Improvement of thermal stability of a mutagenised α-amylase by manipulation of the calcium-binding site

Enzyme and Microbial Technology 53 (2013) 406–413

Contents lists available at ScienceDirect

Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/emt

Improvement of thermal stability of a mutagenised ␣-amylase by manipulation of the calcium-binding site Marzieh Ghollasi a , Maryam Ghanbari-Safari b , Khosro Khajeh b,∗ a b

Department of Cell and Molecular biology, Faculty of Biological Science, Kharazmi University, P.O. Box: 31979-37551, Tehran, Iran Department of Biochemistry and Biophysics, Faculty of Biological Science, Tarbiat Modares University, P.O. Box: 14115-175, Tehran, Iran

a r t i c l e

i n f o

Article history: Received 31 October 2012 Received in revised form 30 August 2013 Accepted 3 September 2013 Keywords: ␣-Amylase Bacillus megaterium Calcium Mutagenesis Thermostability

a b s t r a c t Site-directed mutagenesis of an ␣-amylase isolated from Bacillus megaterium WHO has been performed to evaluate the roles of the calcium binding site residues in enzyme thermostability. The strategy used was to replace residues in the hypothetical calcium binding loops of B. megaterium WHO ␣-amylase (BMWamylase) by equivalent positions at Halothermothrix orenii ␣-amylase (AmyA) as a thermophilic amylase by QuikChange site directed mutagenesis. Asn-75, Ser-76, and His-77 were mutated in the second calcium binding site which resulted in an increase in thermostability. All mutants retained their hydrolytic activity although their kcat parameter decreased in compare to the wild type and in the presence of calcium ions. In S76P and H77E, the Km for starch decreases while overall activity (kcat /Km ) was increased. In the presence of calcium, conversion of His-77 to Glu resulted in a 4-fold enhancement in enzyme half life and a 9 ◦ C upward shift in T50 , which was observed in compare to the wild type. Further analysis suggested the H77E mutant as the most stable which increased the affinity of the enzyme for calcium ion and its optimum temperature was 5 ◦ C higher than the wild type. © 2013 Elsevier Inc. All rights reserved.

1. Introduction The ␣-amylase family contains almost 30 different enzyme specificities including hydrolases, transferases and isomerases [1]. The ␣-amylase family enzymes possess several well-conserved sequence regions (CSR); four of them named as region I, II, III and IV were definitively established in 1986 [2] and contains most of the residues necessary for catalytic function of the enzyme [3]. Further, three conserved sequence regions, V, VI and VII were identified at the beginning of the 1990s [4]. The CSRs V, VI and VII located close to the C-terminal end of domain B and at ␤ strands ␤2 and ␤8 of TIM barrel, respectively [5]. It has been proposed that conservation and variation within these CSRs may be related to maintenance of structure and characteristic of certain enzyme specificities [6]. Features of The specific sequence in the fifth conserved sequence region of the family served as the basis for defining the subfamilies: QPDLN for the oligo 1,6-glucosidase subfamily and MPKLN for the neopullulanases subfamily [7]. From the sequence point of view, ␣-amylase from Bacillus megaterium is placed in “intermediary group” by the intermediary sequence as MPDLN and mixed enzyme specificities [8]. It has been reported that B. megaterium exhibit specificity for cyclodextrins, pullulan and starch [9] which is distinguished from that of a typical ␣-amylase [10].

∗ Corresponding author. Tel.: +98 21 8800 9730; fax: +98 21 8800 9730. E-mail address: [email protected] (K. Khajeh). 0141-0229/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.enzmictec.2013.09.001

The objective of this study was to simultaneously improve the activity and stability of a recombinant ␣-amylase from B. megaterium WHO [11]. Adjustments of the thermostability of natural proteins seem to occur through the accumulation of numerous mutations with limited individual impact, as suggested by comparing homologous proteins from psychrophilic, mesophilic, thermophilic and hyperthermophilic organisms [12]. With this in mind, the residues in the hypothetical calcium binding loops of B. megaterium WHO ␣-amylase (BMW-amylase) were replaced by equivalent positions at Halothermothrix orenii ␣-amylase (AmyA) as a thermophilic enzyme. BMW-amylase shows 50% sequence identity and 67% sequence similarity with AmyA which has a known 3D structure among various bacterial ␣-amylases resulted from BLAST program [13,14]. Crystal structure of AmyA shows that the enzyme binds two calcium ions in two loops that are located in domain A [15]. The identity and similarity scores between primary sequences of BMW-amylase and AmyA arise to 63% and 81%, respectively in the first fragment of domain A where the calcium binding sites are located. Due to the higher sequence identity of BMW-amylase and AmyA, we chose it as a model for identifying the best positions for site-directed mutagenesis to improve the thermostability caused by increased Ca-affinity of the enzyme. Although, there are some similar reports previously published for Bacillus ␣-amylases, especially for Bacillus licheniformis amylase (BLA) and Bacillus amyloliquefaciens ␣-amylase (BAA) using naturally occured mutant enzymes and artificially obtained ones [12,16,17] but BMW-amylase is an ␣-amylase very far in

