fc alone (23.41 min) (Fig. 4a). The peak fraction in Fig. 4d contained both the receptor and the ligand components (Fig. 4h, lane 1) and no significant peak was observed at the peak elution time of the hFasLECD (29.74 min, Fig. 4c) in Fig. 4d. This suggested very tight binding between the hFasRECD-T-Fc and the hFasLECD under the evaluation conditions. The tag-free hFasLECD under non-denaturing conditions (49.3 kDa) constituted a preassembled homotrimer which contains three equivalent binding sites to the hFasRECD, and the hFasRECD-T-Fc has two equivalent hFasRECD domains due to dimerization through the Fc part (Fig. 1b, left). The ratio of the total number of binding sites in the hFasRECD-T-Fc sample to that in the hFasLECD sample in the above mixture was calculated as approximately 0.67. On the other hand, the elution profile of the hFasRECD exhibited no significant peak at 280 nm, but a strong single peak at 215 nm due to the lack of tryptophan residue in the hFasRECD (Fig. 4b). The peak elution time of the hFasRECD (29.55 min) was much earlier than that expected from its molecular weight (16.4 kDa). The peak elution time was not close to that of Ribonuclease (35.12 min, 15.2 kDa), but was identical to that of Ovalbumin (29.55 min, 49.1 kDa). The predicted elongated architecture of the native structure of the hFasRECD belonging to the TNF receptor superfamily [25] can explain this abnormal behavior in size-exclusion chromatography. The hFasRECD is considered to exist as a monovalent monomer (Fig. 1b, right) in solution [15]. Therefore, the binding activity of the hFasRECD to the hFasLECD was evaluated by mixing hFasLECD with a three-fold molar excess amount of the hFasRECD. In this condition, the ratio of the total number of binding sites in the hFasRECD sample to that in the hFasLECD sample was calculated as 3.0, which was much higher than that used in the above case for the mixture of the hFasLECD with the hFasRECD-T-Fc. In Fig. 4e–g, the results concerning three kinds of concentration of the mixture are presented, which showed a basically similar profile to each other. Comparison of the elution profile of the two major peaks at 215 nm indicated that the elution time of the earlier peak as well as the relative area of the earlier peak compared to that of the later peak changed as the concentration of the mixture increased, whereas the elution time of the later peak remained the same (29.56 min). By increasing the concentration of the mixture ten times from 0.61 nmol to 6.1 nmol with respect to the hFasLECD, the elution time of the earlier peak changed from 27.54 min to 25.24 min, and the relative area of the earlier peak compared to

a

107

the area of the later peak increased significantly. The earlier peak contained both the receptor and ligand components, but in contrast the later peak contained only hFasRECD (Fig. 4h, center gel). Further, the analysis of the earlier peak fraction in Fig. 4g showed that the molar ratio of the hFasRECD to the hFasLECD was approximately two (Fig. 4h, lanes 2–6), and that virtually all components in the final product of the hFasRECD (Fig. 3b, lane 2) exhibiting the several discrete bands participated in the formation of the complex (Fig. 4h, lane 6). Susceptibility of the hFasRECD to endoglycosidase digestion The effect of endoglycosidase digestion on the hFasRECD produced in silkworm larvae was examined using PNGase F and Endo Hf. As shown in Fig. 5a, a significant reduction of the molecular weight of the hFasRECD was observed by the PNGase F treatment, but not by the Endo Hf treatment under denaturing conditions. Under non-denaturing conditions, one of the several discrete bands of the hFasRECD disappeared and a new band appeared at the lower molecular weight side as the reaction time increased (Fig. 5b), which revealed that the final product of the hFasRECD was composed of several glycosylated components with different susceptibility to PNGase F, and at least one component among them possessed a higher susceptibility to PNGase F than the others. Discussion It is not always easy to establish a production system for functional human proteins such as hFasRECD which contain many disulphide bridges, but which are not abundant in extended secondary structures using the cost-effective expression hosts, like bacteria and yeast, since they are less robust in post-translational modifications including disulphide-bridge formation than higher organisms. A baculovirus – silkworm larvae expression system can be an alternative to the strategies using insect and mammalian cell lines for the production of this kind of protein in a large amount [18,26]. The production level of the hFasRECD-T-Fc was almost identical to that of the hFasRECD-Fc [18] which ranked as one of the highest level of production using the baculovirus – silkworm larvae expression system reported so far [26]. Here, we have developed an efficient system for the isolation and purification of the hFasRECD using a baculovirus – silkworm larvae expression system, which may have advantages over the previously reported alternative methods for the production of other mammalian FasRECDs [15,16] from the viewpoints of both

