Improved rolling circle amplification (RCA) of hepatitis B virus (HBV) relaxed-circular serum DNA (RC-DNA)

Journal of Virological Methods 193 (2013) 653–659

Contents lists available at ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

Improved rolling circle amplification (RCA) of hepatitis B virus (HBV) relaxed-circular serum DNA (RC-DNA) Nora Martel a , Selma A. Gomes b , Isabelle Chemin a , Christian Trépo a,c , Alan Kay a,∗,1 a b c

Centre de Recherche en Cancérologie de Lyon (CRCL); INSERM, U1052; CNRS, UMR 5286; UCBL1, S 1052. 151 cours Albert Thomas, 69003 Lyon, France Laboratory of Molecular Virology, Oswaldo Cruz Institute, FIOCRUZ, 21040-360 Rio de Janeiro, Brazil Hepato-Gastroenterology Unit, Hôpital de la Croix Rousse, 69004 Lyon, France

a b s t r a c t Article history: Received 12 February 2013 Received in revised form 22 July 2013 Accepted 26 July 2013 Available online 5 August 2013 Keywords: HBV Serum relaxed-circular DNA Rolling-Circle Amplification (RCA) HBV genotypes Recombinant genomes

For functional analysis of HBV isolates, epidemiological studies and correct identification of recombinant genomes, the amplification of complete genomes is necessary. A method for completely in vitro amplification of full-length HBV genomes starting from serum RC-DNA is described. This uses in vitro completion/ligation of plus-strand HBV RC-DNA and amplification using Rolling-Circle Amplification, eventually followed by a genomic PCR. The method can amplify complete HBV genomes from sera with viral loads ranging from >1.0E + 8 IU/ml down to 1.0E + 3 IU/ml. The method can be applied to archived sera that have undergone long-term storage or to archived DNA serum extracts. The genomes can easily be cloned. HBV genotypes A–G can all be amplified with no apparent problems. A recombinant subgenotype A3/genotype E genome was identified and fully sequenced. © 2013 Elsevier B.V. All rights reserved.

1. Introduction Functional analysis of hepatitis B virus (HBV, Family Hepadnaviridae, sub-family Ortho-hepadnavirus) isolates requires amplification of full-length genomes. In patients, the HBV genome exists in 2 forms, a covalently closed circular form (cccDNA) in the nuclei of infected hepatocytes and a partially double-stranded relaxed circular form (RC-DNA) in the serum. Gunther et al. (1995) have described an elegant method for single-step PCR amplification of HBV serum DNA based on the particular structure of RC-DNA, using the redundancies at the extremities of minus-strand DNA. However, this technique requires sera with relatively high viral titres, generally >104 IU/ml and is problematical for low-titre sera such as those found in occult HBV infections or in patients undergoing antiviral treatment. Other teams have used nestedPCR of 2 overlapping fragments to reconstitute full-length genomes (Chaudhuri et al., 2004; Pollicino et al., 2007) but this is tedious and requires extensive genetic manipulation to reconstitute the complete genome. A method for Rolling-Circle Amplification (RCA) of HBV genomes has been described previously (Margeridon et al., 2008). This method requires a covalently closed circular template

∗ Corresponding author. Tel.: +33 4 72 68 19 82. E-mail addresses: [email protected], [email protected] (A. Kay). 1 Permanent address: 22 rue de Flesselles, 69001 Lyon, France. Tel.: +33 4 26 17 22 57. 0166-0934/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2013.07.045

and works well with HBV cccDNA, but the necessary liver biopsies have always been rare and will become almost impossible to obtain in the future. A method for RCA of serum RC-DNA using the endogenous viral polymerase activity to complete plus-strand HBV DNA was described also, but this method has several drawbacks. Improper storage or repeated thawing of the sera can reduce the activity of the endogenous viral polymerase. It is probable that even if the sera are properly stored, polymerase activity will decline over time. Mutants that have impaired polymerase activity will also be less efficiently amplified. In any case, the DNA still has to be ligated after extraction. Finally, sometimes there is no longer any serum and only DNA extracts are available. In this study an improved method of RCA amplification of HBV RC-DNA where all steps are carried out in vitro is described. 2. Materials and methods 2.1. Sera Originally, serum extraction and viral loads were determined automatically using the COBAS AmpliPrep/COBAS TaqMan HBV Version 2.0 Test (Roche Diagnostics, Mannheim, Germany). In this test, 1 IU corresponds to 5.82 copies or genome equivalents (ge). For genotyping, sera were extracted manually with the QIAamp DNA Blood kit (Qiagen, Hilden, Germany) and HBV DNA was amplified by standard PCR covering the S gene (positions 55–1179) and sequenced. For this study, 200 ␮l of sera were

