Improvement of biocontrol efficacy of Trichoderma harzianum vs. Fusarium oxysporum f. sp. lycopersici through UV-induced tolerance to fusaric acid

Biological Control 67 (2013) 397–408

Contents lists available at ScienceDirect

Biological Control journal homepage: www.elsevier.com/locate/ybcon

Improvement of biocontrol efficacy of Trichoderma harzianum vs. Fusarium oxysporum f. sp. lycopersici through UV-induced tolerance to fusaric acid Marinella Marzano 1, Antonia Gallo, Claudio Altomare ⇑ Institute of Sciences of Food Production (ISPA), National Research Council (CNR), Via Amendola 122/O, 70125 Bari, Italy

h i g h l i g h t s

g r a p h i c a l a b s t r a c t

 The phytotoxin fusaric acid is

inhibitory to Trichoderma harzianum growth.  A UV-C mutant tolerant to fusaric acid at a concentration of 120 lg/g was generated.  The mutant was more effective against Fusarium wilt of tomato than the wild type.  The expression of the gene MDRProB is suppressed in the mutant when exposed to fusaric acid.

a r t i c l e

i n f o

Article history: Received 31 July 2012 Accepted 11 September 2013 Available online 19 September 2013 Keywords: Trichoderma harzianum Fusarium oxysporum f. sp. lycopersici Biological control Competition Fusaric acid UV-mutagenesis

a b s t r a c t Competition is one of the potential mechanisms of the antagonistic action of Trichoderma harzianum against Fusarium oxysporum. The competitive capability of the T. harzianum isolate ITEM 908 (Th908) vs. an isolate of F. oxysporum f. sp. lycopersici was improved via enhancement of the tolerance to growth-inhibitory metabolites produced by F. oxysporum. HPTLC and HPLC analyses led to the identification of fusaric acid (FA) as the major metabolite in culture filtrate of the phytopathogenic F. oxysporum strain ITEM 2797 (Fo2797). FA, a phytotoxin which has also been reported to be released in soil, totally inhibited the growth of Th908 on PDA containing 120 lg of FA per gram in 3-day trials. Through UV-C irradiation and subsequent selection of mutants able to grow on PDA supplemented with culture extracts of Fo2797 or FA, one stable tolerant mutant (Th908-5) with unaltered physiological features and rhizosphere competence was isolated. The biocontrol capability of the UV-mutant Th908-5 was compared to that of the wild-type strain Th908 on tomato plants grown in a substrate heavily infested with Fo2797 in two separate trials. The reduction of the disease by Th908-5 was highly (P < 0.01) to extremely (P < 0.001) significant, while only marginally significant (P < 0.05) and inconsistent biocontrol was achieved by Th908. In addition, in non-inoculated vermiculite, Th908-5 increased the emergence and growth of tomato plants compared to the control. Th908 and Th908-5 were investigated for the expression of five genes (MDR ProB, MDR BrefA, MDR Protein2, Hydro II, ThPTR2) encoding proteins putatively associated with T. harzianum biocontrol function and involved in the mechanisms of multidrug resistance (MDR) or competition for space and nutrients. When the mutant strain was exposed to FA, the expression of the gene MDR ProB, encoding a protein associated with MDR was suppressed, suggesting a role for the gene in response to FA. Since UV-mutants are not regarded as genetically modified organisms (GMO) and their circulation and use is not subjected to restrictions that apply to strains derived by genetic transformation, the improved strain Th908-5 could be readily available for application in the field. Ó 2013 Elsevier Inc. All rights reserved.

⇑ Corresponding author. Fax: +39 080 5929374. 1

E-mail address: [email protected] (C. Altomare). Present address: Institute of Biomembranes and Bioenergetics CNR, Bari, Italy.

1049-9644/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.biocontrol.2013.09.008

398

M. Marzano et al. / Biological Control 67 (2013) 397–408

1. Introduction Fusarium oxysporum Schlechtend.: Fr. is a cosmopolitan soiland rhizosphere-inhabiting fungal species complex that includes both pathogenic and nonpathogenic strains (Leslie and Summerell, 2006). The fungus can survive in soil for long periods of time through the production of overwintering chlamydospores (Burgess, 1981; Beckman, 1987). Plant pathogenic forms cause tracheomycoses (a.k.a. Fusarium wilts) or foot and root rots in a great number of economically important plant species (Beckman, 1987). They have a pronounced pathogenic specialization and are grouped into formae speciales and races based on their host range and variety specificity (Armstrong and Armstrong, 1981; Kistler, 1997). Fusarium oxysporum f. sp. lycopersici (Sacc.) W. C. Snyder & H. N. Hans. is the pathogenic form that causes wilts of tomato. It is found world-wide but is more prevalent in warmer climates where it causes severe yield losses of both field and greenhouse tomato crops (Jones et al., 1991). The most effective method of control of diseases caused by F. oxysporum is the use of resistant cultivars, when these are available (Fravel et al., 2003). However the onset of new races of the pathogen which overcome the host resistance, by spontaneous random mutation or parasexuality, is possible (Beckman, 1987; Cai et al., 2003; Sidhu and Webster, 1979). Some systemic fungicides may control the disease, but only partially (Amini and Sidovich, 2010; Bolton, 1984; Gullino et al., 2002; Song et al., 2004). Soil fumigation is effective in eradicating the resident inoculum (Miguel et al., 2004) but is expensive and poses environmental and safety concerns (Fravel et al., 2003; Scott et al., 2012). Long-term crop rotation may achieve the same result (Curl, 1963; Hopkins and Elmstrom, 1984; Scott et al., 2012), but the method is economically impracticable where agriculture is intensive and highly specialized (Miguel et al., 2004). For the above reasons, alternative options for management of pathogenic F. oxysporum are needed. Biological control with antagonistic Trichoderma spp. has proven to be a potential alternative to chemical control of several soil-borne plant pathogens (Harman et al., 2004). In particular, species of Trichoderma have been found to be effective in controlling crown and root rot diseases of many crop plants (Verma et al., 2007). However, the level of control of diseases caused by F. oxysporum by otherwise successful biocontrol strains of Trichoderma spp. has occasionally been found to be inadequate or inconsistent (Elad et al., 1980; Hadar et al., 1979; Larkin and Fravel, 1998; Nel et al., 2006; Sivan and Chet, 1989a). It is known that one particular strain of Trichoderma may be differentially effective against different plant pathogens (Bell et al., 1982; Harman et al., 1989). Since a variety of mechanisms of action may be brought into play within the interaction of Trichoderma with different fungi and with the plant (Harman, 2000; Howell, 2003), it is conceivable that differences in the efficacy of one particular strain against different plant pathogens might be due to its potential to express high levels of one or another mechanism of action. In some cases mycoparasitism, a complex process that finally results in dissolution of the target fungus’ cell wall by lytic enzymes released by Trichoderma, has been proposed as a major mechanism of biocontrol of root rot fungi, such as Rhizoctonia, Sclerotium and Pythium (Chet et al., 1998; Elad et al., 1983; Grinyer et al., 2004; Mendoza-Mendoza et al., 2003; Reithner et al., 2011; Scherm et al., 2009; Sivan and Chet, 1989a). In other cases, disease control by Trichoderma has been associated with production of antibiotics (Howell, 1998; Lifshitz et al., 1986). There is correlative evidence that competition may play a major role in the interaction of Trichoderma with F. oxysporum (Marois and Mitchell, 1981; Ordentlich et al., 1991; Sivan and Chet, 1989b; Segarra et al., 2010). Therefore, it is conceivable that the low level of biocontrol of F. oxysporum may be due to the low competitive activity of some Trichoderma strains towards this

particular pathogen (Dubey et al., 2007; Sivan and Chet, 1989b; Whipps, 1987). Competition between microorganisms occurs when a vital factor, such as nutrients or space, is available in limited quantity. Under these limiting conditions, production of inhibitory compounds able to stop or slow down the growth of other microorganisms confers on the producing microbe an ecological advantage over the competitors (Bolwerk et al., 2003; Demain and Fang, 2000; Karlovsky, 2008). This particular form of aggressive competition, has been referred to as ‘‘interference competition’’ (Karlovsky, 2008; Wicklow, 1992). In this sense, antifungal metabolites released by F. oxysporum can be regarded as chemical weapons used to enhance survival and prevalence of the pathogen over the biocontrol agent. Members of the F. oxysporum species complex are known to synthesize a number of biologically active compounds (Vesonder and Golínski, 1989). Some of these metabolites have been recognized to have a role in plant pathogenesis and are regarded as phytotoxins, some have been studied mainly as mycotoxins potentially harmful to humans and animals, and some others show a variety of biological activities, including antimicrobial activity (Desjardins, 2006). In particular, enniatin (EN), beauvericin (BEA) and fusaric acid (FA) are three naturally occurring metabolites of F. oxysporum (Desjardins, 2006) that exhibit antimicrobial activity (Bacon et al., 2006; El-Hasan et al., 2008; May et al., 2000; Meca et al., 2010; Son et al., 2008; Wang and Xu, 2012). An inhibitory effect of EN against Trichoderma harzianum Rifai has been reported recently by Meca et al. (2010). Strains of the species T. harzianum have been used for biological control of plant diseases of vegetable and cereal crops (Harman, 2000; Harman et al., 2004). Trichoderma harzianum strain ITEM 908 (Th908) is an effective biocontrol agent of crown, stem and root rot diseases caused by Rhizoctonia, Sclerotinia and Pythium in tomato and other vegetable crops (Altomare, unpublished) it is being registered as a commercial biopesticide. However, biocontrol of F. oxysporum f. sp. lycopersici by Th908 was found to be poor (Altomare, unpublished) and improvement of the efficacy against this pathogen would be advantageous in order to broaden the range of diseases controlled. Various strategies can be used to improve the efficacy of biological control agents and reduce the inconsistency of biocontrol (for a review of this topic, see Spadaro and Gullino, 2005). One of these is the genetic manipulation of wild-type strains. For instance, strains of Trichoderma transformed to overexpress hydrolytic enzymes have been shown to be better biocontrol agents than their corresponding parental strains (Baek et al., 1999; Flores et al., 1997; Limón et al., 1999; Mendoza-Mendoza et al., 2003; Migheli et al., 1998). However this approach requires a precise knowledge of the mechanisms driving the antagonism, as well as of structure and regulation of the relevant genes. Unfortunately, for most antagonist-pathogen associations, our current knowledge of these elements is still largely incomplete. In addition, though transformation is a tool of utmost importance for the understanding of the modes of action of biocontrol agents, in many countries the use of genetically modified organisms (GMO) is not currently permitted and this limits the practical use of transformed strains. Historically, random mutagenesis with UV light or chemical mutagens followed by subsequent selection of mutants has been a successful strategy of improvement of fungal strains (Elander and Lowe, 1992; Parekh et al., 2000). Although this is a labor- and time-consuming procedure, a major benefit of this method is that mutants are not regulated as GMO and therefore their circulation and use is not subjected to restrictions. In addition, this approach does not require the knowledge of the genetic determinants of the desired features. In Trichoderma spp., random mutagenesis has been successfully used to generate mutants with enhanced tolerance to chemical pesticides (Hatvani et al., 2006; Papavizas and Lewis, 1983; Papavizas et al., 1982) or increased