M. Ghollasi et al. / Enzyme and Microbial Technology 53 (2013) 406–413

407

Table 1 DNA sequences of primers used in the study. Primer name

Primer sequence

N75D primer F N75D primer R S76P primer F S76P primer R H77E primer F H77E primer R

5 GGATTATTTAAATGACGGCGATTCTCATACAAAGAATGATC 3 5 GATCATTCTTTGTATGAGAATCGCCGTCATTTAAATAATCC 3 5 GATTATTTAAATGACGGCAATCCGCATACAAAGAATGATCTTC 3 5 AAGATCATTCTTTGTATGCGGATTGCCGTCATTTAAATAATC 3 5 GATTATTTAAATGACGGCAATTCTGAAACAAAGAATGATCTTC 3 5 GAAGATCATTCTTTGTTTCAGAATTGCCGTCATTTAAATAATC 3

The mutated sites are underlined.

phylogenetic tree from BLA and BAA [14], so they have different structures. Based on the sequence of BMW-amylase it seems that this enzyme belongs to the intermediary subfamily of GH13-36. Only a few of this subfamily members have already been biochemically characterized and it seems that they possess a varying mixture of related enzyme specificities of the ␣-amylase family GH13 [18]. Further, in this report we engineered a stable, thermophilic-like variant of an intermediary ␣-amylase by only single amino acid substitution. Here, to characterize the structural stability of the wild-type and mutated enzymes, the thermal inactivation in the temperature range of 50–70 ◦ C was measured. Inactivation studies at various concentrations of calcium ion provide useful information about the stabilization of the enzyme structure bound to the divalent ion. To obtain more reliable results we employed a simple kinetic model described by Lumry and Eyring [19] to compare the unfolding kinetic of four different variants of ␣-amylase. 2. Materials and methods 2.1. Chemicals The following chemicals were purchased from commercial sources: Starch, DNS (Sigma Chemical Co., St. Louis, Mo, USA); dNTP (Fermentas, Vilnius, Lithuania); PWO DNA polymerase, restriction enzymes (Roche, Basal, Switzerland); Ni-NTA column (Qiagen, Munich, Germany); Tris (Liofilchem, Italy); CaCl2 (Merck, Darmstadt, Germany). All other chemicals were of analytical grade.

2.2. Bacterial strains and plasmids B. megaterium WHO was used as a source of genomic DNA [11]. Escherichia coli XL1-blue and E. coli BL-21 were used as the host for cloning and expression experiments. Plasmid pET-21a was used in expression vector construction.

2.7. Site-directed mutagenesis Site-directed mutagenesis was done using quick-change method described by Fisher [23]. Following subcloning, the amylase gene was fully sequenced (Millgen, Toulouse, France) to ensure that the mutation of interest was present and that no additional mutation was introduced by the PCR. Based on quick-change site-directed mutagenesis method three pairs of primers were designed (Table 1). The PCR reaction mixture contained 0.2 ␮g template DNA, 10× PCR buffer, 0.2 mM of each dNTP, 15 ␮M of each primer and 1.25 units PWO DNA polymerase in 50 ␮l. The mixture was heated at 95 ◦ C for 5 min and then subjected to thermal cycling (22 cycles of 94 ◦ C for 1 min, 55 ◦ C for 1 min and 68 ◦ C for 13 min). The PCR product incubated in a digestion reaction with DpnI at 37 ◦ C for 12 h. The digestion reaction transformed to E. coli XL1-blue by chemical method [20]. For each mutation, five clones selected randomly for sequencing and the mutagenesis was confirmed. 2.8. Expression of BMW-amylase E. coli BL-21 harboring a recombinant plasmid was grown overnight at 37 ◦ C in 25 ml broth containing ampicillin (100 ␮g/ml). An overnight culture was inoculated into fresh 1 l broth (1%, v/v, inoculation) containing ampicillin (100 ␮g/ml) and incubation at 37 ◦ C was continued until an optimal density of 0.5–0.7 at 600 nm was reached. The inducer isopropyl-␤-d-thiogalactopyranoside (IPTG) was added (final concentration, 1 mM) and incubated for another 6 h at 25 ◦ C. Cells were harvested by centrifugation at 8000 × g for 20 min at 4 ◦ C and the cell pellet was resuspended in the lysis buffer containing 1 M NaCl, 50 mM Tris, 2 mM imidazole, 1 mM PMSF, 10% (v/v) glycerol, pH 8.0. The cells were disrupted by sonication and then centrifuged at 15000 × g for 30 min at 4 ◦ C. The supernatant used as the crude extract, applied to Ni-NTA column equilibrated with lysis buffer (pH 8.0). The column washed with a linear gradient of washing buffer (NaCl, 1 M; Tris, 50 mM; imidazole, 30, 40 or 60 mM, pH 8.0) and eluted with elution buffer (same as washing buffer except containing 250 mM imidazole). The eluted fractions containing amylase activity were pooled and dialyzed against 20 mM Tris–HCl buffer (pH 7.2) twice. The solution was then used for determination of protein concentration based on Bradford procedure [24]. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was carried out by the method of Laemmli [25]. A high molecular-weight marker (Fermentas) was used and protein bands were detected by staining with coomassie brilliant blue R-250. 2.9. Far-UV circular dichroism and fluorescence spectroscopy