654

N. Martel et al. / Journal of Virological Methods 193 (2013) 653–659

extracted manually with High Pure Viral Nucleic Acid kit (Roche Diagnostics, Mannheim, Germany) and eluted in 50 ␮l of elution buffer. The use of the sera for research purposes is governed by 2 Authorisations (No AC-2008-238 and No DC-2008-235) from the French Ministry of Research and Technology and patients gave their informed consent. 2.2. Completion/ligation (C/L) Five ␮l of extracts were added to 5 ␮l of reaction mix so that the final concentrations were polymerase Phi29 buffer (New England Biolabs, Ipswich, MA, USA), 1×; bovine serum albumin (BSA), 0.1 mg/ml; deoxynucleotide triphosphates (dNTPs), 0.5 mM each; adenosine triphosphate, 1 mM; T4 DNA polymerase (New England Biolabs, Ipswich, MA, USA), 1.5 U and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), 200 U. As a control for the possible presence of HBV cccDNA in the serum extracts, extracts were also treated but without addition of the enzymes or nucleotides. The reactions were carried out at 45 min at 30 ◦ C followed by 20 min at 75 ◦ C to inactivate the enzymes. 2.3. Rolling Circle Amplification To the 10 ␮l of the C/L reaction were added 0.6 ␮l of the 8 RCA primers (Margeridon et al., 2008) at a concentration of the stock solution of 12.5 ␮M of each primer. The samples were denatured at 95 ◦ C for 2 min followed by annealing at 50 ◦ C for 15 s, 30 ◦ C for 15 s and 20 ◦ C for 10 min then put on ice. To this was added 9.4 ␮l of reaction mix so that the final concentrations (including ingredients from the first step) were polymerase Phi29 buffer, 1×; RCA primers, 0.75 ␮M each; BSA, 0.2 mg/ml; dithiothreitol, 2 mM; dNTPs, 2 mM each, pyrophosphatase (Fermentas, Vilnius, Lithuania), 0.01 U; polymerase Phi29 (New England Biolabs, Ipswich, MA, USA), 10 U. The RCA reaction was carried out at 30 ◦ C for 22 h followed by 65 ◦ C for 15 min to inactivate the enzyme.

For gPCR products, 1 ␮l samples were electrophoresed. The molecular weight marker was 2-log DNA marker (New England Biolabs, Ipswich, MA, USA) spiked with 1 ng of linear HBV DNA (genotype D). After electrophoresis, the agarose gels were stained with ethidium bromide and photographed. The gels were then treated with HCl to depurinate the DNA, NaOH to denature the DNA that was then neutralised with Tris–HCl before capillary transfer to HybondXL membranes (GE-Healthcare, Piscataway, NJ, USA) according to the manufacturer’s instructions. After overnight transfer using a sodium phosphate/sodium chloride/EDTA (SSPE) solution, 20×, the membranes were baked at 80 ◦ C for 2 h. They were then prehybridised for at least 1 h at 65 ◦ C in SSPE, 6×; Denhardt’s solution, 5×; sodium dodecyl sulphate (SDS), 0.5%; denatured (3 min, 100 ◦ C) sonicated salmon-sperm (sss) DNA, 100 ␮g/ml. The probe was 100 ng of gel-purified linear HBV DNA (genotype D) that was denatured (3 min, 100 ◦ C) and labelled using dCTP-␣32 P (3000 Ci/mmol) and a “Ready to Go” dCTP DNA labelling bead (GE-Healthcare, Piscataway, NJ, USA) for 45 min at 37 ◦ C. After separation from unincorporated nucleotides using a Probe-Quant G50 spin column (GE-Healthcare, Piscataway, NJ, USA), the probe was denatured along with sss DNA, added to fresh hybridisation solution and hybridised with the membranes at 65 ◦ C overnight. The membranes were washed once for 5 min with SSPE, 2×-SDS, 0.1%, once for 5 min with SSPE, 1×-SDS, 0.1% and four times for 10 min with SSPE, 0.1×SDS, 0.1%, all at 65 ◦ C. The membranes were exposed to phosphor storage screens and the screens were scanned using a Typhoon FLA 9500 PhosphorImager (GE-Healthcare, Piscataway, NJ, USA). 2.6. Intergenotypic recombination analysis Potential intergenotypic recombination was analysed using both jpHMM software (Schultz et al., 2012) and by Bootscanning with SimPlot v3.5.1 software (Lole et al., 1999). 3. Results

