Improved strategy for molecular genetic diagnostics in juvenile nephronophthisis

Improved Strategy for Molecular Genetic Diagnostics in Juvenile Nephronophthisis Erika Heninger, MSc, Edgar Otto, PhD, Anita Imm, MT, Gianluca Caridi, PhD, and Friedhelm Hildebrandt, MD ● Juvenile or type 1 nephronophthisis (NPH1), an autosomal recessive cystic kidney disease, represents the most common genetic cause of end-stage renal disease in the first two decades of life. Because the disease is caused by large homozygous deletions of the NPHP1 gene in approximately 66% of patients with nephronophthisis, molecular genetic testing offers a method for the definite diagnosis of NPH1 and avoids the invasive procedure of renal biopsy. We recently developed an algorithm for molecular genetic diagnosis of NPH1 that efficiently detects homozygous deletions. However, a major limitation remained for the detection of heterozygous deletions that cause NPH1 in combination with point mutations at the other NPHP1 allele. Because a partial sequence from the NPHP1 region recently became available through the Human Genome Projects, we exploited this information to develop novel polymorphic markers from this genetic region for the detection of heterozygous deletions of NPHP1, thus bridging the diagnostic gap. Five novel polymorphic microsatellites positioned within the large common NPHP1 deletion were generated. Two multiplex polymerase chain reaction sets using two and three polymorphic markers from the NPHP1 deletion region together with one positive control marker allowed four different diagnostic problems to be solved in one diagnostic setup: (1) detection of the classic homozygous deletion of NPH1, (2) detection of a rare smaller homozygous deletion of NPH1, (3) testing for a heterozygous deletion, and (4) potential exclusion of linkage to NPHP1. The newly generated multiplex marker sets will greatly enhance the efficacy of molecular diagnostics in NPH through improved detection of heterozygous deletions. © 2001 by the National Kidney Foundation, Inc. INDEX WORDS: Nephronophthisis; nephronophthisis type 1 (NPH1); NPHP1; molecular genetic diagnosis.

N

EPHRONOPHTHISIS type 1 (NPH1), also termed juvenile nephronophthisis, is an autosomal recessive cystic disease of the kidney (Online Mendelian Inheritance in Man [OMIM] no. 256100). NPH1 represents the most common genetic cause of end-stage renal disease in children,1-4 which develops by a median age of 13 years.5 The diagnosis of NPH1 is suspected if there is a history of polyuria, polydipsia, anemia, and growth retardation together with a renal ultrasound result of normal kidney size, lack of corticomedullary differentiation, increased echogenicity, and later in the course of the disease, cysts at the corticomedullary border of the kidneys.6-9 The gene (NPHP1) responsible for NPH1 has been identified by positional cloning.10-12 That the NPHP1 gene product nephrocystin encodes an src homology 3 domain10,11,13 points toward a potential role of this gene product in protein-protein interactions, eg, in signal transduction at focal adhesions, contact points between cells and extracellular matrix, and adherens junctions.14,15 This is in accord with the finding that nephrocystin interacts with p130Cas, a major component of focal adhesion signaling, and also has been localized to cell-cell contacts at adherens junctions16 (E. Otto and F. Hildebrandt, unpublished data). NPH1 belongs to a group of diseases (nephron-

ophthisis/medullary cystic kidney disease complex) that share identically the characteristic renal histological triad of (1) tubular basement membrane disintegration, (2) tubular atrophy with cyst development, and (3) interstitial cell infiltration with fibrosis.2,15 For recessive nephronophthisis without extrarenal organ involvement, three different disease variants have been localized to three different genetic loci: juvenile nephronophthisis (NPH1) maps to chromosome 2q12-q1310,11; From University Children’s Hospital, Freiburg University, Freiburg, Germany; Pediatrics and Nephrology Research Group of the Hungarian Scientific Academy, First Pediatric Department, Semmelweis University, Budapest, Hungary; and the Laboratory and Department of Nephrology, G. Gaslini Institute, Genoa, Italy. Received September 27, 2000; accepted in revised form January 5, 2001. Supported in part by grant no. 49498-IC-1-98-2-HU ERASMUS EPS-I from the Socrates/Erasmus Program (E.H.); grant no. Hi 381/7-1 from the Deutsche Forschungsgemeinschaft (F.H.); grant no. ZKF1-A1 from the Zentrum Klinische Forschung, Freiburg (F.H.); and FSP Zystogenese from the State of Baden-Wuerttemberg (F.H.). Address reprint requests to Friedhelm Hildebrandt, MD, University Children’s Hospital, Mathildenstrasse 1, D-79106 Freiburg, Germany. E-mail: [email protected] © 2001 by the National Kidney Foundation, Inc. 0272-6386/01/3706-0003$35.00/0 doi:10.1053/ajkd.2001.24514