b

Fig. 5. SDS-PAGE analysis of the susceptibility of the hFasRECD toward PNGase F and Endo Hf. The asterisks are the main band positions of used endoglycosidases. Panel a, under denaturing conditions. Lanes: M, molecular-weight markers; 1 and 3, before digestion; 2, after PNGase F (5000 units) digestion at 37 °C for 1 h; 4, after Endo Hf (5000 units) digestion at 37 °C for 1 h. Panel b, under non-denaturing conditions. Lanes: M, molecular-weight markers; 1, before digestion; 2, the reaction mixture with PNGase F (5000 units) at 37 °C after 1 h; 3, after 8 h; 4, after 24 h; 5, after 48 h; 6, after 72 h. The arrows indicate the susceptible band and the newly appeared band in the PNGase F digestion reaction.

108

M. Muraki, S. Honda / Protein Expression and Purification 80 (2011) 102–109

high expression level and simple purification procedure. Isolation of the hFasRECD from the hFasRECD-T-Fc was achieved by the digestion with bovine thrombin, which is a common protease generally used for the cleavage of tag sequences [21], and also represents the much less expensive enzymes compared to other commercially available sequence specific proteases, such as Factor X or PreScission protease. The total purification yield of the hFasRECD from 25 ml of the silkworm larvae hemolymph approximately corresponded to that from 1.4 l of the Sf9 cell line culture [15] and that from 3.4 l of the E. coli cell culture [16], respectively. In addition, the sample purity of the former counterpart was about 75%, which required further purification steps to reach near homogeneity [15]. The latter counterpart also needed several laborious purification steps including refolding of the insoluble inclusion body [16]. It is generally observed that the intact bivalent IgG molecule presents about 100-fold stronger binding activity against its specific antigen than the isolated monovalent product due to the combined synergistic strength, called avidity [27]. The isolated hFasRECD exhibited significant but much weaker binding activity to the hFasLECD as compared with the hFasRECD-T-Fc in the size-exclusion chromatography analysis in this study. Essentially any hFasRECD-T-Fc in its free state did not remain in the analysis of the mixture with the hFasLECD, whereas an obvious amount of the hFasRECD in its free state was observed even after ten-fold concentration of the initial mixture solution. This suggests that the antibody-like avidity resulting from the synergy in interaction took place in the case of the hFasRECD-T-Fc. Similar behaviors have been observed for soluble TNF receptor using either the cytotoxicity inhibition assay [28] or the cell-surface binding inhibition assay [29]. Two N-glycosylation sites exist in the hFasRECD [18], and previous analysis using HeLa cells showed no evidence of the attachment of O-glycans in hFasRECD [17]. Also, the SDS-PAGE analysis of the purified hFasRECD under disulphide-bridge non-reducing conditions exhibited several discrete bands, as is often observed for the recombinant cytokines containing N-glycan attachment sites produced in silkworm larvae [30,31]. These results suggest that the existence of several discrete bands in the final product of the hFasRECD originated from the difference in the state of Nglycosylation. The participation of virtually all the components of the hFasRECD in the complex formation with the hFasLECD indicates that the difference in the glycosylation state did not significantly affect the interaction strength with the hFasLECD. However, we also cannot exclude the possibility that the local change in protein conformation affected the susceptibility to PNGase F at this stage. It is proposed that the substantial reduction in molecular weight of the hFasRECD occurred in PNGase F digestion under the denaturing condition, but not in Endo Hf digestion under the same condition by the SDS-PAGE analysis. This revealed the plausible component of the attached N-glycans in the light of the substrate specificity of each enzyme [32]. The result suggests that the amounts of high mannose and some hybrid N-glycans susceptible to Endo H type glycosidase were small, and that paucimannosidic N-glycans were abundant in the hFasRECD. The N-linked glycan structures of the recombinant proteins of animals origin produced in silkworm larvae have been investigated. The susceptibility to endoglycosidases [33,34] and the detailed profile in the composition of the N-linked glycans [35,36] largely depend on the case. The migration position of only one band among the several bands of the hFasRECD in the SDS-PAGE shifted significantly to the lower molecular-weight side by the digestion with PNGase F under nondenaturing conditions. The different susceptibility to the PNGase F digestion might be attributed to the difference in the steric hindrance around the N-glycan attachment site in the native structure of the hFasRECD.