2.4. Genomic PCR (gPCR)

3.1. RCA amplification of extracted serum HBV RC-DNA

PCR amplification of full-length HBV genomes was carried out essentially as described by Gunther et al. (1995) with modifications. The two primers situated in the terminal redundancies of HBV minus-strand DNA were P1-AK (CCGGAAAGCTTATGCTCTTCTTTTTCACCTCTGCCTARTCATC, with HBV sequences in bold type and the Sap I cloning site underlined) and P2-AK (CCGGAGAGCTCATGCTCTTCAAAAAGTTGCATGGTGCTGGTG). The PCR reaction mix (total 50 ␮l) contained Herculase buffer, 1×; P1-AK, 0.5 ␮M; P2-AK, 0.25 ␮M; dNTPs, 250 ␮M each; Herculase II fusion polymerase (Agilent, Santa Clara, CA, USA), 1 ␮l. Cycling parameters were denaturation at 95 ◦ C for 2 min followed by 3 cycles of 95 ◦ C, 20 s, 55 ◦ C, 20 s, 72 ◦ C, 2 min 30 then 37 cycles of 95 ◦ C, 20 s, 60 ◦ C, 20 s, 72 ◦ C, 2 min 30. Initially, only 22–23 nucleotides of the primers will hybridise to the target sequences and annealing temperature is lower in the first 3 cycles. For direct gPCR amplification of serum extracts, 5 ␮l were used. For gPCR following RCA, 1 ␮l of RCA products were used.

HBV RC-DNA was directly extracted from patients’ sera. Three sera were used, one with a low viral load (genotype F, 1.15E + 3 IU/ml), one with an intermediate viral load (genotype A, 1.0E + 4 IU/ml) and one with a high viral load (genotype A, 1.38E + 8 IU/ml). Two negative controls, water and normal human serum (NHS), were extracted at the same time. To complete plusstrand HBV RC-DNA and to generate covalently closed circular HBV DNA, a mix of thermostable DNA polymerase/DNA ligase from the QuikChange Multi Site-Directed Mutagenesis kit (Agilent, Santa Clara, CA, USA) was used initially. This worked well, but carryover of the enzymes inhibited the subsequent RCA reaction (not shown) and the enzymes had to be removed by phenol/chloroform treatment and ethanol precipitation. This not only introduced extra steps but also increased the risk of laboratory contamination because the phenol/chloroform treatment had to be carried out under a fume hood outside of the normal PCR circuit. To overcome this problem, the samples were treated in one step with a mixture of heat sensitive T4 DNA polymerase and T4 DNA ligase. After heat denaturation of the enzymes used in the completion/ligation (C/L) step, the samples were subjected to Rolling Circle Amplification (RCA). There have been some reports that HBV cccDNA can be present in patients’ sera, presumably because of lysis of infected hepatocytes (Chen et al., 2004). Since these molecules are circular, they can be amplified without completion/ligation. To be sure that completion/ligation is essential and that it was not HBV cccDNA eventually present in the sera that was being amplified in the RCA reaction, serum extracts that had gone through the C/L step but in

2.5. Southern blotting To liberate unit-length HBV genomes from the high molecular weight concatemers of RCA products, 2.5 ␮l of the products were digested with Bcu I (Fermentas, Vilnius, Lithuania) before electrophoresis. Bcu I is an isoschizomer of Spe I that has a unique site in the S gene of >95% of HBV genomes, the major exception being genotype G isolates that usually have 2 sites, the common site in the S gene at position 680 and an additional site at position 2667.

N. Martel et al. / Journal of Virological Methods 193 (2013) 653–659

655

Fig. 1. Completion/ligation (C/L) of HBV serum RC-DNA, Rolling-Circle Amplification (RCA) and genomic PCR (gPCR). C/L: samples went through the complete completion/ligation step before RCA and gPCR; No C/L: samples went through the C/L step but in the absence of T4 polymerase, T4 DNA ligase and nucleotides before RCA and gPCR; direct gPCR: samples were directly amplified by gPCR without prior treatment. Panel A: ethidium bromide staining; Panel B: southern blotting using a full-length HBV genome probe (genotype D). M: 2-log DNA ladder spiked with 1 ng of linear HBV DNA (genotype D); 0: water control; N: normal human serum control; 1: low titre serum (genotype F, 1.15E + 3 IU/ml); 2: intermediate titre serum (genotype A, 1.0E + 4 IU/ml); 3: high-titre serum (genotype A, 1.38E + 8 IU/ml). The positions for a full-length HBV genome (3.2 kb) are indicated.