American Journal of Kidney Diseases, Vol 37, No 6 (June), 2001: pp 1131-1139

1131

1132

a gene locus for infantile nephronophthisis (NPH2), which leads to end-stage renal disease in infancy, has been identified in a single family and localized to 9q22-q3117; and a locus for adolescent nephronophthisis (NPH3), which results in terminal renal failure at a median age of 19 years, localizes to 3q21-q22.18,19 Because there is genetic locus heterogeneity, NPH types 1, 2, and 3 represent distinct disease entities. The present study is concerned with positive molecular genetic diagnosis of NPH1 (juvenile nephronophthisis) with isolated renal involvement. Interestingly, of all children with presumed NPH, the disease is caused in approximately 66% by large deletions of the NPHP1 gene that are homozygous, ie, they occur on both parental chromosomes.5,20,21 This large common deletion is not caused by a founder effect and arises by homologous recombination between two copies of a 45-kb direct repeat that flank the NPHP1 gene (Fig 1C and D).22 Besides this large common deletion, a few unusual rearrangements have been described that all lead to homozygous loss of the entire NPHP1 gene.22 In addition, we

HENINGER ET AL

recently cloned and characterized the shortest deletion of NPHP1 reported to date in a family with NPH1 (family F12). It spans the region from intron 2 up to and beyond the 3⬘ flanking region of the gene and occurs within a Long Interspersed Nuclear Element 1 (LINE1) element (Fig 1C and D).23 Homozygous deletions of the NPHP1 region have also been described in patients with NPH and ocular motor apraxia type Cogan.24,25 However, unanswered to date is why some patients present with isolated NPH1 whereas others experience NPH1 in combination with ocular motor apraxia type Cogan, although there seems to be no distinction on a molecular genetic basis.22 The prevalence of NPH1 has been estimated as 1 in 1 million inhabitants in the United States.26 Therefore, the expected frequency of a defective NPHP1 allele would be approximately 1 in 1,000 individuals. In a recent study, we identified homozygous deletions of NPHP1 in 74 of 124 families (58%) in which at least one child was affected with NPH1. In 5 additional families, we found the combination of a heterozygous dele-

Fig 1. Genomic structure of the NPHP1 genetic region with order of markers used. (A) Position of STS markers from set NPH-A in relation to a physical map of the NPHP1 locus (see C). (B) Position of STS markers from set NPH-B in relation to a physical map of the NPHP1 locus (see C). (C) Physical map of the NPHP1 locus. The centromeric (cen) to telomeric (tel) orientation is indicated. The NPHP1 gene (exons, vertical hatches; introns, circumflexes) is shown in relation to the common large 330-kb inverted duplication (filled arrows). Two oblique lines indicate that the 330-kb duplication is not drawn to scale. The 45-kb direct duplication is represented by open arrows. A partial restriction enzyme map for Cla I (C) and Sfi I (S) is given as published.21 A 50-kb size bar is provided. (D) The extent of the large common deletion in NPHP1 is shown as an open bar with deletion borders within the direct repeat as vertically hatched bars.22 The extent of the rare shorter deletion of 140 kb in family F12 is shown as an open bar.23 (E) Four PAC clones of the region isolated previously23 together with PAC clones RP11-528g9 and RP11-322f4, from which new STS markers were derived, are shown in relation to a partial restriction enzyme map for Cla I (C) and Sfi I (S). Names of PACs are given to the left of the horizontal lines that represent PACs. Sizes are given in parentheses, if known. PAC ends that have not been mapped are indicated as dashed horizontal lines.

GENETIC DIAGNOSTICS IN NEPHRONOPHTHISIS

tion with a hemizygous point mutation.20 Altogether, 10 different hemizygous point mutations have been described to date in a total of 14 patients. All point mutations very likely lead to loss of function of NPHP1.20 In the same study, linkage to NPHP1 was excluded in 16 of 124 NPH1 families (13%), and heterozygous deletions were excluded in 25 of 124 NPH1 families (20%). After identification of the NPHP1 gene responsible for NPH1, molecular genetic diagnosis can be performed by showing the presence of the deletions or point mutations in the NPHP1 gene, avoiding such invasive diagnostic measures as renal biopsy (http://www.genetests.org).10,11,27,28 We recently developed an algorithm for molecular genetic diagnosis that efficiently detects homozygous deletions.20 However, a major limitation remained for the detection of heterozygous deletions that cause NPH1 in combination with point mutations in the other NPHP1 allele. Because a partial sequence of genomic clones from the NPHP1 region recently became available through the Human Genome Projects, we exploited this information to develop novel polymorphic markers from this genetic region for the detection of heterozygous deletions of NPHP1 by showing parental noncontribution of one allele in the affected child. The newly generated marker sets allows four different diagnostic problems to be solved in one experiment: (1) detection of the classic homozygous deletion of NPH1, (2) detection of the rare shorter homozygous deletion of NPH1, (3) testing for a heterozygous deletion, and (4) potential exclusion of linkage to NPHP1. PATIENTS AND METHODS