2.3. Media E. coli was routinely grown at 37 ◦ C in Luria-Bertani medium [20] supplemented with ampicillin (100 ␮g/ml) or isopropyl-␤-d-thiogalactopyranoside (IPTG, 1 mM) if required.

2.4. DNA isolation and manipulation Genomic DNA was isolated from B. megaterium WHO by phenol–chloroform method [21]. Plasmid isolation from E. coli was performed by the plasmid extraction miniprep kit (Bioneer, Daejeon, Korea). Manipulation of DNA molecules was performed according to the methods described by Sambrook [20].

2.5. Cloning of BMW-amylase The identification and cloning of the enzyme has been reported previously (the nucleotide sequence data were submitted to the GenBank under the accession number ABU54057) [22].

2.6. Computer aide modeling of BMW-amylase tertiary structure The automated protein structure homology-modeling server, SWISSMODEL (http://www.expasy.org/swissmod/) was used to generate the three dimensional model. The Deep view Swiss-PDB viewer software from the EXPASY server (available at http://www.expasy.org/spdbv/) was applied to visualize and analyze the atomic structure of the model.

Far-UV circular dichroism measurements were conducted on an AVIV model 215 (Lakewood, NJ, USA) spectropolarimeter equipped with a thermostatically controlled cell holder. Results were expressed as molar ellipticity [] (deg cm2 dmol−1 ), based on a mean molecular weight of the residue (MWR) assuming an average weight of 54,450 Da for BMW-amylase. The molar ellipticity [] was calculated from the formula [] = ( × 100MRW)/(cl), where c is the protein concentration in mg/ml, l the light path length in centimeters, and  the measured ellipticity in degrees at wavelength . Each spectrum is an average of at least two scans. All spectra were background-corrected, smoothed and transformed into mean residue ellipticity []. Fluorescence studies were carried out on Varian Cary Eclipse fluorescence spectrometer (Varian, Palo Alto, USA). Intrinsic fluorescence was determined using 0.02 mg/ml protein at an excitation wavelength of 280 nm. Emission spectra were recorded between 300 and 400 nm. 2.10. Enzyme activity and biochemical characterization For preparation of Ca2+ -free enzyme, the protein sample was dialyzed against 20 mM Tris–HCl (pH 7.2). To obtain Ca-depleted samples, 4 ml of the purified protein were dialyzed against 20 mM Tris/20 mM ethylene diamine tetra acetic acid (EDTA) overnight with at least two changes of the equilibrium dialysis buffer. In this condition the enzyme was precipitated so the enzyme solution dialyzed against Tris–HCl buffer (20 mM, pH 7.2) for 48 h was used for all biochemical tests. ␣-Amylase activity was determined by measuring the amount of reducing sugars released during incubation with starch. 20 ␮l of enzyme solution was added to 80 ␮l of 1% (w/v) starch dissolved in 20 mM Tris–HCl buffer (pH 7.2), followed by incubation at 30 ◦ C for 30 min. The reaction was stopped by adding DNS reagent and the amount of reducing sugars released was determined by dinitrosalicylic acid method [26]. One unit of