M. Marzano et al. / Biological Control 67 (2013) 397–408

production of antibiotics (Faull et al., 1994; Graeme-Cook and Faull, 1991; Kumar and Gupta, 1999). Based on the above premises, the work here presented was aimed at improving the competitiveness and biocontrol ability of Th908 against one strain of F. oxysporum f. sp. lycopersici via enhancement of the tolerance to antifungal metabolites produced by F. oxysporum. Through UV-C irradiation and subsequent selection we isolated one mutant strain (Th908-5) tolerant to culture extracts of F. oxysporum containing antifungal metabolites. The mutant strain exhibited improved biocontrol capability against F. oxysporum f. sp. lycopersici compared to the wild-type strain. Chemical analyses and biological assays led to the identification of FA as the main metabolite from F. oxysporum responsible for inhibition of Th908. FA, a phytotoxin implicated in the pathogenesis of Fusarium wilts (Gäumann, 1957; Wu et al., 2008), is herein reported as a potent antifungal compound able to inhibit Th908 and potentially involved in T. harzianum–F. oxysporum competitive interaction. In recent years, an increasing number of studies have been performed to unravel the molecular basis of the biocontrol activity of Trichoderma spp., leading to the identification of genes involved in the different aspects of biocontrol mechanisms (Druzhinina et al., 2011; Hermosa et al., 2012; Sharma et al., 2011) however, not much information is available for T. harzianum. In this regard, we investigated Th908 and Th908-5 for the expression of five genes. Of these genes, four were chosen from an available EST library of T. harzianum (Liu and Yang, 2005) on the basis of sequence similarity to genes known to encode multidrug resistance proteins (MDR ProB, MDR BrefA, MDR Protein2) or involved in mechanisms of competition for space and nutrients (Hydro II) in different microorganisms (Liu and Yang, 2005). The gene ThPTR2, coding for a di/tri peptide transporter in T. harzianum (Vizcaíno et al., 2006) was also investigated. When the mutant strain was exposed to FA, the expression of the gene encoding the protein MDR ProB was suppressed suggesting a role for the gene in the mechanism of response to FA.

2. Materials and methods 2.1. Fungal strains The fungal isolates used in this study were obtained from the culture collection of the Istituto Tossine e Micotossine (ITEM, http://www.ispa.cnr.it/Collection/), Bari, Italy. The antagonistic strain T. harzianum ITEM 908 (Th908) was isolated from soil collected in Apulia, Italy, by plating serial decimal dilutions on a Trichoderma selective medium (Smith et al., 1990), and identified to the species level by sequence analysis of the internal transcribed spacer regions ITS-1 and ITS-2 of the nuclear rDNA (GenBank accession No. KC819133) and a fragment of the translation elongation factor gene TEF-1a (Druzhinina et al., 2005). This isolate is an effective biocontrol agent of crown, stem and root rot diseases caused by Rhizoctonia, Sclerotinia and Pythium in tomato and other vegetable crops (Altomare, unpublished) and is being registered as a commercial biopesticide by Agrifutur S.r.l., Alfianello, Italy. Th908 has also been found capable of reducing the conidial production of Stemphylium vesicarium (Wallroth) Simmon, the causal agent of brown spot of pear (Rossi and Pattori, 2009), in the laboratory and in the field. The phytopathogenic isolate used throughout the work was F. oxysporum ITEM 2797 (Fo2797). This strain was originally isolated from roots of diseased tomato plants. Fo2797 was assessed as highly virulent based on the assay described by Sanchez et al. (1975). Both Th908 and Fo2797 were maintained in purity on potato dextrose agar (PDA) (Oxoid, Basingstoke, UK) slants, which were used as inoculum source for subcultures

399

throughout the work. Th908 and Fo2797 have been stored in liquid nitrogen in the ITEM collection. 2.2. Competitive capability of Fo2797 towards Th908 The interaction between Fo2797 and Th908 was assessed in vitro in dual cultures, according to Whipps (1987). Observations were carried out on cultures grown on three different culture media, viz. agarified Adams and Hanson medium (AHA) (Adams and Hanson, 1972); malt dextrose peptone (MDP), malt extract (Oxoid), 20 g; dextrose, 20 g; peptone (Oxoid), 1 g; agar, 20 g; distilled water, 1 L; and modified Richard’s medium (RM) (Altomare et al., 1999). Six mm-diameter mycelial disks, one of each of the two fungi, were placed in a 9 cm diameter Petri dish containing 15 ml of medium, 5 cm apart and diametrically opposed to each other. The experiment was carried out in triplicate. The plates were incubated at 25 ± 1 °C and the radial growth of each fungus was measured by a ruler daily for 4 days in order to calculate the percent inhibition of growth as (R1-R2)/R1  100, where R1 was the radial growth of each fungus measured on the side of the disk the farthest from the other fungal isolate (control value) and R2 was the radial growth of each fungus towards the other isolate (inhibition value). After 21 days of growth, a qualitative evaluation of the interaction between the colonies was carried out based on the following keys (Whipps, 1987): 1, antagonist overgrowing pathogen and pathogen stopped its growth; 1/2, antagonist overgrowing pathogen but pathogen still growing; 2, pathogen overgrowing antagonist and antagonist stopped its growth; 2/1, pathogen overgrowing antagonist but antagonist still growing; 3, mutual inhibition (inhibition zone 2 – 4 mm width); 4, extreme inhibition (inhibition zone >4 mm width). 2.3. Production, extraction and bioassay of antifungal metabolites of Fo2797 Fo2797 was grown in 250 ml flasks with 50 ml of Adams and Hanson liquid medium (AH), inoculated with 1 ml of a conidial suspension prepared from 7 day old cultures on PDA, which contained 1  105 macroconidia/ml, as determined by a Thoma hemocytometer. The flasks were incubated for 2, 4, 7, 10, and 14 days in a rotary shaker at 160 rpm, 25 °C, in the dark. One additional flask containing non-inoculated medium was used as a control. The culture broths were collected and filtered through Whatman No. 4 filter paper (Whatman LTD, Maidstone, UK) and extracted twice with 2/3 volume of methylene chloride in a separatory funnel. The aqueous and the organic (methylene chloride) phases were separately collected and brought to dryness by lyophilization or by rotary evaporation under reduced pressure respectively. The residues from 50 ml of culture were dissolved in 0.5 ml of distilled water (aqueous phase) or in 0.5 ml of methanol (organic phase) and tested for antifungal activity, using Geotrichum candidum Link ex Pers. ITEM 479 as a test organism (Bottalico et al., 1989). An agar well diffusion assay was used to test the aqueous phase. Three ml of 0.7% (wt/vol) water-agar (WA) (Oxoid) containing 104 conidia/ml of the test fungus were poured into 9 cm diameter Petri dishes containing 7 ml of solidified PDA. After solidification of the water-agar layer, ten mm diameter wells were made with a sterile cork borer and filled with 0.2 ml of concentrated aqueous phase. The concentrated aqueous phase from non-inoculated medium was used as a control. The organic extract was tested by a paper disk method. Six-mm diameter cellulose disks (Difco, Detroit, MI) were impregnated with aliquots of the methanol solution of the organic extract, air dried to constant weight and laid on the agar surface of 9 cm diameter Petri dishes containing 7 ml of PDA. The extract from non-inoculated medium was used as a control. The plates were inoculated by spraying a conidial suspension

400

M. Marzano et al. / Biological Control 67 (2013) 397–408

(1  105 conidia/ml) of G. candidum. Plates were incubated at 25 °C for 24 h, and the antifungal activity was evaluated by the diameter of the growth inhibition zone measured by a ruler. The antifungal assays against G. candidum were performed in triplicate and repeated once with materials from different culture batches and extractions. The antifungal activity of Fo2797 organic extract was also tested on Th908. Aliquots of the organic extract of Fo2797 were incorporated into 4 ml of liquid PDA at 50 °C to give 5, 2.5, 1.25, and 0.62% (vol/vol) of extract with 1% (vol/vol) of methanol. PDA was poured into 5 cm diameter Petri dishes. After media solidified, one single conidium of Th908, germinated on 1% (wt/vol) WA for 24 h, was transferred in the centre of each dish with a sterile lancet. Inhibition was assessed after 24, 48, and 72 h by colony growth on PDA plates amended with the culture extract compared to control plates containing PDA with 1% (vol/vol) of methanol. The inhibitory activity of pure fusaric acid (FA) (Sigma–Aldrich, St. Louis, MO) to Th908 was assayed by incorporation in PDA, similarly to the culture extract. Solutions of different concentrations were prepared by dissolving FA in ethanol and the solutions were added to PDA to give test concentrations of FA of 750, 375, 187 and 93 lg/g of medium with 1% (vol/vol) of ethanol. The inhibition assays against Th908 were performed in triplicate and repeated twice with materials from different culture batches and extractions. 2.4. Identification of bioactive metabolites produced by Fo2797 High performance thin layer chromatography (HPTLC) was used for a preliminary screening of the bioactive metabolites enniatin (EN), beauvericin (BEA) and FA in culture extract of Fo2797. HPTLC silica gel plates with fluorescent indicator (silica gel 60 F254, 10  10 cm) (Merck, Darmstadt, Germany) were spotted with culture extract of Fo2797 alongside authentic samples (Sigma– Aldrich) of the above metabolites. The plates were developed in chloroform-isopropyl alcohol 95:5 (vol/vol) for analyses of EN and BEA, while isopropyl alcohol-ethyl acetate-water-acetic acid 4.0:3.8:2.0:0.2 (vol/vol) and isopropyl alcohol-butanol-waterammonium hydroxide 6.0:2.0:1.5:0.5 (vol/vol) were used as mobile phases for the analysis of FA (Burmeister et al., 1985). The metabolites were visualized by fluorescence quenching under 254 nm wavelength UV light (EN, BEA and FA) (Altomare et al., 1995; Burmeister et al., 1985; Logrieco et al., 1993) and by exposure to iodine vapour (EN and BEA) (Altomare et al., 1995; Logrieco et al., 1993). The limit of detection of all of the compounds analyzed was 1 lg/ml of culture broth, as determined in preliminary experiments by the minimal detectable amount of compound and the highest loadable quantity of extract on the HPTLC plates. The culture extract of Fo2797 was analyzed by high performance liquid chromatography (HPLC) for confirmation of the identity and quantification of FA and its derivative 9,10-dehydrofusaric acid (DFA), using the method and the experimental conditions reported by Amalfitano et al. (2002).