Patients Blood samples and pedigrees were obtained on the basis of informed consent from patients with the presumed diagnosis of isolated NPH and their parents. To show the ability of the new diagnostic strategy of detecting two different forms of homozygous deletions, a heterozygous deletion and absence of linkage to NPH1, distinct families representing these different diagnostic constellations were selected from our cohort studied previously.20 In the affected individuals, clinical diagnosis was made by a (pediatric) nephrologist. In all cases, the minimal diagnostic criteria were fulfilled: such characteristic clinical signs as polyuria, polydipsia, anemia, and growth retardation in the presence of incipient chronic renal failure, together with a result from renal biopsy characteristic of NPH.29 In most cases, renal ultrasound was performed that showed the typical pattern of NPH.6 Genomic

1133

DNA was isolated by standard methods30 directly from blood samples or Epstein-Barr virus–transformed peripheralblood lymphocytes.31

Generation of New Markers to the NPHP1 Gene Locus Novel polymorphic DNA markers were generated by using a newly developed search strategy for microsatellite markers in electronic databases. Specifically, a text file containing 16 repeats of dinucleotides AC, AG, AT, and CG; 11 repeats of trinucleotides ATA, AAC, AAG, AAT, ACG, AGG, ACC, ATT, CGG, and CCG; and 8 repeats of tetranucleotides GATA, GGAA, GAAT, GGAT, GTAT, CCGG, AATT, and GATT was used as a search query for the sequence comparison program BLAST (http://www3.ncbi.nlm. nih.gov). The queries were searched against partial sequences of the recently released human PAC clones RP11528G9 (accession no. AC036166.2) and RP11-322f4 (accession no. AC013268.2), generated from the human high-throughput genome sequencing project (Fig 1E). Eighteen dinucleotide, trinucleotide, and tetranucleotide repeats were found. Primer pairs were designed to the sequence flanking the repeats (Table 1). These repeat markers were analyzed for polymorphism using DNA samples from six unrelated control individuals. Polymorphic markers were assembled into two multiplex polymerase chain reaction (PCR) sets (NPH-A and NPH-B) for haplotyping of families with NPH. Analysis for a homozygous deletion of the NPHP1 gene was performed by PCR on genomic DNA of patients with NPH. PCR reactions were performed as multiplex reactions, ie, simultaneous amplification of several sequence-tagged site (STS) markers in one PCR reaction, to ensure a true internal control for the presence or absence of a homozygous deletion. In addition, multiplex PCRs greatly reduce the number of experiments necessary. PCR product sizes were optimized to allow simultaneous detection on polyacrylamide gel electrophoresis (Table 1). Multiplex PCR for the diagnostic set NPH-A was performed with three polymorphic markers localized within the common NPHP1 deletion: del-16, del-5-5(2), and del-10 (Fig 1A and C). As an internal positive control marker localized outside the deletion, we used marker RanBP11/12 (Table 1).32 The second multiplex set NPH-B consists of three polymorphic markers: two microsatellite markers del-2 and del-9 localized within the common large deletion region of the NPHP1 gene (Fig 1B and C). Marker D2S1896,33 localized outside the deletion region, was used as an internal control for the NPH-B marker set (Table 1).

Multiplex PCR and Haplotype Analysis PCR was performed by radioactive multiplex PCR, described previously,5 using dry template; 6 to 18 pmol of primers; 0.2 mmol/L each of deoxyadenosine triphosphate, deoxyguanosine triphosphate, and deoxythymidine triphosphate; primer concentrations as given below, 2.5 ␮mol/L of deoxycytidine triphosphate, 0.1 ␮Ci/␮L of phosphorus 32– labeled ␣deoxycytidine triphosphate, 10 mmol/L of TrisHCl (pH 7.3), 50 mmol/L of KCl, 0.001% gelatin (wt/vol); and 0.3 U of Thermus aquaticus DNA polymerase (Perkin

1134

HENINGER ET AL Table 1.