Human Fas receptor belongs to the TNF receptor superfamily [37,38]. It is frequently difficult to obtain high quality crystals of glycoprotein for structural analysis [39]. However, X-ray diffraction quality crystals of the complex of TNF-b with 55 kDa TNF receptor were successfully obtained using the product expressed in baculovirus – insect cell line system actually [40], which is possibly due to the abundance of the relatively small paucimannosidic structure represented by Mana1–6Manb1–4GlcNAcb1–4GlcNAc [36]. The characteristic of this abundance of paucimannosidic N-glycan is shared by the glycoproteins expressed in silkworm larvae [34]. Therefore, the efficient isolation and purification strategy described here should contribute to the determination of three-dimensional structures using X-ray crystallography as the hFasRECD alone and also as a complex with the hFasLECD in combination with the production system for the hFasLECD [19,24], which will be fundamental to structure-based drug design focusing on the signal transduction processes mediated by hFasR–hFasL system. Although the development of the expression system for the recombinant glycoproteins with humanized oligosaccharide side chains is essential for human treatment [41], the production system developed in this study may also be useful in discovering clinically important biopharmaceuticals for treatment of diseases arising from the impaired physiological function of hFasRECD. Acknowledgments The authors wish to thank H. Tanoue and H. Takakura of Takara-bio Inc., and C. Enomoto and H. Nagaya of Katakura Industries Co., Ltd. for their helpful comments to technical inquiries. This work was supported by a grant for operating expenses from the Ministry of Economy, Trade and Industry, Japan. Editorial assistance in the preparation of the manuscript by C.S. Langham of Nihon University is also appreciated. References [1] S. Yonehara, A. Ishii, M. Yonehara, A cell-killing monoclonal antibody (anti-Fas) to a cell surface antigen co-downregulated with the receptor of tumor necrosis factor, J. Exp. Med. 169 (1989) 1747–1756. [2] M.E. Peter, R.C. Budd, J. Desbarats, S.M. Hedrick, A.-O. Hueber, M.K. Newell, L.B. Owen, R.M. Pope, J. Tschopp, H. Wajant, D. Wallach, R.H. Wiltrout, M. Zörnig, D.H. Lynch, The CD95 receptor: apoptosis revisited, Cell 129 (2007) 447–450. [3] A. Strasser, P.J. Jost, S. Nagata, The many roles of Fas receptor signaling in the immune system, Immunity 30 (2009) 180–192. [4] S. Nagata, Apoptosis by death factor, Cell 88 (1997) 355–365. [5] C. Nadal, J. Maurel, R. Gallego, A. Castells, R. Longarón, M. Marmol, S. Sanz, R. Molina, M. Martin-Richard, P. Gascón, Fas/Fas ligand ratio: a marker of oxaliplatin-based intrinsic and acquired resistance in advanced colorectal cancer, Clin. Cancer Res. 11 (2005) 4770–4774. [6] A. Tamakoshi, K. Nakachi, Y. Ito, Y. Lin, K. Yagyu, S. Kikuchi, Y. Watanabe, Y. Inaba, K. Tajima, Soluble Fas level and cancer mortality: findings from a nested case-control study within a large-scale prospective study, Int. J. Cancer 123 (2008) 1913–1916. For the JACC Study group. [7] S. Holdenrieder, P. Stieber, Circulating apoptotic markers in the management of non-small cell lung cancer, Cancer Biomarkers 6 (2009/2010) 197–210. [8] C. Choi, E.N. Benveniste, Fas ligand/Fas system in the brain: regulator of immune and apoptotic responses, Brain Res. Rev. 44 (2004) 65–81. [9] L.M. Blanco-Colio, J.L. Martín-Ventura, E. de Teresa, C. Farsang, A. Gaw, G.F. Gensini, L.A. Leiter, A. Langer, P. Martineau, G. Hérnandez, J. Egido, Increased soluble Fas plasma levels in subjects at high cardiovascular risk, Atorvastatin on inflammatory markers (AIM) study, a substudy of ACTFAST, Arterioscler. Thromb. Vasc. Biol. 27 (2007) 168–174. On behalf of the ACTFAST investigators. [10] M. Sahin, O. Aydıntug, S.E. Tunc, H. Tuktak, M. Nazırog˘lu, Serum soluble Fas levels in patients with autoimmune rheumatic diseases, Clin. Biochem. 40 (2007) 6–10. [11] G. Eisele, P. Roth, K. Hasenbach, S. Aulwurm, F. Wolpert, G. Tabatabai, W. Wick, M. Weller, APO010, a synthetic hexameric CD95 ligand, induces human glioma cell death in vitro and in vivo, Neuro-Oncology 13 (2011) 155–164. [12] N. Odani-Kawabata, M. Takai-Imamura, O. Katsuta, H. Nakamura, K. Nishioka, K. Funahashi, T. Matsubara, M. Sasano, H. Aono, ARG098, a novel anti-human Fas antibody, suppresses synovial hyperplasia and prevents cartilage destruction in a severe combined immunodeficient-HuRAg mouse model, BMC Musculoskelet. Disord. 11 (2011) 221. [13] http://www.clinicaltrials.gov/ct2/show/NCT01071837?term=APG101&rank=1, 2011 (cited 04.20.11).