Irradiation was provided by a 15 Watt germicidal lamp (Sylvania, Danvers, MA, USA) placed at a distance of 15 cm from the plate. The lamp was switched on 10 min prior to exposure of conidia in order to stabilize the radiation. 100 ll aliquots of the conidial suspension exposed to UV-C were spread on 10 ml of 1% WA supplemented with 2.5% (vol/vol) of Fo2797 culture extracts. After incubating the WA plates for 24 h at 25 ± 1 °C, single germinated conidia of the presumptive mutants of Th908 were transferred to PDA by a sterile loop. The tolerance to Fo2797 culture extract and FA of presumptive mutants was assessed as follows. Plates containing PDA supplemented with 2.5% (vol/vol) of Fo2797 culture extract or 120 lg/g of FA were inoculated with single germinated conidia of the presumptive mutant strains. The plates were incubated at 25 ± 1 °C and the growth of the mutants after 24, 48, and 72 h was measured in three replicated plates and compared to that of the wild-type strain. The stability of the mutants was checked by four passages on PDA and then by a further passage on PDA supplemented with culture extract of Fo2797 or with FA (Hatvani et al., 2006). The rhizosphere competence of the mutants Th908-5 and Th908-81 was tested according to Ahmad and Baker (1987). 2.6. Biocontrol efficacy Tomato seeds (cv. Marmande) were surface disinfested in 4% NaOCl for 10 min and then rinsed with sterile distilled water by shaking at 120 rpm for 10 min. The procedure was repeated three times. After incubation in a moisture chamber at 25 ± 1 °C for 2 days, the germinated seeds were inoculated with Th908 or Th908-5 by immersion in a conidial suspension (107 conidia/ml) for 1 h under continuous orbital shaking at 120 rpm. The treatment resulted in at least 104 conidia per seed, as determined by cfu counts after seed washing and subsequently plating of serial decimal dilutions on a Trichoderma selective medium (Smith et al., 1990). MagentaÒ vessels (77  77  77 mm) (Sigma) were filled with 30 g of autoclaved vermiculite and moistened with 120 ml of a conidial suspension of Fo2797 in AH to obtain 104 macroconidia/g of vermiculite as a final inoculum density. Four (in the first experiment) or six (in the second experiment) Trichoderma-treated germinated seeds were placed in each vessel, at a 1 cm depth. The vessels were placed in a greenhouse at 26 °C/21 °C day/night with a 12 h photoperiod. After emergence, on alternate days every vessel was watered with a modified nutritive Knop solution (Knop, 1862), [Ca(NO3)2 0.8 g; KNO3 0.2 g; MgSO47H2O 0.2 g; KH2PO4 0.2 g; FeCl2 0.005 g; water 1 L]. The plants were observed daily and the percentage of surviving plants was recorded 30 days after transplanting. Treatments included the following controls: seeds in Fo2797-inoculated vermiculite (inoculated control); seeds in noninoculated vermiculite (non-inoculated control); and Th908-inoculated or Th908-5-inoculated seeds in non-inoculated vermiculite. Each treatment was comprised of 4 replicated vessels and the experiment was performed twice. 2.7. Nucleic acid extraction and cDNA synthesis

2.5. UV-C mutagenesis and selection of Th908 mutants A conidial suspension of Th908 was prepared by gently scraping the surface of a 4 day old colony grown on PDA with a sterile inoculating loop. Conidia were suspended in sterile distilled water and the suspension was removed from the plate by a pipette and filtered through a double layer of cheesecloth to get rid of fragments of hyphae. The concentration of the suspension was determined by a Thoma hemocytometer, adjusted to the concentration of 106 conidia/ml and 1 ml aliquots of the suspension were pipetted into wells of a 24-well microplate (Sterilin, Staffs, UK). After removal of the lid, conidia were exposed to UV-C radiation for 2 min to obtain about 85% conidia kill (Rey et al., 2001).

DNA and RNA were extracted from mycelia of Th908 and mutant Th908-5 grown on sterile cellophane sheets placed on PDA supplemented with 2.5% (vol/vol) of Fo2797 organic extract or 120 lg/g of FA. Plates were incubated at 25 °C in the dark for 6 days and the mycelia were scraped off the cellophane with a sterile spatula. DNA was isolated using the Fungal DNA miniprep kit (E.Z.N.A., Omega Bio-Tek Inc., Doraville, GA) according to the manufacturer’s protocol. Total RNA was extracted from 100 mg of frozen mycelium ground in liquid nitrogen, using the RNeasy Plant Minikit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. RNA samples were treated with RNAse-free DnaseI (Promega, Madison, WI) to eliminate possible traces of

401

M. Marzano et al. / Biological Control 67 (2013) 397–408

contaminating DNA. RNA aliquots were quantified spectrophotometrically at 260 nm and preserved at 80 °C. First strand cDNA was synthesised using about 2 lg of total RNA, oligo (dT)18 primer and the SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. 2.8. PCR and reverse transcriptase (RT)-PCR, sequencing and data analysis The presence of five genes (MDR ProB, MDR BrefA, MDR Protein2, Hydro II, ThPTR2), putatively associated with biocontrol function in T. harzianum was analyzed in Th908 and Th908-5. Also the presence of their corresponding transcripts was evaluated by the use of RT-PCR. Accession numbers of sequences used to design primers pairs for this study and relative primer sequences are listed in Table 1. Amplification from genomic DNA and from first strand cDNA was performed at the following conditions: 94 °C for 5 min, 35 cycles of 94 °C for 30 s, 54 °C for 50 s, 72 °C for 50 s, then a final extension step of 72 °C for 5 min. The primers b-tubulin1 (Li and Yang, 2007) were used to monitor b-tubulin gene expression as a reference gene (Tijerino et al., 2011; Viterbo et al., 2005). One and a half unit of Taq DNA polymerase (Roche Applied Science, Indianapolis, IN) and dNTPs at 200 lM were used in each PCR experiment. Oligonucleotides were synthesised by MWG Biotech AG (Ebersberg, Germany), dissolved to 100 lM final concentration with sterile water and stored at 20 °C. A negative control reaction (no added DNA template) was included in all the PCR experiments. PCR reactions were performed in triplicate. The sequence of all cDNA and genomic amplicons were confirmed by sequence analysis. PCR products were sequenced directly and sequence data were obtained using the ABI Prism Big Dye Deoxy Terminator Cycle Sequencing kit (Applied Biosystem, Foster City, CA). Reactions were analysed using a model 3100 Genetic Analyser (Applied Biosystem). Sequence similarity searches were performed using the BLAST algorhythm through the National Center for Biotechnology Information (NCBI) platform. Nucleotide and amino acid alignments were performed with the Clustal W program. 2.9. Statistical analyses Data from biocontrol experiments were analyzed by one-way analysis of variance (ANOVA) and Tukey–Kramer multiple comparison test after transforming the original percentage data to arcsine p values (arcsin x, where x was the relative proportion). The statistical analyses were performed using the GraphPad Instat 3.0 software (GraphPad Software, San Diego, CA).

3. Results 3.1. Competitive capability of Fo2797 towards Th908 The data of competitive capability of Fo2797 towards Th908 collected 72 h after culture transfer are showed in Table 2. Fo2797 was able to inhibit the growth of Th908 colonies on all of the three media utilized by 56–66%. The growth of the pathogen was also inhibited by Th908, although to a lesser extent (by 35, 48 and 15% on AHA, MDP and RM respectively, Table 2). The qualitative evaluation of the interaction between the colonies was carried out after 21-day incubation at 25 °C. In 2 out of 3 media, the colony interaction was characterized by a mutual inhibition of Fo2797 and Th908, while on RM Fo2797 overgrew Th908. 3.2. Antifungal activity of Fo2797 culture extract and inhibition of Th908 by FA Fo2797 produced antifungal substance(s) in liquid culture on AH (Fig. 1). The antifungal activity towards G. candidum was extracted quantitatively with the organic solvent methylene chloride (Fig. 1A), leaving an inactive aqueous phase (Fig. 1B). Activity against G. candidum was found in cultures grown from 7 days until the last date tested, 14 days. Given the absence of antifungal activity in the aqueous phase over a 3-day observation, only the organic extract of the Fo2797 culture was tested against Th908. The organic extract of Fo2797 totally inhibited the growth of Th908 on PDA when added to the medium at the concentration of 2.5% or higher (Fig. 1C).

Table 2 Percentage inhibition of radial growth of Trichoderma harzianum Th908 and Fusarium oxysporum Fo2797 in dual culture and colony interactions on Adams and Hanson agar (AHA), malt dextrose peptone (MDP) and modified Richard’s medium (RM). Medium

% Inhibition of Th908a

% Inhibition of Fo2797a

Interactionb

AHA MDP RM

56.2 58.7 66.0

35.0 48.0 15.0

3 3 2

a Mean values of three replicated plates incubated at 25 °C for 72 h. The values in column are not significantly different (P < 0.05, Tukey–Kramer Multiple Comparison Test). b Interaction coding as observed after 21 days of growth: 1, Th908 overgrowing Fo2797 and Fo2797 stopped growth; 1/2, Th908 overgrowing Fo2797 but Fo2797 still growing; 2, Fo2797 overgrowing Th908 and Th908 stopped growth; 2/1, Fo2797 overgrowing Th908 but Th908 still growing; 3, mutual inhibition (inhibition zone 2–4 mm width); 4, extreme inhibition (inhibition zone > 4 mm width).