Marker Multiplex marker set NPH-A* del-16

Polymorphic DNA Markers In and Around the Region Deleted in NPH1

Forward Primer (5⬘ 3 3⬘)

gcaaattgcaatgggaagg

del-5-5(2)

cctgatctggagaagtaggt

del-10

gctgtgcatctcttctgact

RanBP11/12‡

tcatgccaaaatctaaaccc

Multiplex marker set NPH-B* del-2

gctgtatgccaggaaacaag

del-9

gatggctttggtcaccaaga

D2S1896§

gagttgcaattataagccattg

Polymorphic but not used del-4(2)-4

gtgccacacacttaatatcc

del-18

tgcgacagggtatttcttcc

del-8

gcacattgtgcacatgtacc

Reverse Primer (5⬘ 3 3⬘)

Length (bp)

Heterozygosity (%)

No. of Alleles

ctcagtctggcaatg aatcc acaatgaatgggtct caagc aggtacctggaactc tgaga ctggttttaggagta aaaacag

⬇102

56

5

Deleted†

⬇185

52

6

Deleted†

⬇209

38

7

Deleted†

80

—

—

ctgaccttcctttca ggact tgtgagtccccagat tcgta gcacaagagtgtccc tga

⬇123

14

4

Deleted†

⬇93

52

7

Deleted†

175-193

79

10

182

—

Not determined

153

—

Not determined

⬇166

90

Not determined

accttgcaggctgca aacc ttaaatgaaagcatc tacatcca ctaaaggttgcactc cagga

Comment

Not deleted

Not deleted

Polymorphic, not deleted† Duplicated, not deleted† Duplicated†

*Markers from each multiplex marker set were amplified together in a single PCR reaction (multiplex PCR). †Newly generated in this study. ‡Data from Nothwang et al,32 1998. §Data from Dib et al,33 1996.

¨ berlingen, FRG). After initial denaturation at Elmer Cetus, U 94°C for 4 minutes, 27 cycles were performed for 30 seconds at 94°C denaturation, 30 seconds at 58°C annealing, 60 seconds at 72°C extension, and 7 minutes final extension at 72°C. For primer sequences, see Table 1. Primer concentrations in marker set NPH-A were del-16 (10 pmol/␮L), del-5-5(2) (25 pmol/␮L), del-10 (50 pmol/␮L), and RanBP11/12 (10 pmol/␮L). Primer concentrations in multiplex set NPH-B were del-2 (15 pmol/␮L), del-9 (10 pmol/ ␮L), and D2S1896 (60 pmol/␮L). Amplified fragments were separated by electrophoresis in 8% denaturing polyacrylamide sequencing gels. The gels were blotted onto Whatman paper (Rotenburg, Fulda, Germany) and dried, and autoradiography was performed for 2 to 16 hours. For haplotype analysis, highly polymorphic microsatellite markers that localize to chromosome 2q13 were examined by radioactively labeled PCR followed by polyacrylamide gel electrophoresis and autoradiography and scored as described previously.5 The following microsatellite markers were used in haplotype analysis: del-16, del-2, del-5-5(2), del-10, del-9, and D2S1896.

RESULTS

Identification of New Polymorphic Markers Eighteen markers containing dinucleotide, trinucleotide, or tetranucleotide repeats were iden-

tified from novel human genomic sequence (see Methods). Eight of these markers were found to be polymorphic in six unrelated control individuals. Five polymorphic microsatellite markers were identified to localize within the common NPHP1 deletion region by testing on DNA templates from patients with NPH1 in whom the presence of the large common homozygous deletion has been shown previously20 (patients F9 II-1, F703 II-3, F684 II-1, F692 II-1, F680 II-1 and II-2, and F728 II-1, II-2, and II-3). For the deletion analysis, marker Wi-18516-1/2 (GenBank accession no. G24662) was used in a multiplex PCR as an internal unrelated control to show the presence of the deletion (data not shown). Polymorphic markers that localized within the NPHP1 common deletion region were further analyzed for heterozygosity. Heterozygosity indices and number of alleles established on genomic DNA samples of 53 to 82 unrelated individuals are listed in Table 1, together with additional information on the newly generated markers. Marker