the absence of T4 DNA polymerase, ligase and nucleotides were also subjected to RCA. Finally, the RCA products were then re-amplified using genomic HBV PCR (gPCR). In parallel, serum extracts (plus a water control) were directly amplified by gPCR. The results are shown in Fig. 1. Ethidium bromide staining (Panel A) shows that clonable amounts of full-length HBV genomes from the highly viraemic serum, but not the low or intermediate sera, can be amplified by both C/L + RCA and by direct gPCR. Subsequent gPCR of the RCA products enables the amplification of clonable amounts of fulllength HBV genomes from all 3 of the HBV positive sera (Fig. 1, Panel A). Hybridisation confirms that this is really HBV DNA (Fig. 1, Panel B). Hybridisation also shows that there is some weak amplification of the samples with low and intermediate levels of HBV DNA in direct gPCR as well as in the samples that had gone through RCA without C/L. 3.2. Sensitivity To probe the limits of the RCA amplification, a highly viremic serum (1.38E + 8 IU/ml, genotype A) was 10-fold serially diluted in NHS before extraction. The extracts were then subjected to C/L + RCA before further amplification by gPCR. In parallel, the extracts were also directly amplified by gPCR (Fig. 2). Ethidium bromide staining (Fig. 2, Panel A) shows that direct gPCR is capable of amplifying clonable amounts of full-length HBV in up to 2 10-fold dilutions corresponding to 1.38E + 6 IU/ml. For C/L + RCA in this experiment, this is only possible for pure high-titre extracts (1.38E + 8 IU/ml), although in other experiments C/L + RCA was equivalent to direct gPCR and hybridisation (Fig. 2, Panel B) shows that the first dilution (1.38E + 7 IU/ml) is also amplified to some extent. However, when gPCR is performed on samples that had gone through C/L + RCA, clonable amounts of full-length HBV are amplified in samples corresponding to a viral load of 1.38E + 3 IU/ml. It is notable that with RCA/gPCR amplification increases with increased dilution. The probable reason for this is described in the Section 4. 3.3. HBV genotypes To be fully applicable, the method must be able to amplify all HBV genotypes. A panel of HBV positive sera (with different titres) representative of HBV genotypes A–G was chosen. Serum from a patient infected with genotype H was not available. It should be

noted that for genotypes F and G DNA serum extracts that had been archived at −20 ◦ C for over 2 years were used. The results show (Fig. 3, Panel A) that some samples with high viral load (samples A and F) are adequately amplifiable by C/L + RCA alone. A fragment of 3.2 kb is also found in sample G, but this was surprising because several full-length genotype G clones from this patient have previously been sequenced (Araujo et al., 2013) and all have the 2 Bcu I sites associated with genotype G strains. Southern blotting (Fig. 3, Panel B) shows that the 3.2 kb fragment does not hybridise and is therefore an artefact and that the 2 expected Bcu I fragments of 1987 and 1261 bp are present. All the samples are amplifiable after subsequent gPCR. Partial sequencing of the gPCR products in a region spanning the end of the C gene up to the beginning of PreS1 (>750 nt) confirmed the genotype classifications (EMBL/GenBank/DDBJ Accession numbers HF571060-HF571066) with the exception of the genotype A strain that turns out to be a subgenotype A3/genotype E recombinant. This sample was fully sequenced (HF571060) and is mostly subgenotype A3 but with genotype E sequences with breakpoints at position 1761 ± 85 and position 2403 ± 38 given by jpHMM software. Similar recombinants have been previously described (Garmiri et al., 2009). This was confirmed by Bootscan analysis with SimPlot v3.5.1 software (Fig. 4A). For comparison, the isolate of Garmiri et al. (GQ161767) that has recombinant junctions closest to those of HF571060 was also analysed (Fig. 4B). Overall, the 2 strains are not identical but are very similar. The 18-year-old patient was born in Côte d’Ivoire but now lives in France where he was diagnosed as being a chronic HBV carrier in the immunotolerent stage.

4. Discussion A method for RCA of HBV RC-DNA using the endogenous viral polymerase to complete plus strand DNA (Margeridon et al., 2008) was proposed originally. While this works, there are several drawbacks since it relies on the integrity of the viral polymerase and would be inefficient with some polymerase mutants. Also, sometimes there is no longer any serum and only DNA extracts are available. This was in fact the case for samples F and G shown in Fig. 3. To be able to amplify complete HBV genomes by RCA of extracted RC-DNA, completion of plus-strand DNA and ligation to circularise the template was carried out in one step in vitro using commercially available heat-labile DNA polymerase and ligase.

656

N. Martel et al. / Journal of Virological Methods 193 (2013) 653–659

Fig. 2. End-point titration of amplification sensitivity. A high titre serum (genotype A, 1.38E + 8 IU/ml) was 10-fold serially diluted with normal human serum before extraction. The extracts were amplified by C/L + RCA then gPCR or were directly amplified by gPCR. Panel A: ethidium bromide staining; Panel B: southern blotting using a full-length HBV genome probe (genotype D). M: 2-log DNA ladder spiked with 1 ng of linear HBV DNA (genotype D); 0: water control; N: normal human serum control; 1: pure extract of the high titre serum; 10−1 –10−7 : serial 10-fold dilutions. The positions for full-length HBV genome (3.2 kb) are indicated.