Table 1 Polymerase chain reaction primers used in this study with their products and sources. Protein

a b c

GenBank (acc. No.) a

Primer code

Primer sequence (50 ?30 )

MDR ProB

for. 50 GCCATGGCTTTCACTAAC 30 rev. 50 CGGACGATTATAGACACCA 30 for. 50 GAACAACACGACACACCTG 30 rev. 50 GCCAAGGATGAGATGTAGAC 30 for. 50 GGCTGATATCTGGGAAGAC 30 rev. 50 TCGAGTACATCTTGGACGA 30 for. 50 TCATCACCACTCTCTTACACA 30 rev. 50 ATCCATCCATTCCCAACTA 30 for. 50 CAGTTCTTCGCCTACATCA 30 rev. 50 GGGTTCAGGTTCTGGATAA 30 for. 50 GAGCCTTATAACGCCACC 30 rev. 50 GTTCTTGTTCTGGATGCTGC 30

Multidrug resistance protein B

CK907073.1

Multidrug resistance protein

CK907092.1a

MDR Protein 2

Brefeldin A resistance protein

CK434041.1a

MDR BrefA

Hydrophobin II precursor

CK907564.1a

HydroII

b

ThPTR2

CAI30793.1

ß-tubulin 1

ABK27613.1c

Liu and Yang (2005). Vizcaíno et al. (2006). Li and Yang (2007).

ThPTR2 ß-tubulin1

402

M. Marzano et al. / Biological Control 67 (2013) 397–408

A

B

C

D

Fig. 1. Antifungal activity of culture extracts produced by Fusarium oxysporum Fo2797 and of the metabolite fusaric acid (see section 2.3 for details). (A) Inhibition of Geotrichum candidum by the organic extracts of Fo2797 cultures grown in liquid Adams and Hanson medium for 2, 4, 7, 10 and 14 days (paper disk assay). The control (C) was the organic extract of non-inoculated medium. (B) Effect on G. candidum of the exhausted aqueous phase of Fo2797 cultures after extraction with methylene chloride (agar well diffusion assay). The control (C) was the aqueous phase of non-inoculated medium. (C) Inhibition of the growth of T. harzianum Th908 on PDA amended with increasing percentages (vol/vol) of organic extract of Fo2797 culture. Plates are shown after three days at 25 °C. (D) Inhibition of the growth of Th908 on PDA amended with increasing quantities (lg per gram of medium) of the metabolite fusaric acid. Plates are shown after three days at 25 °C.

Three days after inoculation, the growth of Th908 was completely inhibited on PDA containing 187 lg of FA per gram of medium or more (Fig. 1D). FA at the concentration of 93 lg/g resulted in an average 70% growth inhibition of Th908 after two days and a 40% inhibition after three days.

concentrations of FA and DFA were 46 and 151 mg/ml of culture extract (i.e. 0.46 and 1.51 mg/ml of culture filtrate), respectively.

3.3. Identification of FA in culture extract of Fo2797

Three hundred presumptive mutants of Th908 were isolated from PDA plates supplemented with 2.5% (vol/vol) of Fo2797 culture extract or 120 lg/g of FA. A further selection process led to selection of the mutants Th908-5 and Th908-81, which were tolerant to Fo2797 metabolites and FA. On PDA supplemented with either 2.5% of Fo2797 culture extract or 120 lg/g of FA, the growth

Neither EN nor BEA were detected in cultures of Fo2797 by HPTLC. FA was qualitatively detected and subsequently confirmed and quantified by HPLC in culture extract of Fo2797. Along with FA, its analogue DFA was produced by Fo2797 (Fig. 2). The

3.4. Selection of Th908 mutants tolerant to Fo2797 metabolites and FA

M. Marzano et al. / Biological Control 67 (2013) 397–408

403

inoculation, while 6 days after inoculation the colony diameter of wild-type strain was less than 0.5 cm (data not shown). Growth and sporulation on PDA under non-selective conditions, and rhizosphere competence of both the mutants were not significantly different (P < 0.05) from that of the wild-type strain (data not shown). Tolerance of the two mutants proved to be stable after four cycles of subculturing on Fo2797 metabolite-free PDA. However, the mutant Th908-81 was auxotrophic, being unable to grow on defined media containing only ammonium salts as nitrogen source. Therefore, only the mutant Th908-5 was used in subsequent experiments. 3.5. Disease suppression The biocontrol capability of Th908-5 was compared to that of the wild-type strain (Th908) on tomato plants grown in a substrate heavily infested with F. oxysporum. The results obtained in two separate experiments are shown in Table 3. The reduction of the disease by the mutant strain Th908-5 was highly (P < 0.01 to P < 0.001) significant, while a slight (P < 0.05) biocontrol was achieved by the wild-type strain Th908 only in the second experiment. Interestingly, in one of the two experiments Th908-5 increased the survival and growth of tomato plants grown in non-inoculated vermiculite, compared to the non-inoculated control (Table 3, Fig. 5). A similar effect was not observed in plants treated with the wild-type strain. 3.6. Expression of biocontrol-related genes Fig. 2. HPLC chromatogram (LC 90 UV spectrophotometric detector equipped with an LCI 100 integrator) of fusaric acid (FA) and 9,10-dehydrofusaric acid (DFA) produced by Fusarium oxysporum Fo2797 grown in Adams and Hanson liquid medium for 14 days at 25 °C.

of Th908 was completely inhibited during the 3-day trial. In contrast, the growth of the mutant strains was only reduced, by 69% and 31.5% for Th908-5, and 71% and 21.3% for Th908-81, in the presence of culture extracts or FA respectively (Fig. 3). The colonies of the mutant strains completely covered the plates 4 days after

PCR and RT-PCR were used to analyse the presence and expression in Th908 and Th908-5 of five genes (MDR ProB, MDR BrefA, MDR Protein2, Hydro II, and ThPTR2) putatively associated with biocontrol functions of T. harzianum (Liu and Yang, 2005; Vizcaíno et al., 2006). When the organic extract from Fo2797 was present in the medium, both the strains were able to grow, albeit the growth of the wild-type strain was detected only 6 days after inoculation and was extremely slow and sparse. In the presence of FA, only the mutant strain was able to grow, while conidial germination of the

Fig. 3. Growth of Trichoderma harzianum Th908 wild-type strain and of the UV-mutants Th908-5 and Th908-81 on PDA amended with 2.5% of Fusarium oxysporum Fo2797 culture extract (top) or 120 lg/g of fusaric acid (bottom). Plates are shown after three days at 25 °C.

404

M. Marzano et al. / Biological Control 67 (2013) 397–408

Table 3 Biocontrol efficacy of Trichoderma harzianum strains Th908 (wild-type strain) and Th908-5 (UV-mutant) in vermiculite infested with Fusarium oxysporum Fo2797 (104 CFU/gram). Percentage of surviving tomato plants after 30 days from transplanting. The T. harzianum strains were applied to germinated seeds (104 CFU/seed) prior to planting. Results of two independent experiments. Treatment

First experimenta

Second experimentb

c

Surviving plants (%) Inoculated control (Fo2797) Non-inoculated control Th908 Th908-5 Fo2797 + Th908 Fo2797 + Th908-5 a b c

31.3 ± 12.5 87.5 ± 14.4 50.0 ± 0 100 ± 0 43.8 ± 12.5 75.0 ± 0

a de bc e ab cd

P value

Surviving plantsc (%)

0.000 0.042 0.000 0.792 0.003

12.5 ± 8.3 75.0 ± 9.6 45.8 ± 8.3 95.8 ± 8.3 41.7 ± 9.6 58.3 ± 9.6

P value a d bc e b cd

0.000 0.007 0.000 0.016 0.001

Mean values of 4 replicated vessels with 4 transplanted germlings each, ± standard deviation (SD). Mean values of 4 replicated vessels with 6 transplanted germlings each, ± SD. Values in column followed by different letters are significantly different for P < 0.05 (Tukey–Kramer Multiple Comparison Test).

4. Discussion

Fig. 4. Polymerase chain reaction (PCR) analysis of the five putative Multi drug resistance MDR-related genes tested (MDR ProB, MDR BrefA, MDR Protein2, Hydro II, ThPTR2) and of ß-tubulin1 conduced on cDNA obtained from Trichoderma harzianum Th908 (wild-type strain) and the mutant strain Th908-5, grown on PDA (control, C) and on PDA supplemented with either 2.5% (vol/vol) of Fusarium oxysporum Fo2797 organic extract (+Fo2797) or 120 lg/g of fusaric acid (+FA).

wild-type strain was completely inhibited. As shown in Fig. 4, no significant difference in expression levels was detected for MDR Protein2, MDR BrefA or HydroII, which were transcribed both in the wild-type and the mutant T. harzianum strains in the presence of F. oxysporum metabolites. The gene ThPTR2 was not expressed in any of the conditions tested. A different behaviour was observed for the gene MDR ProB, which was transcribed in both strains in the presence of the organic extract of Fo2797, while no expression signal was detected in the mutant strain when FA was added to the medium.

In the Presidential Address given at the 76th Annual Meeting of the APS, R. James Cook stated: ‘‘Most pathogens probably succeed within the milieu of plant colonists by finesse-by careful management of the nutrients and energy supplies in their niche in a way that does not invite or attract unwanted company. A few probably succeed by their ability to liberate secondary metabolites inhibitory to the neighboring nonpathogens. In this regard, a toxin produced by a pathogen is almost invariably studied for its role as a pathotoxin, but maybe it serves the pathogen as an antibiotic to inhibit nonpathogens during pathogenesis.’’ (Cook, 1985). The scenario outlined by Cook appears to be applicable to FA. FA has long been known as a wilt toxin (Gäumann, 1957) and is regarded as a virulence factor in plant tracheo-fusariosis caused by F. oxysporum ff. spp. (Davis, 1969; Matsumoto et al., 1995; Toyoda et al., 1988). In spite of the occurrence of FA both in soil and in the rhizosphere (Sadasivan, 1961), its ecological significance in the frame of microbial interactions in the soil is not as clearly recognized. Duffy and Défago (1997) showed that FA suppressed the biocontrol efficacy of a strain of Pseudomonas fluorescens. However, this effect was not due to inhibition of the bacterial growth, which was not affected at concentrations as high as 200 lg/ml (Duffy and Défago, 1997), but rather to repression of the expression of genes involved in the synthesis of 2,4-diacetylphloroglucinol (Notz et al., 2002), an antibiotic that is thought to be a key factor in the antagonistic activity of P. fluorescens (Rezzonico et al., 2007). Bacon et al. (2004) investigated the correlation between production of FA by the systemic pathogen Fusarium verticillioides and reduction in the population of the endophytic biocontrol bacterium Bacillus mojavensis in planta. They suggested that FA accounted for the reduction in endophytic colonization by the bacteria and the resulting poor biocontrol, and hypothesized a role for FA in the in planta competition for the intercellular niche colonization by

Fig. 5. Growth of tomato plants in the greenhouse in autoclaved vermiculite. Plants were watered every two days with Knop solution. Shown are representative examples of three different treatments. These are from left to right, plants grown from untreated seed, seed treated with Trichoderma harzianum mutant Th908-5, and seed treated with T. harzianum wild-type strain Th908. Plants are shown 30 days after planting.