GENETIC DIAGNOSTICS IN NEPHRONOPHTHISIS

1135

del-4(2)-4 was not used for the study because it did not localize within the large common deletion region. Markers del-18 and del-8 were not used because they represented a multilocus marker by virtue of their localization within the direct duplication (Fig 1C). Heterozygosity indices are listed in Table 1. Detection of Homozygous NPHP1 Deletions Because the presence of a homozygous deletion of the NPHP1 gene can be considered proof for the diagnosis of NPH1,10,20,21,22 we performed as a first diagnostic step deletion detection by multiplex PCR using marker set NPH-A with three markers from within the deletion and one marker from outside the deletion region, as well as marker set NPH-B with two markers from within the deletion and one positive control marker from outside the deletion region, as described in Methods. Figure 2 shows results exemplified by NPH1 families F728 and F692. The use of multiplexes NPH-A and NPH-B shows the presence of a large deletion of the NPHP1 region in the children with the presumptive diagnosis of NPH1. Through demonstration of the large common deletion, the diagnosis of NPH1 was safely ascribed to affected children of both families. Detection of the Large Common and Rare Short Deletions Deletion markers del-16 and del-2 discriminate between the common large and rare shorter deletions within the NPH1 genetic region (Fig 1A, B, and C), shown in Fig 3A and B for the example of family F12. Detection of Heterozygous NPHP1 Deletions Parental noncontribution of polymorphic markers allows the detection of a heterozygous deletion. We used multiple polymorphic markers to circumvent noninformativity of markers. Deletion analysis by multiplex PCR using the three polymorphic markers del-10, del-5-5(2), and del-16 of marker set NPH-A, which are localized within the common NPHP1 deletion region, yields a heterozygous deletion in the affected child of NPH1 family F275 (Fig 4). The presence of this deletion was previously confirmed by fluorescence in situ hybridization, and the second NPHP1 allele in this child was shown to carry a loss-of-function point mutation.20

Fig 2. PCR deletion analysis with multiplex marker sets yields a homozygous deletion in the affected children of families with NPH1. (A) Results of multiplex NPH-A in family F728. The three polymorphic markers del-10, del-5-5(2), and del-16 are positioned within the common NPHP1 deletion region. The nonpolymorphic marker RanBP11/12 is localized outside the deletion region and used as a positive control (see Fig 1A and C). Marker names are given on the left. Size ranges are denoted by a vertical bar. For product sizes, see Table 1. Note that in contrast to the positive control marker RanBP11/12, the other three markers yield no product in the affected children (II-1, II-2, and II-3) of family F728, whereas products are present in the parents (father, I-1; mother, I-2), thus showing the presence of a homozygous deletion of NPHP1 in these affected children. (B) Results of multiplex NPH-B in family F692. Markers del-2 and del-9 are from within the common NPH1 deletion region. Polymorphic marker D2S1896 from outside the deletion region is used as a positive control (see Fig 1B and C). Marker names are given on the right. For product sizes, see Table 1. Note that in contrast to the positive control marker D2S1896, the other two markers yield no product in the affected child (II-1) of family F692, whereas products are present in the father (I-1), mother (I-2), and unaffected child (II-2). Absence of products in the affected child shows the presence of a homozygous deletion, thus confirming the diagnosis of NPH1.

1136

Fig 3. Deletion markers del-16 and del-2 discriminate between the common large and rare short deletions within the NPHP1 genetic region. (A) Results of multiplex A in family F12. Markers del-10, del-5-5(2) and del-16 are located within the common deletion region of the NPHP1 gene (Fig 1A and C). Marker RanBP11/12 serves as a positive control because it localizes outside the large common deletion region (Fig 1A and C). Deletion markers del-10 and del-5-5(2) yield no product in any of the three affected children (II-1, II-2, and II-3) of F12, thus showing the presence of a homozygous deletion. Note that in contrast, the products of deletion marker del-16 appear in all three affected children of this family, thus showing the presence of the rare shorter deletion of family F12. Deletion marker del-16 has been tested on several patients with NPH1 (see Methods) in whom the large common homozygous deletion had been previously confirmed and shown to be deleted in all children from other families with the exception of family 12. This is consistent with this marker’s position within the interval between the centromeric breakpoint of the large common deletion and the centromeric breakpoint of the shorter deletion of family F12 (see Fig 1A, C, and D). (B) Results of multiplex B in family F12. D2S1896 is the internal undeleted control marker of multiplex B (see Table 1). Deletion markers del-2 and del-9 are from the common deletion region of the NPHP1 gene. Deletion marker del-9 yielded a PCR product in both parents of F12, but was absent from all affected children (II-1, II-2, and II-3). Note that deletion marker del-2 was amplified in the father and mother and all affected children, as well. Deletion marker del-2 has been tested on several patients with NPH1 (see Methods) in whom the large common homozygous deletion had been previously confirmed and shown to be deleted in all children from other families with the exception of family 12. This is

HENINGER ET AL

Fig 4. Deletion analysis by multiplex PCR yields a heterozygous deletion in the affected child of NPH1 family F275. The pedigree of the parents and affected child is shown above the gel electrophoresis panel. The three polymorphic markers del-10, del-5-5(2), and del-16 are localized within the common NPH1 deletion region (see Fig 1A and C). The nonpolymorphic marker RanBP11/12 positioned outside the deletion region is used as a positive control. Marker names are given on the left. Size ranges are denoted by a vertical bar. For product sizes, see Table 1. Note that for markers del-55(2) (arrow) and del-16 (arrow head), the allele of the father (I-1) is not transmitted to the affected child (II-1). This paternal noncontribution shows the presence of a heterozygous deletion in NPHP1 in the father of F275 that is transmitted to the affected child.