Using this strategy followed by RCA and a gPCR, full-length HBV genomes in amounts amenable to cloning (i.e. the genomic band is visible by ethidium bromide staining) could be amplified from sera that could not be amplified by gPCR alone, including a serum sample with a viral load of only 1.15E + 3 IU/ml (Fig. 1). In the European Guidelines for the management of chronic hepatitis B, along with other criteria such as serum liver enzyme levels and liver histology, 2E + 3 IU/ml is the lower limit of viral load advised for intention to treat (EASL, 2012). The method is

therefore capable of amplifying full-length HBV genomes over a wide range of clinically relevant viral loads, although it was not possible to amplify a sample with a viral load of only 3.1E + 2 IU/ml (not shown). There have been some reports that free HBV cccDNA that is normally found in the nuclei of infected hepatocytes can be found in the serum, presumably by release from damaged cells (Chen et al., 2004). In the samples used in this study, no evidence was found for this. For the samples that went through RCA without the complete C/L step (absence of the enzymes and nucleotides),

Fig. 3. Amplification of HBV genotypes A–G. Panel A: ethidium bromide staining; Panel B: southern blotting using a full-length HBV genome probe (genotype D). M: 2-log DNA ladder spiked with 1 ng of linear HBV DNA (genotype D); 0: water control; A: HBV genotype A, 1.7E + 8 IU/ml; B: genotype B, 1.63E + 5 IU/ml; C: genotype C, 5.56E + 4 IU/ml; D: genotype D, 9.97E + 3 IU/ml; E: genotype E, 1.39E + 4 IU/ml; F: genotype F, 1.9E + 8 IU/ml; G: genotype G, 1.26E + 6 IU/ml. The positions for full-length HBV genome (3.2 kb) are indicated.

N. Martel et al. / Journal of Virological Methods 193 (2013) 653–659

657

BootScan - Query: Q-HF571060

A

100

A1-AB246336 A2-EF208113 A3-AY934764 B-D50522 C-D50519 D-AY233291 E-AB091255 F-X75658 G-AB056513 H-AY090457

95 90 85 80 75 70

% of P Permuted Trees

65 60 55 50 45 40 35 30 25 20 15 10 5 0 0

100

200

300

400

500

600

700

800

900 1 000 1 100 1 200 1 300 1 400 1 500 1 600 1 700 1 800 1 900 2 000 2 100 2 200 2 300 2 400 2 500 2 600 2 700 2 800 2 900 3 000 3 100 3 200 Position

Window: 200 bp, Step: 20 bp, GapStrip: On, Reps: 100, Kimura (2-parameter), T/t: 2,0, Neighbor-Joining

BootScan - Query: A3E_GQ161767

B

100

A1_AB246336 A2_EF208113 A3_AY934764 B_D50522 C D50519 C_D5051 9 D_AY233291 E_AB091255 F_X75658 G_AB056513 H_AY090457

95 90 85 80 75 70

% of Permuted Trees

65 60 55 50 45 40 35 30 25 20 15 10 5 0 0

100

200

300

400

500

600

700

800

900 1 000 1 100 1 200 1 300 1 400 1 500 1 600 1 700 1 800 1 900 2 000 2 100 2 200 2 300 2 400 2 500 2 600 2 700 2 800 2 900 3 000 3 100 3 200 Position Window: 200 bp, Step: 20 bp, GapStrip: On, Reps: 100, Kimura (2-parameter), T/t: 2,0, Neighbor-Joining

PreS1/S2/S (2848-835)

PreS1/S2/S (2848-835)

PreC/C (1814-2452) X (1374-1838)

Pol (2307-1623)

Pol (2307-1623)

Fig. 4. Bootscan (SimPlot) analysis of subgenotype A3/genotype E recombinant full-length genomes. Panel A: query sequence HF571060 described in this study. Panel B: query sequence GQ161767 described by Garmiri et al. (2009). Parameters are shown. A window size of 200 bp was used, but using 400 bp did not alter the recombination breackpoints. A physical map of HBV open reading frames is shown underneath. Genbank Accession numbers, strain origin and colour codes for the subgenotype and genotype reference sequences are: A1 – AB246336, South Africa, dark blue; A2 – EF208113, Germany, turquoise; A3 – AY934764, Gambia, blue; B – D50522, Japan; grey; C – D50519, Japan, brown; D – AY233291, South Africa, dark green; E – AB091255, Côte d’Ivoire, red; F – X75658, France, green; G – AB156513, USA, yellow; H – AY090457, Nicaragua, black.

there is no amplification in the RCA step and in the subsequent gPCR there are only faint signals of amplification shown by hybridisation, even with the high-titre sample. This is normal because the gPCR can amplify RC-DNA. The faint signals can be explained in part by the fact that only 1/20th of the RCA reaction went into the gPCR and in part by damage to RC-DNA during the RCA

reaction. Amplification of RC-DNA by the gPCR requires that the terminal redundancies of minus-strand DNA remain intact. The strong 3 →5 proofreading activity of Phi29 polymerase may have removed the 3 redundancy from many of the RC-DNA molecules. The C/L step is therefore essential for successful RCA of HBV RCDNA.