408

M. Ghollasi et al. / Enzyme and Microbial Technology 53 (2013) 406–413

amylase activity is defined as the amount of enzyme that release 1 ␮mol of reducing sugars (with maltose as the standard) per min under the assay conditions specified. A maltose standard curve was constructed with different concentrations of maltose. To determine the influence of temperature on the enzymatic activity, samples were incubated at temperatures from 20 to 100 ◦ C for 5 min using thermoblock or water bath and the amount of reducing sugars liberated by enzyme activity was measured using the DNS method of Miller [26]. 2.11. Determination of calcium content of the enzyme The calcium bound to the ␣-amylase was determined by ICP-AES (Varian Libery 150 Ax Turbo) spectrophotometer at 317.93 nm after the dialysis of the purified enzyme against Tris–HCl buffer (20 mM, pH 7.2) for 48 h [27]. 2.12. Thermal inactivation Thermal stability was determined at five temperatures (50, 55, 60, 65, 70 ◦ C) in 20 mM Tris–HCl buffer (pH 7.2) using 0.06 mg/ml enzyme solved in calcium free buffer as well as 2 or 5 mM calcium buffer. At various time intervals, 20 ␮l aliquots were removed and diluted into 100 ␮l of an assay solution (80 ␮l starch 1%, w/v) for the measurement of residual activity at 30 ◦ C for 30 min. Plots of the log of residual activity versus time were obtained. On the other hands, thermal stability was determined by incubating 1 ␮M solution of purified BMW-amylase (in 20 mM Tris–HCl, pH 7.2; calcium free buffer, 2 or 5 mM calcium buffer) at various temperatures for 30 min. Subsequently, the remaining amylase activity was determined at 30 ◦ C. Stability was quantified by determining T50 , being the temperature of incubation at which 50% of the initial amylase activity was retained. The T50 values given are the average of at least three independent measurements. 2.13. Enzyme kinetics In order to determine kinetic parameters, the enzyme activity was measured using different substrate concentrations and the final concentration of the enzyme was 0.06 mg/ml. We have blanks for each starch concentration and the differential absorbance was used to determine the activity. Steady-state kinetic parameters Km , Vmax , kcat and kcat /Km for BMW-amylase and its variants were determined by fitting the Michaelis–Menten equation to the initial velocity data. The results are mean values of three independent experiments and they were repeated for reproducibility. 2.14. Calculation of thermodynamic parameters The rate constants of amylolytic reaction (kcat ) and inactivation (kinact ) were used to calculate the activation energy of each reaction according to the Arrhenius equation [28]. k = Ae−Ea /RT

(1)

−1

where k (s ) is the rate constant at temperature T (K), A is a pre-exponential factor related to steric effects and the molecular collision frequency, R is the gas constant (8.314 J mol−1 K−1 ) and Ea the activation energy of the reaction. Hence, a plot of ln k as a function of 1/T gives a curve of slope −Ea /R. The thermodynamic parameters of activation were determined as follows:



G# = RT ln

kB T h



− RT ln kcat

(2)

H # = Ea − RT S # =

H − G T #

(3) #

(4) −23

−1

where kB is the Boltzmann constant (1.3805 × 10 J K ), h the Planck’s constant (6.6256 × 10−34 J s) and k (s−1 ) is the rate constant at temperature T (K). All results are the mean of at least three repeated experiments in a typical run to confirm reproducibility.

orenii. AmyA is active in a broad range of salt concentration and its optimal temperature is above 65 ◦ C [15]. The crystal structure of AmyA [13] showed two calcium binding loops in domain A. It has been shown that the purified AmyA could be stabilized at 70 ◦ C using 10 mM CaCl2 . The optimum pH for AmyA is 7.5. concerning the activity profile of AmyA, this enzyme has no significant effect on pullulan, glycogen or cyclodextrins while starch, amylase and amylopectin were hydrolysed rapidly by AmyA [29]. We used the BLASTP program (http://blast.ncbi.nlm.nih.gov) to identify the amino acids in the second Ca-binding site of AmyA, where we found some of the amino acids to be different from BMWamylase. The crystal structure of AmyA showed the involvement of Asp65 , Asp67 , Thr70 , and Asp73 in the second calcium binding loop to be identical to the Asp73 , Asn75 , Thr78 and Asp81 residues in BMW-amylase (Fig. 1A). In addition, there are some differences in the amino acid sequences besides the calcium binding site residues in the loop. For example the Ser76 and His77 in BMW-amylase are replaced with Pro68 and Glu69 in AmyA (Fig. 1A). The 3-D structure of AmyA was used as an initial template to build models for BMWamylase, using the automated structure-modeling program Deep View/Swiss-PDB viewer. A representation of the overall polypeptide chain fold determined for BMW-amylase is shown in Fig. 1B. Three point mutations as N75D, S76P and H77E were chosen in order to increase the binding affinity of calcium ion. Thermal stability, activity and calcium affinity were also examined.