Haplotype Analysis for Linkage Because multiplex marker sets NPH-A and NPH-B together contain six polymorphic markers, performing both multiplexes, in addition to answering questions of homozygous or heterozygous deletions, allows haplotypes (alleles of

consistent with this marker’s position within the interval between the centromeric breakpoint of the large common deletion and the centromeric breakpoint of the shorter deletion of family F12 (see Fig 1A, C, and D).

GENETIC DIAGNOSTICS IN NEPHRONOPHTHISIS

Fig 5. Results from haplotype analysis in NPH family F444. Marker names are shown with left individuals. For marker order, see Fig 1A through C. Note that the two affected children inherited alternative haplotypes from the father (black versus white), thus excluding the NPHP1 locus as responsible for NPH1 in this family. Squares denote males; circles, females; black symbols, affected individuals. For children, the paternal haplotype is drawn to the left and the maternal haplotype is drawn to the right.

neighboring markers) of great informativity to be generated. A result from haplotype analysis is shown in Fig 5 for family F444. Transmission of alternative paternal haplotypes to both affected children excludes the NPHP1 locus as responsible for the disease in this family and thereby excludes the diagnosis of NPH1. DISCUSSION

In this study, we attempted to overcome the notorious difficulty detecting heterozygous deletions of NPHP1 without having to resort to the laborious technique of fluorescence in situ hybridTable 2. Marker

del-16 del-5-5(2) del-10 D2S1896 del-2 del-9

1137

ization. Through the generation of only two multiplex marker sets derived from novel human genomic sequence, we designed a method that remedies many of the limitations for molecular genetic diagnostics of NPH1. The use of two independent multiplexes with three versus two deletion markers and one positive control marker each now allows safe diagnosis of the homozygous and, if informative, heterozygous NPHP1 deletions. It is important to note that this approach requires DNA analysis of the affected child and both parents. Because heterozygosity indices of the newly generated markers from the deletion region were 56%, 52%, 38%, 14%, and 52% for markers del-16, del-5-5(2), del-10, del-2, and del-9, respectively, the likelihood that at least one of these markers from this haplotype together with marker D2S1896 is heterozygous is very high. This a priori likelihood can be calculated as the product of the nonheterozygosity of all markers used. As listed in Table 2, the residual nonheterozygosity of the full haplotype amounts to only 1.14%. Therefore, in approximately 99% of all cases, a haplotype using these two marker sets should be informative for the detection of a heterozygous deletion. Recombinants, which would confound these calculations, are expected to represent extremely rare events because all six markers are located within an interval of less than 1 cM of sex-averaged genetic distance. In families with more than one affected child, such haplotypes can be evaluated for linkage to the NPHP1 locus. In a diagnostic context, proof of linkage will not be an issue because the presence of a heterozygous or homozygous deletion will lead to the diagnosis of NPH1, and for statistical reasons, a family of seven or more affected children would be required for proof of linkage. However, exclusion of linkage can safely be shown even with two affected children in one

A Priori Likelihood That a Haplotype of Marker Sets NPH-A and NPH-B is Informative in a Parent Heterozygosity (%)

Nonheterozygosity (%)

Residual Nonheterozygosity (%)