M. Muraki, S. Honda / Protein Expression and Purification 80 (2011) 102–109 [14] Y. Murayama, K. Terao, M. Inoue-Murayama, Molecular cloning and characterization of cynomolgus monkey Fas, Human Immunol. 61 (2000) 474–485. [15] J. Mahiou, J.-P. Abastado, L. Cabanie, F. Godeau, Soluble FasR ligand-binding domain: high-yield production of active fusion and non-fusion recombinant proteins using the baculovirus/insect cell system, Biochem. J. 330 (1998) 1051–1058. [16] P. Wisniewski, A. Master, B. Kaminska, Cloning and purification of functionally active Fas ligand interfering protein (FIP) expressed in Escherichia coli, Acta Biochim. Pol. 55 (2008) 51–56. [17] Y. Li, X. Yang, A.H.T. Nguyen, I. Brockhausen, Requirement of N-glycosylation for the secretion of recombinant extracellular domain of human Fas in HeLa cells, Int. J. Biochem. Cell Biol. 39 (2007) 1625–1636. [18] M. Muraki, S. Honda, Efficient production of human Fas receptor extracellular domain-human IgG1 heavy chain Fc domain fusion protein using baculovirus/ silkworm expression system, Protein Expr. Purif. 73 (2010) 209–216. [19] M. Muraki, Improved secretion of human Fas ligand extracellular domain by Nterminal part truncation in Pichia pastoris and preparation of the N-linked carbohydrate chain trimmed derivative, Protein Expr. Purif. 60 (2008) 205–213. [20] J.-Y. Chang, Thrombin specificity, requirement for apolar amino acids adjacent to the thrombin cleavage site of polypeptide substrate, Eur. J. Biochem. 151 (1985) 217–224. [21] J. Arnau, C. Lauritzen, G.E. Petersen, J. Pedersen, Current strategies for the use of affinity tags and tag removal for the purification of recombinant proteins, Protein Expr. Purif. 48 (2006) 1–13. [22] E. Honjo, Y. Shoyama, T. Tamada, H. Shigematsu, T. Hatanaka, S. Kanaji, K. Arima, Y. Ito, K. Izuhara, R. Kuroki, Expression of the extracellular region of the human interleukin-4 receptor a chain and interleukin-13 receptor a1 chain by a silkworm-baculovirus system, Protein Expr. Purif. 60 (2008) 25–30. [23] T. Suzuki, T. Kanaya, H. Okazaki, K. Ogawa, A. Usami, H. Watanabe, K. KadonoOkuda, M. Yamakawa, H. Sato, H. Mori, S. Takahashi, K. Oda, Efficient protein production using a Bombyx mori nuclear polyhedrosis virus lacking the cysteine proteinase gene, J. Gen. Virol. 78 (1997) 3073–3080. [24] M. Muraki, Secretory expression of synthetic human Fas ligand extracellular domain gene in Pichia pastoris: influences of tag addition and N-glycosylation site deletion, and development of a purification method, Protein Expr. Purif. 50 (2006) 137–146. [25] J. Bajorath, A. Aruffo, Prediction of the three-dimensional structure of the human Fas receptor by comparative molecular modeling, J. Comp.-Aided Mol. Design 11 (1997) 3–8. [26] T. Kato, M. Kajikawa, K. Maenaka, E.Y. Park, Silkworm expression system as a platform technology in life science, Appl. Microbiol. Biotechnol. 85 (2010) 459–470. [27] C.L. Hornick, F. Karush, Antibody affinity-III, the role of multivalence, Immunochem. 9 (1972) 325–340. [28] K. Peppel, D. Crawford, B. Beutler, A tumor necrosis factor (TNF) receptor-IgG heavy chain chimeric protein as a bivalent antagonist of TNF activity, J. Exp. Med. 174 (1991) 1483–1489.