3.2. Preparation of wild-type and mutated ˛-amylases The amyW gene (␣-amylase gene without the signal sequence) was subcloned into pET-21a expression vector controlled by the T7 promoter (pAmyW). After induction with IPTG and lactose (1 mM and 4 mM as the final concentrations, respectively), the supernatant of sonicated cells was collected from 1 l of culture and applied to Ni-NTA columns for purification. The purified protein revealed a single band with an apparent mass of 54 kDa on SDSPAGE (Fig. 2). The plasmids containing mutated ␣-amylase gene were transformed into E. coli BL-21. Expression and purification of the mutated enzyme was carried out using the same procedure as the wild type. The purified enzyme used for SDS-PAGE analysis and the gel staining revealed the single band of protein (Fig. 2). Far-UV circular dichroism (CD) was used to investigate the changes of secondary structures in different variants (Fig. 3a). The spectrum is typical of an ␣-helical protein with a large negative ellipticity at 222 nm [30]. The profile of the wild-type was not significantly different from that of the variants, indicating that the secondary structures are essentially identical. In addition, the intrinsic fluorescence spectrum obtained by fluorescence emission from Trp residues near 340 nm was slightly different for mutant enzymes (Fig. 3b). This may have been caused by exposing aromatic residuesto water solutions. These results revealed that the mutations did not cause a significant change in the secondary and tertiary structure of the enzyme.

3. Results and discussion 3.1. Mutation selection in BMW-amylase

3.3. Calcium content of BMW-amylase variants

Based on the sequence of BMW-amylase, it seems that this enzyme could possess specific features of GH13 amylase which resembles ␣-amylase, ␣-glucosidase and even cyclomaltodextrinase. With regards to the functional significance of such amylases, in this study it has been attempted to promote the thermal stability of the enzyme by inducing specific mutations. AmyA is the only ␣-amylase which its verified structure displays a high sequence homology with BMW-amylase; this ␣-amylase has been obtained from a true halo-thermophilic bacterium named H.

The ␣-amylase is a metalloenzyme which its amount of bound calcium is different from one to ten. Calcium ion has been reported to possess a critical role in enzymatic activity and structural stability of ␣-amylases [27]. Analysing the calcium content of purified enzyme variants showed the presence of two bound calciums per enzyme molecule. Dialysis against EDTA precipitates of the enzyme indicated that the afore mentioned two Calcium ions are tightly bound to the enzyme and are essential for the structural integrity of the protein molecule.

M. Ghollasi et al. / Enzyme and Microbial Technology 53 (2013) 406–413

409

Fig. 1. (A) Multiple alignments of N-terminal domain of BMW-amylase and related proteins in GenBank and Swiss-Prot databases. The amino acids participate in the calcium binding sites and the ones selected for mutagenesis are marked by gray and black boxes, respectively. Abbreviations used here, represent amylases from some microbial sources as BMW-amylase, Bacillus megaterium WHO (ABU54057.1), BMA, Bacillus megaterium (ACN23230.1), AmyAB, Bacillus sp. WCS10 (AAU84698.1), AmyF, Bacillus sp. WS06 (AAX84031.1) and AmyA, Halothermothrix orenii (AAN52525). (B) Stereo view of the ribbon model of the overall structure of BMW-amylase showing selected amino acids for mutation. Loops are shown in green color and the mutated segment is determined by blue color. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

3.4. Kinetic parameters of BMW-amylase variants The kinetic parameters (Km and Vmax ) of the wild-type and the three mutants were measured using starch as the substrate in the presence of two concentrations of CaCl2 at 30 ◦ C, as shown in Table 2. It is significant that the kinetic parameters of the wild-type enzyme and mutants revealed a clear trend in decreasing both kcat

and Km in the presence of CaCl2 . As it will be presented in the next section, the mutant enzymes showed enhanced thermal stability compared to the wild-type; it is obvious that the increased thermostability of the enzyme variants has often been reported to be accompanied by a decrease in their catalytic activity at moderate temperatures, presumably as a consequence of the overall protein rigidity [31,32]. On the other hand, substitution of single amino acid as S76P and H77E results in decreased Km compared with the wildtype enzyme and the catalytic efficiency (kcat /Km ) has improved due to an increase in the affinity of the enzyme to substrate. Although the overall activity of N75D had decreased, nevertheless about 80% of the wild-type activity maintained in the absence of calcium. It seems that the presence of calcium has a destructive effect on the enzyme catalysis activity in which the catalytic efficiency of the enzyme is decreased. There are two factors that may have caused this change in the rate of hydrolysis activity. The first is the effect of increased ionic strength on the hydrolytic reaction [33] and the second is the specific effect of calcium binding. It seems that the effect of specific calcium binding is more likely to cause this change than the pure salt effect, since the addition of 2 mM NaCl, instead of CaCl2 , had no effect on the kinetic parameters (data not shown). 3.5. Temperature dependence of catalytic activity

Fig. 2. SDS-PAGE analysis of purified recombinant BMW-amylases. Lanes 1–4, single purified band of N75D, S76P, H77E and wild type amylase, respectively; lane 5, molecular mass markers (14.3, 20.1, 36, 44.2, 66.2 and 97.2 kDa).