658

N. Martel et al. / Journal of Virological Methods 193 (2013) 653–659

To test the sensitivity of the method, an end-point titration experiment was done (Fig. 2). To make this experiment as realistic as possible, it was not extracts from a high-titre serum that were diluted but rather the high titre serum was serially 10-fold diluted with NHS before extraction and amplification, thereby reflecting the real-life situation of extraction and amplification of sera with different viral loads. With direct gPCR, efficient amplification only occurs down to dilution 10−2 , corresponding to a viral load of 1.38 E + 6 although hybridisation shows that residual amplification occurs at higher dilutions. C/L + RCA alone is less efficient than direct gPCR in this experiment with only the pure extract showing efficient amplification. However, in the subsequent gPCR there is efficient amplification down to a viral load of 1.38E + 3 IU/ml, a gain in sensitivity of 3-logs over gPCR alone. Two interesting phenomena can be observed in this experiment. The first is that while amplification with RCA alone decreases with dilution, gPCR amplification of samples initially amplified by RCA increases up to a certain point. This is reproducible, although in some experiments there was a tapering off in the last positive dilution. It can also be observed in Fig. 3 where samples that can be efficiently amplified by RCA do not necessarily give the strongest signals in the subsequent gPCR. This is why only 1 ␮l of the RCA reaction is used in the gPCR. The answer to this paradox probably lies in the gPCR protocol. The manufacturer gives the polymerisation rate of the polymerase used as 2 kb/min. The elongation time of 2 min 30 is therefore sufficient for amplifying unit-length HBV genomes but not for efficient amplification of HBV dimers or higher order concatemers. When the number of HBV genomes present in the high-molecular weight DNA RCA products that are put into the gPCR is high with respect to the quantities of RCR primers used, the likelihood that a forward and a reverse primer will anneal to both ends of a unit-length HBV genome is low, and the first rounds of PCR will generate many dead end products. As the starting material (RCA products) is diluted out, the probability of generating unit-length HBV genomes in the first rounds that can be efficiently amplified by the chain reaction increases. This minor problem can perhaps be alleviated by increasing the concentrations of the PCR primers used in the gPCR. This is always delicate and the recommendations of the manufacturer concerning primer concentrations were followed. The second phenomenon, more serious, is the extremely abrupt cessation of amplification between dilutions 10−5 and 10−6 . The 10−5 dilution corresponds to a serum of 1.38E + 3 IU/ml and means that 161 HBV genome equivalents are being put into the C/L reaction. This suggests that circularisation of RC-DNA may be the limiting step, with perhaps only 1% of RC-DNA molecules being circularised. There is no formal proof, but it is most likely that it is the plus-strand of HBV RC-DNA that is circularised. There are several obstacles to the circularisation of minus-strand DNA, the terminal redundancies and the viral polymerase covalently attached to the 5 terminus (Seeger et al., 2007). Even though there is a Proteinase K treatment during extraction, at least the tyrosine residue should remain covalently attached. It cannot be ruled out that damaged RC-DNA molecules that have lost the 5 redundancy can be repaired and ligated. The only obstacle to circularisation of plus-strand DNA is the capped oligoribonucleotide primer attached to the 5 end (Lien et al., 1986). The RNA is not a problem since T4 DNA ligase can do RNA-DNA ligations, it is the cap structure and plus-strands that have lost at least the cap can easily be repaired and ligated. During development of the technique, a mix of RNase A/T1 was added to the C/L reaction, but this had no obvious effect (not shown). It would perhaps de judicious to add RNase H. Finally, all HBV genotypes from A to G could be amplified (Fig. 3) and since genotype F strains are easily amplified (Figs. 1 and 3), the closely related genotype H should not be a problem. This does not mean that all the genotypes are amplified equally well, only that