109

[29] K.M. Mohler, D.S. Torrance, C.A. Smith, R.G. Goodwin, K.E. Stremler, V.P. Fung, H. Madani, M.B. Widmer, Soluble tumor necrosis factor (TNF) receptors are effective therapeutic agents in lethal endotoxemia and function simultaneously as both TNF carriers and TNF antagonists, J. Immunol. 151 (1993) 1548–1561. [30] D. Wu, K. Murakami, N. Liu, Y. Inoshima, T. Yokoyama, T. Kokuho, S. Inumaru, T. Matsumura, T. Kondo, K. Nakano, H. Sentsui, Expression of biologically active recombinant equine interferon-c by two different baculovirus gene expression systems using insect cells and silkworm larvae, Cytokine 20 (2002) 63–69. [31] A. Usami, S. Ishiyama, C. Enomoto, H. Okazaki, K. Higuchi, M. Ikeda, T. Yamamoto, M. Sugai, Y. Ishikawa, Y. Hosaka, T. Koyama, Y. Tobita, S. Ebihara, T. Mochizuki, Y. Asano, H. Nagaya, Comparison of recombinant protein expression in a baculovirus system in insect cells (Sf9) and silkworm, J. Biochem. 149 (2011) 219–227. [32] F. Maley, R.B. Trimble, A.L. Tarentino, T.H. Plummer Jr., Characterization of glycoproteins and their associated oligosaccharides through the use of endoglycosidases, Anal. Biochem. 180 (1989) 195–204. [33] N. Ishida, M. Tsujimoto, T. Kanaya, A. Shimamura, N. Tsuruoka, S. Kodama, T. Katayama, S. Oikawa, M. Matsui, T. Nakanishi, J. Kobayashi, H. Nakazato, Expression and characterization of human bone morphogenetic protein-2 in silkworm larvae infected with recombinant Bombyx mori nuclear polyhedrosis virus, J. Biochem. 115 (1994) 279–285. [34] K. Sasaki, M. Kajikawa, K. Kuroki, T. Motohashi, T. Shimojima, E.Y. Park, S. Kondo, H. Yagi, K. Kato, K. Maenaka, Silkworm expression and sugar profiling of human immune cell surface receptor, KIR2DL1, Biochem. Biophys. Res. Comm. 387 (2009) 575–580. [35] R. Misaki, H. Nagaya, K. Fujiyama, I. Yanagihara, T. Honda, T. Seki, N-linked glycan structures of mouse interferon-b produced by Bombyx mori larvae, Biochem. Biophys. Res. Comm. 311 (2003) 979–986. [36] T. Dojima, T. Nishina, T. Kato, T. Uno, H. Yagi, K. Kato, E.Y. Park, Comparison of the N-linked glycosylation of human b1, 3-N-acetylglucosaminyltrasferase 2 expressed in insect cells and silkworm larvae, J. Biotechnol. 143 (2009) 27–33. [37] R.M. Locksley, N. Killeen, M.J. Lenardo, The TNF and TNF receptor superfamilies: integrating mammalian biology, Cell 104 (2001) 487– 501. [38] J.-L. Bodmer, P. Schneider, J. Tschopp, The molecular architecture of the TNF superfamily, Trends Biochem. Sci. 27 (2002) 19–26. [39] F. Gruenninger-Leitch, A. D’Arcy, B. D’Arcy, C. Chène, Deglycosylation of proteins for crystallization using recombinant fusion protein glycosidases, Protein Sci. 5 (1996) 2617–2622. [40] A. D’Arcy, D.W. Banner, W. Janes, F.K. Winkler, H. Loetscher, H.-J. Schönfeld, M. Zulauf, R. Gentz, W. Lesslauer, Crystallization and preliminary crystallographic analysis of a TNF-b-55 kDa TNF receptor complex, J. Mol. Biol. 229 (1993) 555– 557. [41] D.L. Jarvis, Developing baculovirus-insect cell expression system for humanized recombinant glycoprotein production, Virology 310 (2003) 1–7.