Enzyme activities were determined in a temperature range between 25 and 80 ◦ C. In this temperature range, the substrate (starch) is stable and does not suffer any modifications which may

Topt and T50 of thermoinactivations were obtained in different [Ca2+ ]. Half life of the enzyme (t1/2 ) is obtained from this equation: t1/2 = 0.693/Kd (Kd is the first order constant of inactivation at 60 ◦ C). Thermodynamic parameters for amylolytic reaction were determined at 30 ◦ C and thermodynamic parameters for irreversible thermoinactivation (k = kinactivation ) were determined at 60 ◦ C. In all cases the standard deviations were <5.

128.1 128.2 138.2 21.4 22 22.1 65.4 66 69.5 62 64 65 0 2 5 H77E

1.6 1.3 1.2

19.5 19.5 19.1

12.5 14.6 16.4

64 64.5 64.8

7.7 16.9 19.2

9.1 9.1 9.4

8.5 8.5 8.7

12.7 12.7 12.7

−13.9 −13.9 −13.0

64.8 65.3 68.8

129.3 132 136.9 21.3 21.7 21.9 65.7 66.9 68.8 62 63 64 0 2 5 S76P

1.7 1.4 1.3

22.2 19.7 18.5

12.6 13.8 14.1

60 60.7 61

6 10.3 13.9

8.6 8.7 8.7

8.0 8.1 8.1

12.7 12.7 12.7

−15.5 −15.2 −15.2

65 66.3 68.1

131.2 95.4 91.7 21.4 21.4 21.5 66.4 54.3 52.5 58 59 63 0 2 5 N75D

1.7 1.6 1.5

17.5 16.2 14.5

10.2 9.8 9.5

63 63.5 64

6.93 7.1 8.1

9.6 10 10.6

9 9.4 10

12.6 12.6 12.6

−12.1 −10.6 −8.5

65.8 53.8 52.5

20.9 21 21.2 37.5 47.1 53.9 52.9 55 57 12.5 13.8 13.8 25.7 19.9 19.9 2 1.4 1.4 0 2 5 WT

Km (mg/ml)

kcat (s−1 )

kcat /Km (s−1 mg−1 ml)

60 60.3 60.7

3.2 3.9 5.7

9.5 9.9 10.2

8.9 9.3 9.6

12.6 12.6 12.6

−12.2 −10.9 −9.9

36.8 46.4 53.2

G# (kcal/mol) H# (kcal/mol) Ea (kcal/mol) S# (cal/molK) Ea (kcal/mol)

H# (kcal/mol)

G# (kcal/mol)

Inactivation Activation T1/2 (min) T50 (◦ C) Topt (◦ C) Kinetic parameters [Ca2+ ] (mM) Enzyme

Table 2 The kinetic constants of WT and mutants in calcium free buffer as well as 2 or 5 mM calcium buffer.

47.2 75.1 94.6

M. Ghollasi et al. / Enzyme and Microbial Technology 53 (2013) 406–413 S# (cal/mol K)

410

Fig. 3. Secondary structure analysis of wild-type (1), N75D (2), S76P (3) and H77E (4) variants as measured by CD (a) and fluorescence (b). CD and fluorescence spectra were recorded at 25 ◦ C with 0.2 and 0.02 mg/ml enzyme concentrations in Tris buffer (pH 7.2), respectively.

affect enzyme activity [7]. The results showed that the optimum temperature for the wild types N75D, S76P and H77E was approximately 60 ◦ C, 63 ◦ C, 60 ◦ C and 65 ◦ C, respectively (Table 2) whereas AmyA (a thermophilic enzyme) is optimally active at 65 ◦ C [15]. Also, the presence of calcium ion in different concentrations did not have a noticeable effect on optimum temperatures. An Arrhenius plot (ln specific activity as a function of 1/T) was drawn from the measurement of specific activity (␮mol min−1 mg enz−1 ) of amylolytic reaction at various temperatures. The data plots for the wild-type and the three variants gave straight lines over the temperature range of 25–60 ◦ C. The values of activation energy(Ea ) were evaluated from the slopes of the straight line region. Other activation parameters are listed in Table 2 for 30 ◦ C. As shown, the activation parameters are different in S76P and H77E from those in N75D. In the case of H77E, a change in hydration around the negative charge of the carboxyl group may also have a significant contribution to S# . The negative S# increases G# and slows the rate of catalysis [34]. On the other hand, the decreased