M. Marzano et al. / Biological Control 67 (2013) 397–408

F. verticillioides. El-Hasan et al. (2008) investigated the effect of FA on growth and conidia production of two isolates of T. harzianum. They reported that the two isolates tested were able to grow, partially inhibited, on malt agar containing FA up to 300 lg/ml, although a significant difference in the sensitivity of the two isolated to FA was found. El-Hasan et al. (2008) did not test the biocontrol efficacy of the two T. harzianum isolates and therefore it is not clear whether the difference in sensitivity to FA was correlated to the biocontrol capability of the isolates. El-Hasan et al. (2008) also showed that two T. harzianum isolates were able to degrade FA in vitro at a rate that was dependant on the initial FA concentration and on the strain tested, and that the antifungal metabolite 6-pentyl-alpha-pyrone (6PAP) produced by T. harzianum (Howell, 1998) suppressed FA production by Fusarium moniliforme Sheld. The above-cited works suggest that FA, besides being a virulence factor, may have an ecological function in the interaction of Fusarium spp. with other microorganisms, including biocontrol agents. It has been reported that production of FA may vary greatly among different isolates of the F. oxysporum species complex (Bacon et al., 1996; Schouten et al., 2004) and even among isolates of one forma specialis (Nosir et al., 2011). Therefore, in the T. harzianum-F. oxysporum interaction, the tolerance of the T. harzianum isolate to FA, its ability to produce 6PAP (Cooney et al., 1997) and the level of FA released by F. oxysporum in the soil microenvironment might all have an impact on the success of biocontrol. The growth of the wild-type strain Th908 used in this study was completely inhibited on PDA containing 187 lg of FA per gram. The comparatively high sensitivity of Th908 to FA may account for the poor biocontrol of F. oxysporum by this strain. UV-mutagenesis has been utilized for the enhancement of the biocontrol capability of Trichoderma strains (Besoain et al., 2007; Graeme-Cook and Faull, 1991; Szekeres et al., 2004). However, random mutagenesis, followed by assessment of a large number of mutants through nonautomated screens, such as in vivo tests of biocontrol efficacy, may be slow and labor intensive (Queener and Lively, 1986; Klein-Marcuschamer and Stephanopoulos, 2010; Rowlands, 1984). Therefore, it is profitable to identify key factors in the antagonistic behavior of biocontrol strains and to use these characters to guide the selection of superior mutants. In this paper we identified FA as an antifungal substance present in culture extracts of Fo2797, a strain of F. oxysporum strongly virulent to tomato plants (unpublished). This strain was found to produce 0.46 mg of FA per milliliter of culture filtrate. To the best of our knowledge, no correlation between the level of FA produced in vitro and the capability of the FA-producing F. oxysporum strains to cause tomato wilts has been made. However, the correlation between FA production and virulence of isolates of F. oxysporum was studied by Venter and Steyn (1998) in the potato-F. oxysporum pathosystem. These authors found a correlation between virulence of isolates and FA production, and identified as virulent those isolates that produced 0.032–0.053 mg of FA per milliliter of culture filtrate. We also showed that FA has a direct inhibitory effect on the growth of Th908, a biocontrol strain of T. harzianum that is being registered as a commercial biopesticide and that exhibits poor biocontrol of F. oxysporum. Aiming at improving the efficacy of the biocontrol strain Th908, we carried out an UV-mutagenesis program, followed by selection of mutants for their tolerance to culture extracts of Fo2797 and FA. Through this process, we isolated the mutant strain Th908-5 which was tolerant to FA at a concentration as high as 120 lg/g of medium, a level which totally inhibited the growth of the wild-type strain. In greenhouse tests with autoclaved artificial medium Th908-5 exhibited similar rhizosphere competence (data not shown) and increased biocontrol efficacy toward Fo2797 compared to the wild-type strain. In addition, when applied to tomato pre-germinated seeds transplanted in non-infested vermiculite, Th908-5 was able to increase the growth

405

of the tomato plants. Some possible mechanisms for enhanced growth that have been suggested include altered production of plant-growth-regulating or phytotoxic metabolites (Cutler et al., 1989; Hexon et al., 2009; Marfori et al., 2003; Vinale et al., 2012) or reduction of physiological or abiotic stresses due to transplant or surface disinfestations of seeds (Björkman et al., 1998; Mastouri et al., 2010). In the light of the improved biocontrol efficacy of Th908-5, a preliminary analysis was performed on some genes hypothetically associated with T. harzianum biocontrol function and specifically involved in the mechanisms of multidrug resistance and competition for space and nutrients (Liu and Yang, 2005; Vizcaíno et al., 2006). None of them showed a different expression pattern in the mutant strain in comparison with the wild-type strain. However, the gene MDR ProB, coding for a protein homologous to the multidrug resistance protein B of Bacillus cereus (Liu and Yang, 2005), appeared to be expressed at a lower level in the wild-type strain exposed to F. oxysporum organic extract, compared to the control (PDA not supplemented with the extract). Interestingly, its transcription was completely suppressed in the mutant strain when FA was added in the medium. Further investigation is in progress with the aim to elucidate the possible role of this gene in the biocontrol activity of T. harzianum and to clarify the meaning of its transcriptional suppression in the mutant strain resulting from exposure to FA, should it be involved in either the improvement of biocontrol activity or in the mechanism of resistance to FA. Beside genetic improvement of biocontrol agents, another possible strategy to enhance the overall level of biocontrol and its reliability is combination of two or more biocontrol agents (Duijff et al., 1999; Guetsky et al., 2001; Leeman et al., 1996). Since the environment greatly affects the establishment, survival and activity of biocontrol agents (Fravel et al., 2003; Benítez et al., 2004; Xue et al., 2013), mixtures of agents possessing different modes of action or physiological requirements may afford higher levels and lower variability of control under diverse environmental and ecological conditions (de Boer et al., 2003; Guetsky et al., 2002; Schmidt et al., 2004). Combining different biocontrol agents might be advantageous also for making biocontrol more cost-effective and competitive against chemical control. Many biocontrol strains have a restricted range of targets, being antagonistic only to one or few pathogens (Spadaro and Gullino, 2005; Whipps and Lumsden, 2001). From a practical point of view this is disadvantageous, since farmers may want to control different pests and diseases at a time. The possibility to use a mixture of different biocontrol agents may broaden the range of constraints controlled with a single treatment (Jetiyanon and Kloepper, 2002) and thus reduce the number of interventions and the cost of pest management. However, the combined application of more than one biocontrol agent requires that the agents be compatible. In fact, the interactions between two or more biocontrol agents can also negatively influence disease control (Thrane et al., 2000). Competition can be a limitation to the co-inoculation of beneficial microorganisms. It has been reported that competition for nutrients or space (Kragelund and Nybroe, 1996) or siderophoremediated competition for iron (Raaijmakers et al., 1995) may limit the colonization or activity of introduced biocontrol strains. Aggressive competition is expressed through the release of inhibiting compounds (Karlovsky, 2008; Wicklow, 1992). Based on our findings and previously published literature (El-Hasan et al., 2008), FA might be involved in the aggressive competition of both pathogenic and non-pathogenic F. oxysporum strains against T. harzianum. Non-pathogenic strains of F. oxysporum have been utilized for biological control of wilts and crown rots caused by F. oxysporum ff. spp. (Fravel et al., 2003). Also, some plant pathogenic strains of F. oxysporum have found a profitable use in control of weeds