there seem to be no major obstacles. Interestingly, the genotype A sample turned out to be a recombinant of subgenotype A3 and genotype E. The patient was born in Côte d’Ivoire and presumably was infected there at birth or shortly afterwards. This extends the list of countries where such recombinants have been found that includes Cameroon, Gabon, Ghana and Guinea (Garmiri et al., 2009; Kurbanov et al., 2005; Makuwa et al., 2006). There are other advantages to using RCA. The reaction is isothermal, Phi29 polymerase has a very strong proofreading activity and is very faithful and is highly processive, polymerising up to 70,000 nucleotides without leaving the template (Blanco et al., 1989). The risk of generating artificial recombinant genomes that can occur in conventional PCR (Gorzer et al., 2010) is therefore greatly reduced. Samples that can be adequately amplified with RCA alone can fully benefit from this. The genomes can easily be cloned by cutting with an enzyme that cuts the genome only once (Bcu I, EcoR I, Xho I, Xba I, . . .). Even if it is necessary to add on a gPCR, this is equivalent to a nested PCR but with the advantages that full-length genomes are directly amplified and is less error-prone because the first round (RCA) is of very high fidelity. In addition, since the RCA products are concatemers of HBV genomes, gPCR can be done using partially overlapping forward and reverse primers anywhere in the HBV genome. The original gPCR of Gunther et al. (1995) exploited the unique structure of HBV RC-DNA, with the forward and reverse primers hybridising to the terminal redundancies of HBV RC-DNA, and can therefore not be replaced. Primers hybridising to the terminal redundancies were used in this study because one of the aims was to do head-to head comparisons of gPCR on both RC-DNA extracts and those that had gone through RCA. However, this is a sensitive region of the HBV genome, especially the region covered by primer P2 of Gunther et al. that covers the beginning of the PreCore region. The ATG initiation codon is sometimes mutated and in genotype G strains codon 2 is generally a stop codon. In addition, mutations at positions 1808–1812, covered by this primer, can influence HBeAg expression of subgenotype A1 strains (Kramvis and Kew, 2007). Since the sequences obtained are imposed by the sequence of the primer, such mutations would be missed. Amplification using primers situated elsewhere within the HBV genome can resolve such problems. A pair of forward/reverse primers that overlap only at the Bcu I site in the S gene have been used successfully (not shown). HBV genomes generated by this gPCR can be blunt-end cloned. For transfection studies (Gunther et al., 1995), these genomes can be excised using Bcu I. For genomes that have more than 1 Bcu I site, primers have been designed following the strategy of Gunther et al. by placing a Sap I site immediately adjacent to the Bcu I site so that Sap I cleavage will liberate an authentic full-length HBV genome. This study shows that a combination of in vitro completion/ligation, RCA and gPCR is superior to gPCR alone for the amplification of full-length HBV genomes from extracted HBV RCDNA. The other major technique for amplification of full-length HBV genomes, especially from low titre sera (<4E + 2 IU/ml) such as those often found in occult hepatitis B infections, is nestedPCR amplification of 2 or more overlapping sub-genomic fragments (Chaudhuri et al., 2004; Pollicino et al., 2007). However, this greatly increases the risk of introduction of PCR errors and the generation of artificial “recombinant” genomes. The use of multiple PCR primers also imposes their sequence in the final products. In addition, substantial genetic engineering is required for the reconstitution of a full-length genome. In the technique described in this study, the major problem concerning sensitivity seems to be the low level of circularisation of RC-DNA and it is here that major improvements are possible. Another approach would be to increase the volumes of sera used for extraction, but with the risk of increasing the concentration of inhibitors of the RCA and/or the gPCR reactions.

N. Martel et al. / Journal of Virological Methods 193 (2013) 653–659

5. Conclusions Full-length HBV genomes can now be RCA amplified from extracted serum RC-DNA under controlled conditions. The amplification is effective for viral loads of over 1E + 8 IU/ml down to less than 1E + 3 IU/ml and the products can easily be cloned for functional or molecular epidemiological analysis and full characterisation of recombinant genomes. Acknowledgements We thank Franc¸oise Berby for technical assistance and Pr. Paul Dény and Dr. Sandrine Le Naour for patient information. This work was supported by the Agence National de Recherche sur le SIDA et les Hépatites Virales (ANRS) [grant number 12,149] to A.K. and S.A.G.; an ANRS training grant to N.M.; the Institut National de la Santé et de la Recherche Médicale (INSERM, France)-Fundac¸ão Oswaldo Cruz (FIOCRUZ, Brazil) collaborative program to A.K., C.T. and S.A.G.; the Région Rhône-Alpes student exchange program (ExploRA’Doc) to N.M.; and the Université Claude Bernard Lyon 1 (UCBL1) co-thesis program to N.M. The funding bodies did not intervene at any stage in the making of this paper. References Araujo, N.M., Araujo, O.C., Silva, E.M., Villela-Nogueira, C.A., Nabuco, L.C., Parana, R., Bessone, F., Gomes, S.A., Trepo, C., Kay, A., 2013. Identification of novel recombinants of hepatitis B virus genotypes F and G in human immunodeficiency virus-positive patients from Argentina and Brazil. J. Gen. Virol. 94, 150–158. Blanco, L., Bernad, A., Lazaro, J.M., Martin, G., Garmendia, C., Salas, M., 1989. Highly efficient DNA synthesis by the phage phi 29 DNA polymerase. Symmetrical mode of DNA replication. J. Biol. Chem. 264, 8935–8940. Chaudhuri, V., Tayal, R., Nayak, B., Acharya, S.K., Panda, S.K., 2004. Occult hepatitis B virus infection in chronic liver disease: full-length genome and analysis of mutant surface promoter. Gastroenterology 127, 1356–1371. Chen, Y., Sze, J., He, M.L., 2004. HBV cccDNA in patients’ sera as an indicator for HBV reactivation and an early signal of liver damage. World J. Gastroenterol. 10, 82–85.