M. Ghollasi et al. / Enzyme and Microbial Technology 53 (2013) 406–413

411

H# and activation energy can be ascribed to the increased activity of S76P and H77E mutant relative to wild-type ␣-amylase at lower temperatures [35]. In the hydrolysis process, the attack of an activated water molecule on the ES complex involves moving one water molecule from the liquid state to the enzyme active site using about 10 J/mol K of entropy [36]. The observed activation entropies in this study were between 51 and 54 J/mol K. The deviation from −10 J/mol K is the result of the cooperative behavior of other water molecules around the active site during the hydrolytic pathway [37]. The release of water molecules both from the calcium ion and the binding site of the protein or conformational scrambling of the protein induces a positive entropy change compared to the situation where calcium ion are absent [38]. The small alterations in the thermodynamic activation parameters suggest that the degree of conformational change in ␣-amylase during the calcium ion binding is not significant.

3.6. The apparent transition temperature (T50 ) and half-life (t1/2 ) of enzymes Incubation of ␣-amylases in Tris buffer at pH 7.2 and high temperatures results in a progressive inactivation of the enzyme. This process represents irreversible thermoinactivation of BMWamylase whereas a prolonged incubation of the thermoinactivated enzyme on ice did not provide any appreciable return of catalytic activity. As shown in Table 2, wild-type and mutant ␣-amylases exhibit rather different thermostabilities in comparison with each other and in two concentrations of CaCl2 . The apparent transition temperature, T50 (the temperature resulting in 50% loss of enzyme activity), was measured by determination of residual activity of the enzyme after incubation at desired temperatures for 30 min and cooling on ice. All variants of the enzyme revealed higher T50 in the presence of calcium ions. The well-known effect of stabilizing calcium ion on ␣-amylases is more pronounced for the more thermostable enzyme variant (H77E). The half-life (t1/2 ) of an enzyme is the time it takes for the activity to reduce to a half of the original activity. In comparison with wild type BMW-amylase, variant H77E showed 2, 4 and 3 times increased half life (at 60 ◦ C) in the absence and presence of 2 and 5 mM CaCl2 , respectively (Table 2).

3.7. Enzyme inactivation rate study All ␣-amylases, as typical medium-sized multi domain proteins (≈60 kDa), unfold irreversible except for a psychrophilic ␣-amylase from Alteromonas haloplanctis [39]. To characterize and compare the thermostability of the ␣-amylases, the temperature dependence of inactivation rate constants was measured. As shown in Fig. 4, in all measurements a single linear relationship for the logarithmic plot was obtained, suggesting that all unfolding transitions fitted very well in mono-exponential curves. On the other hand, the inactivation rate is clearly decreased and hence, the divalent ion is effective in stabilizing the enzyme. According to the transition state theory, the rate of inactivation observed in the temperature range, yields the activation enthalpy and entropy. Also, linear regression analysis applied to ln (K) versus 1/T (Arrhenius plots, see Fig. 4) yield Ea (slopes of the curves) according to Eq. (1) (see Section 2). A linear behavior in the corresponding Arrhenius plots was observed for all ␣-amylase variants in the absence and presence of two calcium concentrations. Table 2 shows the thermodynamic parameters including activation energy, enthalpy, entropy and Gibbs free energy for inactivation of enzyme variants. The calculated activation energies (Ea ) differ between the given variants; whereas H77E exhibits the highest value of Ea (69.5 kcal/mol) and S76P shows rather similar value

Fig. 4. Arrhenius plots of the denaturation rate constants of BMW-amylase variants in calcium free buffer (a), 2 mM (b) and 5 mM calcium buffer (c). The enzymes; wildtype (), N75D (), S76P (䊉) and H77E (), were prepared in 20 mM Tris/HCl buffer (pH 7.2) and the remaining activity was measured. For more detail refer to Section 2.

around 68.8 kcal/mol in the presence of 5 mM CaCl2 . The results reveal that the H77E mutant has the highest H# and S# at 65 ◦ C. With increasing the calcium concentration, there is an increase in S# (disorder) of transition state (unfolded) relative to the ground-state (folded), except for N75D where the reverse is true. We can conclude that in the presence of CaCl2 thermal stability of wild-type and mutants increases. In addition, the large entropic change observed in the inactivation process is considered to be due to the decrease in ground state entropy of the system in the presence of calcium [40]. The half lives of BMW-amylase and its variants were determined in association with CaCl2 concentration at 60 ◦ C (Fig. 5). By increasing the concentration of CaCl2 , a decreasing in the enzyme inactivation rate was observed in the wild type and all variants. The dependence of half life on CaCl2 concentration is sigmoid, presuming that the shift in the curve reflects a difference in calcium