56 52 38 79 14 52

44 48 62 21 86 48

44 21.12 13.09 2.75 2.36 1.14

1138

HENINGER ET AL

family (Fig 5). The likelihood that linkage cannot be excluded in a family of two affected children is 1 in 16 because the a priori likelihood that a certain one of two possible haplotypes segregates by chance from both parents to both children is 1 in 24. Patients in whom linkage to NPHP1 is excluded most likely have a form of isolated NPH other than type 1.20 As recommended (Kommission fuer Oeffentlichkeitsarbeit, 1995), we refrained from performing presymptomatic diagnosis because no apparent benefit results for the patients at a time in the course of NPH when serum creatinine levels are still normal. In asymptomatic siblings of children with proven NPH1, yearly creatinine measurements or renal ultrasound examination is recommended to detect the development of renal failure early enough to initiate supportive therapy, ie, treatment of anemia, renal bone disease, growth retardation, and adequate salt and water intake. At this symptomatic stage, molecular genetic testing as a confirmation of the diagnosis is warranted. In this study, we exploited the recent availability of a partial sequence of genomic clones from the NPHP1 region through the Human Genome Projects to generate novel polymorphic markers from this genetic region. This allowed the detection of heterozygous deletions of NPHP1, thus bridging the diagnostic gap. In summary, the usefulness of the two marker sets generated is enhanced because together they allow four different diagnostic problems to be solved in one experiment: (1) detection of the classic homozygous deletion of NPH1, (2) detection of a rare smaller homozygous deletion of NPH1, (3) testing for a heterozygous deletion, and (4) potential exclusion of linkage to NPHP1. This diagnostic test is available for clinical cases of presumed NPH1 (http://www.genetests.org), whereas prenatal testing is not offered yet on a routine basis. The newly generated multiplex marker sets thus will greatly enhance the efficacy of molecular diagnostics in NPH. REFERENCES 1. Kleinknecht C: The inheritance of nephronophthisis, in Spitzer A, Avner ED (eds): Inheritance of kidney and urinary tract diseases. Boston, MA, Kluwer Academic, 1989, pp 277-294 2. Hildebrandt F: Nephronophthisis, in Avner ED, Barratt

TM, Harmon W (eds): Pediatric Nephrology. Baltimore, MD, Lippincott, Williams, and Wilkins, 1999, pp 453-458 3. Hildebrandt F, Jungers P, Gru¨nfeld J-P: Medullary cystic and medullary sponge renal disorders. in Schrier WGC (ed): Diseases of the Kidney. Boston, MA, Little, Brown, and Company, 1996, pp 499-520 4. Hildebrandt F, Waldherr R, Kutt R, Brandis M: The nephronophthisis complex: Clinical and genetic aspects. Clin Invest 70:802-808, 1992 5. Hildebrandt F, Strahm B, Nothwang HG, Gretz N, Schnieders B, Singh-Sawhney I, Kutt R, Vollmer M, Brandis M: Molecular genetic identification of families with juvenile nephronophthisis type 1: Rate of progression to renal failure. APN Study Group. Arbeitsgemeinschaft fuer Paediatrische Nephrologie. Kidney Int 51:261-269, 1997 6. Blowey D, Querfeld U, Geary D, Warady B, Alon U: Ultrasonic findings in juvenile nephronophthisis. Pediatr Nephrol 10:22-24, 1996 7. Ala-Mello S, Jaaskelainen J, Koskimies O: Familial juvenile nephronophthisis. An ultrasonographic follow-up of seven patients. Acta Radiol 39:84-89, 1998 8. Chuang YF, Tsai TC: Sonographic findings in familial juvenile nephronophthisis-medullary cystic disease complex. J Clin Ultrasound 26:203-206, 1998 9. Aguilera A, Rivera M, Gallego N, Nogueira J, Ortuno J: Sonographic appearance of the juvenile nephronophthisiscystic renal medulla complex. Nephrol Dial Transplant 12: 625-626, 1997 (letter) 10. Hildebrandt F, Otto E, Rensing C, Nothwang HG, Vollmer M, Adolphs J, Hanusch H, Brandis M: A novel gene encoding an SH3 domain protein is mutated in nephronophthisis type 1. Nat Genet 17:149-153, 1997 11. Saunier S, Calado J, Heilig R, Silbermann F, Benessy F, Morin G, Konrad M, Broyer M, Gubler MC, Weissenbach J, Antignac C: A novel gene that encodes a protein with a putative src homology 3 domain is a candidate gene for familial juvenile nephronophthisis. Hum Mol Genet 6:23172323, 1997 12. Nothwang HG, Stubanus M, Adolphs J, Hanusch H, Vossmerbaumer U, Denich D, Kubler M, Mincheva A, Lichter P, Hildebrandt F: Construction of a gene map of the nephronophthisis type 1 (NPHP1) region on human chromosome 2q12-q13. Genomics 47:276-285, 1998 13. Otto E, Kispert A, Schatzle S, Lescher B, Rensing C, Hildebrandt F: Nephrocystin: Gene expression and sequence conservation between human, mouse, and Caenorhabditis elegans. J Am Soc Nephrol 11:270-282, 2000 14. Hildebrandt F: Identification of a gene for nephronophthisis. Nephrol Dial Transplant 13:1334-1336, 1998 15. Hildebrandt F, Otto E: Molecular genetics of the nephronophthisis–medullary cystic kidney disease complex. J Am Soc Nephrol 11:1753-1761, 2000 16. Donaldson JC, Dempsey PJ, Reddy S, Bouton AH, Coffey RJ, Hanks SK: Crk-associated substrate p130(Cas) interacts with nephrocystin and both proteins localize to cell-cell contacts of polarized epithelial cells. Exp Cell Res 256:168-178, 2000 17. Haider NB, Carmi R, Shalev H, Sheffield VC, Landau D: A Bedouin kindred with infantile nephronophthisis demonstrates linkage to chromosome 9 by homozygosity mapping. Am J Hum Genet 63:1404-1410, 1998