406

M. Marzano et al. / Biological Control 67 (2013) 397–408

(Cohen et al., 2002; Elzein et al., 2004), taking advantage of the physiological specialization of these strains which prevents infection of non-host plants. Based on our results, in both the above instances the combined use of certain biocontrol strains of F. oxysporum and T. harzianum might be problematic, because of the production of FA by the biocontrol strains of F. oxysporum (Cohen et al., 2002; Schouten et al., 2004) and the inhibitory effect of the toxin on T. harzianum. In this work we obtained one mutant strain of T. harzianum (Th908-5) highly tolerant to FA. This strain also shows improved establishment and survival in soil, when applied along with the mycoherbicidal and FA-producing strain F. oxysporum FT2 (Altomare et al., unpublished), compared to the wild-type strain. Trials for the assessment of the efficacy of nonpathogenic strains of F. oxysporum in combination with Th908-5 will be carried out in coming research. In conclusion, we have showed that FA, a secondary metabolite of F. oxysporum, which is released in soil and has been shown to be a phytotoxin involved in pathogenesis of Fusarium wilts, has a strong inhibitory effect to T. harzianum strain ITEM 908 growth. Based on the hypothesis that FA may play a major role in the competitive interaction between F. oxysporum and T. harzianum, we succeeded in improving the tolerance to FA of T. harzianum strain ITEM 908 and its biocontrol performance against F. oxysporum f. sp. lycopersici through UV mutation. Since UV-mutants are not regarded as GMO, their circulation and use is not subjected to restrictions and the improved strain could get the registration for field use in some countries more easily than strains derived by genetic transformation. Acknowledgments Work of M. Marzano was partly supported by the EU-funded project ‘‘Enhancement and Exploitation of Soil Biocontrol Agents for Bio-Constraints Management in Crops’’ (EU FOOD-CT-2003001687). We thank Dr. C. Amalfitano, University of Naples ‘‘Federico II’’, for the HPLC analysis of FA and DFA. References Adams, P.M., Hanson, R., 1972. Sesquiterpenoid metabolites of Trichoderma polysporum and T. sporulosum. Phytochemistry 11, 423. Ahmad, J.S., Baker, R., 1987. Rhizosphere competence of Trichoderma harzianum. Phytopathology 77, 182–189. Altomare, C., Logrieco, A., Bottalico, A., Mulé, G., Moretti, A., Evidente, A., 1995. Production of type A trichothecenes and enniatin B by Fusarium sambucinum Fuckel sensu lato. Mycopathologia 129, 177–181. Altomare, C., Norvell, W.A., Björkman, T., Harman, G.E., 1999. Solubilization of phosphates and micronutrients by the plant-growth-promoting and biocontrol fungus Trichoderma harzianum Rifai 1295–22. Appl. Environ. Microbiol. 65, 2926–2933. Amini, J., Sidovich, D.F., 2010. The effects of fungicides on Fusarium oxysporum f. sp. lycopersici associated with Fusarium wilt of tomato. J. Plant Prot. Res. 50, 172– 178. Amalfitano, C., Pengue, R., Andolfi, A., Vurro, M., Zonno, M.C., Evidente, A., 2002. HPLC analysis of fusaric acid, 9,10-dehydrofusaric acid and their methyl esters, toxic metabolites from weed pathogenic Fusarium species. Phytochem. Anal. 13, 277–282. Armstrong, G.M., Armstrong, J.K., 1981. Formae speciales and races of Fusarium oxysporum causing wilt diseases. In: Nelson, P.E., Toussoun, T.A., Cook, R.J. (Eds.), Fusarium: Diseases, Biology and Taxonomy. The Pennsylvania State University Press, University Park, PA, USA, pp. 391–399. Bacon, C.W., Porter, J.K., Norred, W.P., Leslie, J.F., 1996. Production of fusaric acid by Fusarium species. Appl. Environ. Microbiol. 62, 4039–4043. Bacon, C.W., Hinton, D.M., Porter, J.K., Glenn, A.E., Kuldau, G., 2004. Fusaric acid, a Fusarium verticillioides metabolite, antagonistic to the endophytic biocontrol bacterium Bacillus mojavensis. Can. J. Bot. 82, 878–885. Bacon, C.W., Hinton, D.M., Hinton, J., 2006. Growth-inhibiting effects of concentrations of fusaric acid on the growth of Bacillus mojavensis and other biocontrol Bacillus species. J. Appl. Microbiol. 100, 185–194. Baek, J.-M., Howell, C.R., Kenerley, C.M., 1999. The role of an extracellular chitinase from Trichoderma virens Gv29-8 in the biocontrol of Rhizoctonia solani. Curr. Genet. 35, 41–50. Beckman, C.H., 1987. The Nature of Wilt Diseases of Plants. APS Press, St. Paul, MN, USA.

Bell, D.K., Wells, H.D., Markham, C.R., 1982. In vitro antagonism of Trichoderma species against six fungal plant pathogens. Phytopathology 72, 379–382. Benítez, T., Rincón, A.M., Limón, M.C., Codón, A.C., 2004. Biocontrol mechanisms of Trichoderma strains. Int. Microbiol. 7, 249–260. Besoain, X.A., Perez, L.M., Araya, A., Lefever, L., Sanguinetti, M., Montealegre, J.R., 2007. New strains obtained after UV treatment and protoplast fusion of native Trichoderma harzianum: their biocontrol activity on Pyrenochaeta lycopersici. Electron. J. Biotechnol. 10, 604–617. Björkman, T., Blanchard, L.M., Harman, G.E., 1998. Growth enhancement of shrunken-2 (sh2) sweet corn by Trichoderma harzianum 1295-22: effect of environmental stress. J. Am. Soc. Hortic. Sci. 123, 35–40. Bolton, A.T., 1984. Root rot of Ficus benjamina. Plant Dis. 68, 816–817. Bolwerk, A., Lagopodi, A.L., Wijfjes, A.H., Lamers, G.E., Chin-A-Woeng, T.F., Lugtenberg, B.J., Bloemberg, G.V., 2003. Interactions in the tomato rhizosphere of two Pseudomonas biocontrol strains with the phytopathogenic fungus Fusarium oxysporum f. sp. radicis-lycopersici. Mol. Plant Microbe Interact. 16, 983–993. Bottalico, A., Logrieco, A., Visconti, A., 1989. Fusarium species and their mycotoxins in infected cereals in the field and in stored grains. In: Chełkowski, J. (Ed.), Fusarium, Mycotoxins Taxonomy and Pathogenicity. Elsevier Scientific Publishers, Amsterdam, The Netherlands, pp. 85–119. Burgess, L.W., 1981. General ecology of the Fusaria. In: Nelson, P.E., Toussoun, T.A., Cook, R.J. (Eds.), Fusarium: Diseases, Biology and Taxonomy. The Pennsylvania State University Press, University Park, PA, USA, pp. 225–235. Burmeister, H.R., Grove, M.D., Peterson, R.E., Weisleder, D., Plattner, R.D., 1985. Isolation and characterization of two new fusaric acid analogs from Fusarium moniliforme NRRL 13,163. Appl. Environ. Microbiol. 50, 311–314. Cai, G., Gale, L.R., Schneider, R.W., Kistler, H.C., Davis, R.M., Elias, K.S., Miyao, E.M., 2003. Origin of race 3 of Fusarium oxysporum f. sp. lycopersici at a single site in California. Phytopathology 93, 1014–1022. Chet, I., Benhamou, N., Haran, S., 1998. Mycoparasitism and lytic enzymes. In: Harman, G.E., Kubicek, C.P. (Eds.), Trichoderma and Gliocladium, vol. 2, Enzymes, Biological Control and Commercial Applications. Taylor & Francis, London, UK, pp. 153–172. Cohen, B.A., Amsellem, Z., Lev-Yadun, S., Gressel, J., 2002. Infection of tubercles of the parasitic weed Orobanche aegyptiaca by mycoherbicidal Fusarium species. Ann. Bot. 90, 567–578. Cook, R.J., 1985. Biological control of plant pathogens: theory to application. Phytopathology 75, 25–29. Cooney, J.M., Lauren, D.R., Jensen, D.J., Perry-Meyer, L.J., 1997. Effect of solid substrate, liquid supplement, and harvest time on 6-n-pentyl-2H-pyran-2-one (6PAP) production by Trichoderma spp., J. Agric. Food Chem. 45, 531–534. Cutler, G.H., Himselsbach, D.S., Arrendale, F., Cole, P.D., Cox, R., 1989. Koninginin A: a novel plant growth regulator from Trichoderma koningii. Agric. Biol. Chem. 39, 2605–2611. Curl, E.A., 1963. Control of plant diseases by crop rotation. Bot. Rev. 29, 413–479. Davis, D., 1969. Fusaric acid in selective pathogenicity of Fusarium oxysporum. Phytopathology 59, 1391–1395. De Boer, M., Bom, P., Kindt, F., Keurentjes, J.J.B., van der Sluis, I., van Loon, L.C., Bakker, P.A.H.M., 2003. Control of Fusarium wilt of radish by combining Pseudomonas putida strains that have different disease-suppressive mechanisms. Phytopathology 93, 626–632. Demain, A.L., Fang, A., 2000. The natural functions of secondary metabolites. Adv. Biochem. Eng. Biotechnol. 69, 1–39. Desjardins, A.E., 2006. Fusarium Mycotoxins. Chemistry, Genetics, and Biology. APS Press, St. Paul, MN, USA. Dubey, S.C., Suresh, M., Singh, B., 2007. Evaluation of Trichoderma species against Fusarium oxysporum f. sp. ciceris for integrated management of chickpea wilt. Biol. Control 40, 118–127. Duffy, B.K., Défago, G., 1997. Zinc improves biocontrol of Fusarium crown and root rot of tomato by Pseudomonas fluorescens and represses the production of pathogen metabolites inhibitory to bacterial antibiotic biosynthesis. Phytopathology 87, 1250–1257. Druzhinina, I.S., Kopchinsky, A.G., Komòn, M., Bissett, J., Szakacs, G., Kubicek, C.P., 2005. An oligonucleotide barcode for species identification in Trichoderma and Hypocrea. Fungal Genet. Biol. 42, 813–828. Druzhinina, I.S., Seidl-Seiboth, V., Herrera-Estrella, A., Horwitz, B.A., Kenerley, C.M., Monte, E., Mukherjee, P.K., Zeilinger, S., Grigoriev, I.V., Kubicek, C.P., 2011. Trichoderma: the genomics of opportunistic success. Nature Rev. Microbiol. 9, 749–759. Duijff, B.J., Recorbet, G., Bakker, P.A.H.M., Loper, J.E., Lemanceau, P., 1999. Microbial antagonism at the root level is involved in the suppression of Fusarium wilt by the combination of nonpathogenic Fusarium oxysporum Fo47 and Pseudomonas putida WCS358. Phytopathology 89, 1073–1079. Elad, Y., Chet, I., Katan, J., 1980. Trichoderma harzianum: A biocontrol agent effective against Sclerotium rolfsii and Rhizoctonia solani. Phytopathology 70, 119–121. Elad, Y., Chet, I., Henis, Y., 1983. Parasitism of Trichoderma spp. on Rhizoctonia solani and Sclerotium rolfsii – scanning electron microscopy and fluorescence microscopy. Phytopathology 73, 85–88. Elander, R.P., Lowe, D.A., 1992. Fungal biotechnology. In: Arora, D.K., Elander, R.P., Mukerji, K.G. (Eds.), Handbook of Applied Mycology, vol. 4, An overview. Marcel Dekker, New York, NY, USA, pp. 1–34. El-Hasan, A., Walker, F., Buchenauer, H., 2008. Trichoderma harzianum and its metabolite 6-pentyl-alpha-pyrone suppress fusaric acid produced by Fusarium moniliforme. J. Phytopathol. 156, 79–87. Elzein, A., Kroschel, J., Mueller-Stoever, D., 2004. Effects of inoculum type and propagule concentration on shelf-life of Pesta formulations containing Fusarium