659

EASL, 2012. EASL clinical practice guidelines: Management of chronic hepatitis B virus infection. J. Hepatol. 57, 167–185. Garmiri, P., Loua, A., Haba, N., Candotti, D., Allain, J.P., 2009. Deletions and recombinations in the core region of hepatitis B virus genotype E strains from asymptomatic blood donors in Guinea, west Africa. J. Gen. Virol. 90, 2442–2451. Gorzer, I., Guelly, C., Trajanoski, S., Puchhammer-Stockl, E., 2010. The impact of PCRgenerated recombination on diversity estimation of mixed viral populations by deep sequencing. J. Virol. Methods 169, 248–252. Gunther, S., Li, B.C., Miska, S., Kruger, D.H., Meisel, H., Will, H., 1995. A novel method for efficient amplification of whole hepatitis B virus genomes permits rapid functional analysis and reveals deletion mutants in immunosuppressed patients. J. Virol. 69, 5437–5444. Kramvis, A., Kew, M.C., 2007. Molecular characterization of subgenotype A1 (subgroup Aa) of hepatitis B virus. Hepatol. Res. 37, S27–S32. Kurbanov, F., Tanaka, Y., Fujiwara, K., Sugauchi, F., Mbanya, D., Zekeng, L., Ndembi, N., Ngansop, C., Kaptue, L., Miura, T., Ido, E., Hayami, M., Ichimura, H., Mizokami, M., 2005. A new subtype (subgenotype) Ac (A3) of hepatitis B virus and recombination between genotypes A and E in Cameroon. J. Gen. Virol. 86, 2047–2056. Lien, J.M., Aldrich, C.E., Mason, W.S., 1986. Evidence that a capped oligoribonucleotide is the primer for duck hepatitis B virus plus-strand DNA synthesis. J. Virol. 57, 229–236. Lole, K.S., Bollinger, R.C., Paranjape, R.S., Gadkari, D., Kulkarni, S.S., Novak, N.G., Ingersoll, R., Sheppard, H.W., Ray, S.C., 1999. Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination. J. Virol. 73, 152–160. Makuwa, M., Souquiere, S., Telfer, P., Apetrei, C., Vray, M., Bedjabaga, I., MouingaOndeme, A., Onanga, R., Marx, P.A., Kazanji, M., Roques, P., Simon, F., 2006. Identification of hepatitis B virus subgenotype A3 in rural Gabon. J. Med. Virol. 78, 1175–1184. Margeridon, S., Carrouee-Durantel, S., Chemin, I., Barraud, L., Zoulim, F., Trepo, C., Kay, A., 2008. Rolling circle amplification, a powerful tool for genetic and functional studies of complete hepatitis B virus genomes from low-level infections and for directly probing covalently closed circular DNA. Antimicrob. Agents Chemother. 52, 3068–3073. Pollicino, T., Raffa, G., Costantino, L., Lisa, A., Campello, C., Squadrito, G., Levrero, M., Raimondo, G., 2007. Molecular and functional analysis of occult hepatitis B virus isolates from patients with hepatocellular carcinoma. Hepatology 45, 277–285. Schultz, A.K., Bulla, I., Abdou-Chekaraou, M., Gordien, E., Morgenstern, B., Zoaulim, F., Deny, P., Stanke, M., 2012. jpHMM: recombination analysis in viruses with circular genomes such as the hepatitis B virus. Nucleic Acids Res. 40, W193–W198. Seeger, C., Zoulim, F., Mason, W.S., 2007. Hepadnaviruses. In: Howley, P., Knipe, D. (Eds.), Fields Virology. Lippincott Williams & Wilkins, Philadelphia, pp. 2977–3029.