GENETIC DIAGNOSTICS IN NEPHRONOPHTHISIS

18. Omran H, Fernandez C, Jung M, Haeffner C, Fargier B, Villaquiran A, Waldherr R, Gretz N, Brandis M, Rueschendorf F, Reis A, Hildebrandt F: Identification of a new gene locus for adolescent nephronophthisis, on chromosome 3q22 in a large Venezuelan pedigree. Am J Hum Genet 66:118127, 2000 19. Omran H, Haeffner C, Burth S, Fernandez C, Fargier B, Villaquiran A, Nothwang HG, Schnittger S, Lehrach H, Woo D, Brandis M, Sudbrak, R, Hildebrandt F: Human adolescent nephronophthisis: Gene locus synteny with polycystic kidney disease in pcy mice. J Am Soc Nephrol 12:107-113, 2001 20. Hildebrandt F, Rensing C, Betz R, Sommer U, Birnbaum S, Imm A, Omran H, Leipoldt M, Otto E, APN Study Group: Establishing an algorithm for molecular genetic diagnostics in 127 families with juvenile nephronophthisis. Kidney Int 59:434-445, 2001 21. Konrad M, Saunier S, Heidet L, Silbermann F, Benessy F, Calado J, Le Paslier D, Broyer M, Gubler MC, Antignac C: Large homozygous deletions of the 2q13 region are a major cause of juvenile nephronophthisis. Hum Mol Genet 5:367-371, 1996 22. Saunier S, Calado J, Benessy F, Silbermann F, Heilig R, Weissenbach J, Antignac C: Characterization of the NPHP1 locus: Mutational mechanism involved in deletions in familial juvenile nephronophthisis. Am J Hum Genet 66:778-789, 2000 23. Otto E, Betz R, Rensing C, Schaetzle S, Kurnit D, Kuntzen T, Vetsi T, Imm A, Hildebrandt F: A deletion distinct from the classical homologous recombination of juvenile nephronophthisis type 1 (NPH1) allows exact molecular definition of deletion breakpoints. Hum Mutat 16:211223, 2000 24. Saunier S, Morin G, Calado J, Benessy F, Silbermann F, Antignac C: Large deletions of the NPH1 region in Cogan syndrome (CS) associated with familial juvenile nephronophthisis (NPH). Am J Hum Genet 61:346A, 1997 (abstr)

1139

25. Betz R, Rensing C, Otto E, Mincheva A, Zehnder D, Lichter P, Hildebrandt F: Children with ocular motor apraxia type Cogan carry deletions in the gene (NPHP1) for juvenile nephronophthisis. J Pediatr 136:828-831, 2000 26. Potter DE, Holliday MA, Piel CF, Feduska NJ, Belzer FO, Salvatierra O Jr: Treatment of end-stage renal disease in children: A 15-year experience. Kidney Int 18:103-109, 1980 27. Ala-Mello S, Sankila E, Koskimies O, de la Chapelle A, Kaariainen H: Molecular studies in Finnish patients with familial juvenile nephronophthisis exclude a founder effect and support a common mutation causing mechanism. J Med Genet 35:279-283, 1998 28. Caridi G, Dagnino M, Gusmano R, Ginevri F, Murer L, Ghio L, Piaggio G, Ciardi MR, Perfumo F, Ghiggeri GM: Clinical and molecular heterogeneity of juvenile nephronophthisis in Italy: Insights from molecular screening. Am J Kidney Dis 35:44-51, 2000 29. Waldherr R, Lennert T, Weber HP, Fodisch HJ, Scharer K: The nephronophthisis complex. A clinicopathologic study in children. Virchows Arch 394:235-254, 1982 30. Nothwang HG, Hildebrandt F: Purification of nucleic acids from eukaryotic cells, in Hildebrandt F, Igarashi P (eds): Techniques in Molecular Medicine. Berlin, Germany, Springer, 2000, pp 50-70 31. Steel C, Philipson J, Arthur E: Possibility of EB virus preferentially transforming a subpopulation of human B lymphocytes. Nature 270:729-731, 1977 32. Nothwang HG, Rensing C, Kubler M, Denich D, Brandl B, Stubanus M, Haaf T, Kurnit D, Hildebrandt F: Identification of a novel Ran binding protein 2 related gene (RANBP2L1) and detection of a gene cluster on human chromosome 2q11-q12. Genomics 47:383-392, 1998 33. Dib C, Faure S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J: A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature 380:152-154, 1996