M. Marzano et al. / Biological Control 67 (2013) 397–408 oxysporum Foxy 2, a potential mycoherbicide agent for Striga spp., Biol. Control 30, 203–211. Faull, J.L., Graeme-Cook, K.A., Pilkington, B.L., 1994. Production of an isonitrile antibiotic by an UV-induced mutant of Trichoderma harzianum. Phytochemistry 36, 1273–1276. Flores, A., Chet, I., Herrera-Estrella, A., 1997. Improved biocontrol activity of Trichoderma harzianum by over-expression of the proteinase-encoding gene prb 1. Curr. Genet. 31, 30–37. Fravel, D., Olivain, C., Alabouvette, C., 2003. Fusarium oxysporum and its biocontrol. New Phytol. 157, 493–502. Gäumann, E., 1957. Fusaric acid as a wilt toxin. Phytopathology 47, 342–357. Graeme-Cook, K.A., Faull, J.L., 1991. Effect of ultraviolet induced mutants of Trichoderma harzianum with altered antibiotic production on selected pathogens in vitro. Can. J. Microbiol. 37, 659–664. Grinyer, J., McKay, M., Nevalainen, H., Herbert, B.R., 2004. Fungal proteomics: initial mapping of biological control strain Trichoderma harzianum. Curr. Genet. 45, 163–169. Guetsky, R., Shtienberg, D., Elad, Y., Dinoor, A., 2001. Combining biocontrol agents to reduce variability of biological control. Phytopathology 91, 261–267. Guetsky, R., Shtienberg, D., Elad, Y., Fischer, E., Dinoor, A., 2002. Improving biological control by combining biocontrol agents each with several mechanisms of disease suppression. Phytopathology 92, 976–985. Gullino, M.L., Minuto, A., Gilardi, G., Garibaldi, A., 2002. Efficacy of azoxystrobin and other strobilurins against Fusarium wilts of carnation, cyclamen and Paris daisy. Crop Prot. 21, 57–61. Hadar, Y., Chet, I., Henis, Y., 1979. Biological control of Rhizoctonia solani damping off with wheat bran culture of Trichoderma harzianum. Phytopathology 69, 64–68. Harman, G.E., 2000. Myths and dogmas of biocontrol. Changes in perceptions derived from research on Trichoderma harzianum T-22. Plant Dis. 84, 377–393. Harman, G.E., Taylor, A.G., Stasz, T.E., 1989. Combining effective strains of Trichoderma harzianum and solid matrix priming to improve biological seed treatments. Plant Dis. 73, 631–637. Harman, G.E., Howell, C.R., Viterbo, A., Chet, I., Lorito, M., 2004. Trichoderma species – opportunistic, avirulent plant symbionts. Nat. Rev. Microbiol. 2, 43–56. Hatvani, L., Manczinger, L., Kredics, L., Szekeres, A., Antal, Z., Vagvolgyi, C., 2006. Production of Trichoderma strains with pesticide-polyresistance by mutagenesis and protoplast fusion. Antonie Van Leeuwenhoek 89, 387–393. Hermosa, R., Viterbo, A., Chet, I., Monte, E., 2012. Plant beneficial effects of Trichoderma and of its genes. Microbiology 158, 17–25. Hexon, A.C., Lourdes, M.R., Carlos, C.P., Jose, L.B., 2009. Trichoderma virens, a plant beneficial fungus, enhances biomass production and promotes lateral root growth through an auxin-dependent mechanism in Arabidopsis. Plant Physiol. 149, 1579–1592. Hopkins, D.L., Elmstrom, G.W., 1984. Effect of nonhost crop plants on watermelon Fusarium wilt. Plant Dis. 68, 239–241. Howell, C.R., 1998. The role of antibiosis in biocontrol. In: Harman, G.E., Kubicek, C.P. (Eds.), Trichoderma and Gliocladium, vol. 2, Enzymes, Biological Control and Commercial Applications. Taylor & Francis, London, UK, pp. 173–184. Howell, C.R., 2003. Mechanisms employed by Trichoderma species in the biological control of plant diseases: the history and evolution of current concepts. Plant Dis. 87, 4–10. Jetiyanon, K., Kloepper, J.W., 2002. Mixtures of plant growth-promoting rhizobacteria for induction of systemic resistance against multiple plant diseases. Biol. Control 24, 285–291. Jones, J.B., Jones, J.P., Stall, R.E., Zitter, T.A., 1991. Compendium of Tomato Diseases. APS Press, St. Paul, MN, USA. Karlovsky, P., 2008. Secondary metabolites in soil ecology. In: Karlovsky, P. (Ed.), Secondary Metabolites in Soil Ecology. Springer-Verlag, Berlin Heidelberg, Germany, pp. 1–19. Kistler, H.C., 1997. Genetic diversity in the plant-pathogenic fungus Fusarium oxysporum. Phytopathology 87, 474–479. Klein-Marcuschamer, D., Stephanopoulos, G., 2010. Method for designing and optimizing random-search libraries for strain improvement. Appl. Environ. Microbiol. 76, 5541–5546. Knop, W., 1862. Quantitative-analytische arbeiten über den ernährungsprocess der pflanze. Landw. Versuchsst. 4, 173–187. Kragelund, L., Nybroe, O., 1996. Competition between Pseudomonas fluorescens Ag1 and Alcaligenes eutrophus JMP134 (pJP4) during colonization of barley roots. FEMS Microbiol. Ecol. 20, 41–51. Kumar, A., Gupta, J.P., 1999. Alteration in the antifungal metabolite production of tebuconazole tolerant mutants of Trichoderma viride. Acta Phytopathol. Entomol. Hung. 34, 27–34. Larkin, R.P., Fravel, D.R., 1998. Efficacy of various fungal and bacterial biocontrol organisms for control of Fusarium wilt of tomato. Plant Dis. 82, 1022–1028. Leeman, M., Den Ouden, F.M., Van Pelt, J.A., Cornelissen, C., Matamala-Garros, A., Bakker, P.A.H.M., Schippers, B., 1996. Suppression of Fusarium wilt of radish by co-inoculation of fluorescent Pseudomonas spp. and root-colonizing fungi. Eur. J. Plant Pathol. 102, 21–31. Leslie, J.F., Summerell, B.A., 2006. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, USA. Logrieco, A., Moretti, A., Ritieni, A., Chełkowski, J., Altomare, C., Bottalico, A., Randazzo, G., 1993. Natural occurrence of beauvericin in preharvest Fusarium subglutinans infected corn ears in Poland. J. Agric. Food. Chem. 41, 2149–2152. Limón, M.C., Pintor-Toro, J.A., Benítez, T., 1999. Increased antifungal activity of Trichoderma harzianum transformants that overexpress a 33-kDa chitinase. Phytopathology 89, 254–261.

407

Li, M., Yang, Q., 2007. Isolation and characterization of a b-tubulin gene from Trichoderma harzianum. Biochem. Genet. 45, 529–534. Lifshitz, R., Windham, M.T., Baker, R., 1986. Mechanism of biological control of preemergence damping-off of pea by seed treatment with Trichoderma spp. , Phytopathology 76, 720–725. Liu, P.G., Yang, Q., 2005. Identification of genes with a biocontrol function in Trichoderma harzianum mycelium using the expressed sequence tag approach. Res. Microbiol. 156, 416–423. Marfori, E.C., Kajiyama, S., Fukusaki, E., Kobayashi, A., 2003. Phytotoxicity of the tetramic acid metabolite trichosetin. Phytochemistry 62, 715–721. Marois, J.J., Mitchell, D.J., 1981. Effects of fungal communities on the pathogenic and saprophytic activities of Fusarium oxysporum f. sp. radicis-lycopersici. Phytopathology 71, 1251–1256. Mastouri, F., Björkman, T., Harman, G.E., 2010. Seed treatment with Trichoderma harzianum alleviates biotic, abiotic, and physiological stresses in germinating seeds and seedlings. Phytopathology 100, 1213–1221. Matsumoto, K., Barbosa, M.L., Soussa, L.A.C., Teixeira, J.B., 1995. Race 1 Fusarium wilt tolerance on bananas selected by fusaric acid. Euphytica 84, 67–71. May, H.D., Wu, Q., Blake, C.K., 2000. Effects of the Fusarium spp. mycotoxins fusaric acid and deoxynivalenol on the growth of Ruminococcus albus and Methanobrevibacter ruminantium. Can. J. Microbiol. 46, 692–699. Meca, G., Soriano, J.M., Gaspari, A., Ritieni, A., Moretti, A., Mañes, J., 2010. Antifungal effects of the bioactive compounds enniatins A, A1, B, B1. Toxicon 56, 480–485. Mendoza-Mendoza, A., Pozo, M.J., Grzegorski, D., Martínez, P., García, J.M., OlmedoMonfil, V., Cortés, C., Kenerley, C., Herrera-Estrella, A., 2003. Enhanced biocontrol activity of Trichoderma through inactivation of a mitogen-activated protein kinase. PNAS 100, 15965–15970. Migheli, Q., González-Candelas, L., Dealessi, L., Camponogara, A., Ramón-Vidal, D., 1998. Transformants of Trichoderma longibrachiatum overexpressing the b-1,4endoglucanase gene egl1 show enhanced biocontrol of Pythium ultimun on cucumber. Phytopathology 88, 673–677. Miguel, A., Maroto, J.V., San Bautista, A., Baixauli, C., Cebolla, V., Pascual, B., LoópezGalarza, S., Guardiola, J.L., 2004. The grafting of triploid watermelon is an advantageous alternative to soil fumigation by methyl bromide for control of Fusarium wilt. Sci. Hortic. 103, 9–17. Nel, B., Steinberg, C., Labuschagne, N., Viljoen, A., 2006. The potential of nonpathogenic Fusarium oxysporum and other biological control organisms for suppressing Fusarium wilt of banana. Plant Pathol. 55, 217–223. Nosir, W., McDonald, J., Woodward, S., 2011. Impact of biological control agents on fusaric acid secreted from Fusarium oxysporum f. sp. gladioli (Massey) Snyder and Hansen in Gladiolus grandiflorus corms. J. Ind. Microbiol. Biotechnol. 38, 21– 27. Notz, R., Maurhofer, M., Dubach, H., Haas, D., Défago, G., 2002. Fusaric acidproducing strains of Fusarium oxysporum alter 2,4-diacetylphloroglucinol biosynthetic gene expression in Pseudomonas fluorescens CHA0 in vitro and in the rhizosphere of wheat. Appl. Environ. Microbiol. 68, 2229–2235. Ordentlich, A., Migheli, Q., Chet, I., 1991. Biological control activity of three Trichoderma isolates against Fusarium wilts of cotton and muskmelon and lack of correlation with their lytic enzymes. J. Phytopathol. 133, 177–186. Papavizas, G.C., Lewis, J.A., 1983. Physiological and biocontrol characteristics of stable mutants of Trichoderma viride resistant to MBC fungicides. Phytopathology 73, 407–411. Papavizas, G.C., Lewis, J.A., Abd-El Moity, T.H., 1982. Evaluation of new biotypes of Trichoderma harzianum for tolerance to benomyl and enhanced biocontrol capabilities. Phytopathology 72, 126–132. Parekh, S., Vinci, V.A., Strobel, R.J., 2000. Improvement of microbial strains and fermentation processes. Appl. Microbiol. Biotechnol. 54, 287–301. Queener, S.W., Lively, D.H., 1986. Screening and selection for strain improvement. In: Demain, A.L., Davies, J., Atlas, R.M., Cohen, G., Hershberger, C., Hu, W., Sherman, D., Willson, R., Wu, J.D. (Eds.), Manual of Industrial Microbiology and Biotechnology. American Society for Microbiology, Washington, DC, USA, pp. 155–169. Raaijmakers, J.M., van der Sluis, I., Koster, M., Bakker, P.A.H.M., Weisbeek, P.J., Schippers, B., 1995. Utilization of heterologous siderophores and rhizosphere competence of fluorescent Pseudomonas spp., Can. J. Microbiol 41, 126–135. Reithner, B., Ibarra-Laclette, E., Mach, R.L., Herrera-Estrella, A., 2011. Identification of mycoparasitism-related genes in Trichoderma atroviride. Appl. Environ. Microbiol. 77, 4361–4370. Rey, M., Delgado-Jarana, J., Benítez, T., 2001. Improved antifungal activity of a mutant of Trichoderma harzianum CECT 2413 which produces more extracellular proteins. Appl. Microbiol. Biotechnol. 55, 604–608. Rezzonico, F., Zala, M., Keel, C., Duffy, B., Moënne-Loccoz, Y., Défago, G., 2007. Is the ability of biocontrol fluorescent pseudomonads to produce the antifungal metabolite 2,4-diacetylphloroglucinol really synonymous with higher plant protection? New Phytol. 173, 861–872. Rossi, V., Pattori, E., 2009. Inoculum reduction of Stemphylium vesicarium, the causal agent of brown spot of pear, through application of Trichoderma-based products. Biol. Control. 49, 52–57. Rowlands, T., 1984. Industrial strain improvement: rational screens and genetic recombination techniques. Enzyme Microb. Technol. 6, 290–300. Sadasivan, T.S., 1961. Physiology of wilt disease. Annu. Rev. Plant Physiol. 12, 449– 468. Sanchez, L.E., Endo, R.M., Leary, J.V., 1975. A rapid technique for identifying the clones of Fusarium oxysporum f. sp. lycopersici causing crown- and root-rot of tomato. Phytopathology 65, 726–727.

408

M. Marzano et al. / Biological Control 67 (2013) 397–408

Scherm, B., Schmoll, M., Balmas, V., Kubicek, C.P., Migheli, Q., 2009. Identification of potential marker genes for Trichoderma harzianum strains with high antagonistic potential against Rhizoctonia solani by a rapid subtraction hybridization approach. Curr. Genet. 55, 81–91. Schmidt, C.S., Agostini, F., Leifert, C., Killham, K., Mullins, C.E., 2004. Influence of soil temperature and matric potential on sugar beet seedling colonization and suppression of Pythium damping-off by the antagonistic bacteria Pseudomonas fluorescens and Bacillus subtilis. Phytopathology 94, 351–363. Schouten, A., van den Berg, G., Edel-Hermann, V., Steinberg, C., Gautheron, N., Alabouvette, C., de Vos, C.H., Lemanceau, P., Raaijmakers, J.M., 2004. Defense responses of Fusarium oxysporum to 2,4-diacetylphloroglucinol, a broadspectrum antibiotic produced by Pseudomonas fluorescens. Mol. Plant Microb. Interact. 17, 1201–1211. Scott, J.C., Gordon, T., Kirkpatrick, S.C., Koike, S.T., Matheron, M.E., Ochoa, O.E., Truco, M.J., Michelmore, R.W., 2012. Crop rotation and genetic resistance reduce risk of damage from Fusarium wilt in lettuce. Calif. Agr. 66, 20–24. Segarra, G., Casanova, E., Avilés, E., Trillas, I., 2010. Trichoderma asperellum strain T34 controls Fusarium wilt disease in tomato plants in soilless culture through competition for iron. Microb. Ecol. 59, 141–149. Sharma, P., Vignesh, K.P., Ramesh, R., Saravanan, K., Deep, S., Sharma, M., Mahesh, S., Dinesh, S., 2011. Biocontrol genes from Trichoderma species: a review. Afr. J. Biotechnol. 10, 19898–19907. Sidhu, G.S., Webster, J.M., 1979. A study of heterokaryosis and its influence on virulence in Fusarium oxysporum lycopersici. Can. J. Bot. 57, 548–555. Sivan, A., Chet, I., 1989a. Degradation of fungal cell walls by lytic enzymes of Trichoderma harzianum. J. Gen. Microbiol. 135, 675–682. Sivan, A., Chet, I., 1989b. The possible role of competition between Trichoderma harzianum and Fusarium oxysporum on rhizosphere colonization. Phytopathology 79, 198–203. Smith, V.L., Wilcox, W.F., Harman, G.E., 1990. Potential for biological control of Phytophthora root and crown rots of apple by Trichoderma and Gliocladium spp., Phytopathology 80, 880–885. Son, S.W., Kim, H.Y., Choi, G.J., Lim, H.K., Jang, K.S., Lee, S.O., Lee, S., Sung, N.D., Kim, J.C., 2008. Bikaverin and fusaric acid from Fusarium oxysporum show antioomycete activity against Phytophthora infestans. J. Appl. Microbiol. 104, 692–698. Song, W., Zhou, L., Yang, C., Cao, X., Zhang, L., Liu, X., 2004. Tomato Fusarium wilt and its chemical control strategies in a hydroponic system. Crop Prot. 23, 243– 247. Spadaro, D., Gullino, M.L., 2005. Improving the efficacy of biocontrol agents against soilborne pathogens. Crop Prot. 24, 601–613. Szekeres, A., Kredics, L., Antal, Z., Kevei, F., Manczinger, L., 2004. Isolation and characterization of protease overproducing mutants of Trichoderma harzianum. FEMS Microbiol. Lett. 233, 215–222. Thrane, C., Funck Jensen, D., Tronsmo, A., 2000. Substrate colonization, strain competition, enzyme production in vitro, and biocontrol of Pythium ultimum by Trichoderma spp. isolates P1 and T3. Eur. J. Plant Pathol. 106, 215–225.

Tijerino, A., Hermosa, R., Cardoza, R.E., Moraga, J., Malmierca, M.G., Aleu, J., Collado, I.G., Monte, E., Gutierrez, S., 2011. Overexpression of the Trichoderma brevicompactum tri5 gene: effect on the expression of the trichodermin biosynthetic genes and on tomato seedlings. Toxins 3, 1220–1223. Toyoda, H., Hashimoto, H., Utsumi, R., Kobayashi, H., Ouchi, S., 1988. Detoxification of fusaric acid by a fusaric acid-resistant mutant of Pseudomonas solanacearum and its application to biological control of Fusarium wilt of tomato. Phytopathology 78, 1307–1311. Venter, S.L., Steyn, P.J., 1998. Correlation between fusaric acid production and virulence of isolates of Fusarium oxysporum that causes potato dry rot in South Africa. Potato Res. 41, 289–294. Verma, M., Satinder, K.B., Tyagi, R.D., Surampalli, R.Y., Valèro, J.R., 2007. Antagonistic fungi, Trichoderma spp.: panoply of biological control. Biochem. Eng. J. 37, 1–20. Vesonder, R.F., Golínski, P., 1989. Metabolite of Fusarium. In: Chełkowski, J. (Ed.), Fusarium, Mycotoxins, Taxonomy and Pathogenicity. Elsevier Scientific Publishers, Amsterdam, The Netherlands, pp. 1–39. Vinale, F., Sivasithamparam, K., Ghisalberti, E.L., Ruocco, M., Woo, S., Lorito, M., 2012. Trichoderma secondary metabolites that affect plant metabolism. Nat. Prod. Commun. 7, 1545–1550. Viterbo, A., Harel, M., Horwitz, B.A., Chet, I., Mukherjee, P.K., 2005. Trichoderma mitogen-activated protein kinase signaling is involved in induction of plant systemic resistance. Appl. Environ. Microbiol. 71, 6241–6246. Vizcaíno, J.A., Cardoza, R.E., Hauser, M., Hermosa, R., Rey, M., Llobell, A., Becker, J.M., Gutiérrez, S., Monte, E., 2006. ThPTR2, a di/tri peptide transporter gene from Trichoderma harzianum. Fungal Genet. Biol. 43, 234–246. Wang, Q., Xu, L., 2012. Beauvericin, a bioactive compound produced by fungi: a short review. Molecules 17, 2367–2377. Whipps, J.M., 1987. Effect of media on growth and interactions between a range of soil-borne glasshouse pathogens and antagonistic fungi. New Phytol. 107, 127– 142. Whipps, J.M., Lumsden, R.D., 2001. Commercial use of fungi as plant disease biological control agents: status and prospects. In: Butt, T.M., Jackson, C.W., Magan, N. (Eds.), Fungi as Biocontrol Agents. Progress, Problems and Potential. CAB International Publishing, Wallingford, UK, pp. 9–22. Wicklow, D.T., 1992. Interference competition. In: Carroll, G.C., Wicklow, D.T. (Eds.), The Fungal Community - Its Organization and Role in the Ecosystem, Second Ed. Marcel Dekker, New York, NY, USA, pp. 265–274. Wu, H., Yin, X., Liu, D., Ling, N., Bao, W., Ying, R., Zhu, Y., Guo, S., Shen, Q., 2008. Effect of fungal fusaric acid on the root and leaf physiology of watermelon (Citrullus lanatus) seedlings. Plant Soil 308, 255–266. Xue, J., Zhang, Y., Wang, C., Wang, Y., Hou, J., Wang, Z., Wang, Y., Gu, L., Sung, C., 2013. Effect of nutrition and environmental factors on the endoparasitic fungus Esteya vermicola, a biocontrol agent against pine wilt disease. Curr. Microb. 67, 306–312.