412

M. Ghollasi et al. / Enzyme and Microbial Technology 53 (2013) 406–413

occur in many characterized EF-hand structures, in the influenza B neuraminidase, a proline coordinates Ca2+ throughout a water molecule [47]. In this way, it is likely that proline could play a role in enhancing the amount of calcium molecules binding to amylase. In summary, we engineered a stable, thermophilic-like variant of an ␣-amylase by only a single amino acid substitution. Fluorescence and far-UV circular dichroism studies showed no important changes in the related spectra of the mutated enzymes compared to wild type. Therefore, the mutations have no significant effect on the secondary and tertiary structure of BMW-amylase. Kinetic measurements showed that calcium concentration had no destructive effect on the kinetics of S76P and H77E mutants in comparison with the wild type, verifying that binding of Ca2+ has parallel effects on activity and stability. Stabilization results showed that tighter calcium binding increases the resistance of the enzyme to thermal denaturation. On the other hand, single amino acid substitutions in the calcium binding sites, improved thermostability by increasing the enzyme affinity for calcium. This study leads to the important conclusion that comparison of primary structure of mesophilic and thermophilic counterparts, even with low sequence similarity, is a useful and reliable way to obtain stable proteins. Fig. 5. Calcium ion titration of the rate of inactivation at 60 ◦ C. Half-life of thermal inactivation of wild-type (◦ ), N75D (), S76P (䊉) and H58I () is plotted as a function of the negative log [Ca2+ ]. The reported half-lives are the average of three independent experiments and the standard errors were ±5%.

affinity. The midpoint of WT curve is ∼3.8 mM. However, the curves for N75D and S76P mutants decreased to ∼3.2 and 2.2 mM respectively, and that of H77E mutant shifted to ∼1.6 mM. In contrast to the wild type enzyme in which the affinity of calcium site is very low and consequently titration effects are insignificant, the affinities of the other mutants, especially H77E mutant, are higher thus the titration effects are noticeable. The stabilizing role of metal ions, particularly calcium is well-documented and involves high affinity or extra Ca2+ binding sites in proteins [41]. In addition, for the first time, Igarashi et al. showed that thermostability of LAMY from Bacillus sp. KSM-1378 was improved by enhanced calcium binding to the enzyme molecule [42]. Several strategies have been proposed in order to increase the enzyme thermostability such as increasing the number of hydrogen bonds and salt bridges, assembling a hydrophobic core, increasing the amount of prolines and shortening of surface loops [43,44]. The high thermostability of mutated enzymes against wild-type enzyme may be the result of the strong effect of calcium ion. The EF-hand motif and its variants (EF-hand-like motif) are the most common calcium-binding motifs found in a large number of protein families and contain the regular conserved DX[D/N]XDG sequence. In the EF-hand like motif, Ca2+ ions coordinated by oxygen atoms of Asp (or Asn) are located in (DX) repeats. Upon the addition of an extra DX unit to the first calcium binding loop, the thermal stability of BMW-amylase was improved due to higher affinity toward calcium [45]. In the case of N75D mutant, it is likely that the Asp residue improved interactions with calcium ions by providing more negative charge and an extra DX unit. As mentioned above, enhancing the affinity of the variants to calcium ion is evident due to the shift in the curves of half life against calcium concentrations. In addition, in H77E, the increased negative charge could play an important role in enhancing the amount of calcium molecules binding to amylase. In the case of S76P, the situation is somehow different. Here, proline residue is introduced in a loop and it is likely that the proline rigidifies the loop by restricting the number of available main chain conformations. Such stabilization by the substitution of Pro residues into loop regions is a welldocumented phenomenon [46]. Although proline residues never

Acknowledgment The authors express their gratitude to the Research Council of Tarbiat Modares University for the financial support during the course of this project. References [1] MacGregor EA, Janecek S, Svensson B. Relationship of sequence and structure to specificity in the ␣-amylase family of enzymes. Biochimica et Biophysca Acta 2001;1546:1–20. [2] Nakajima R, Imanaka T, Aiba S. Comparison of amino acid sequences of eleven different ␣-amylases. Applied Microbiology and Biotechnology 1986;23:355–60. [3] Kuriki T, Imanaka T. The concept of the ␣-amylase family: structural similarity and common catalytic mechanism. Journal of Bioscience and Bioengineering 1999;87:557–65. [4] Janecek S. Close evolutionary relatedness among functionally distantly related members of the (␣/␤)8 -barrel glycosyl hydrolases suggested by similarity of their fifth conserved sequence region. FEBS Letters 1995;377:6–8. [5] Janeˇcek S. Amylolytic enzymes—focus on the alpha-amylases from archaea and plants. Nova Biotechnologica 2009;9:5–25. [6] Janeˇcek S. How many conserved sequence regions are there in the amylase family? Biologia, Bratislava 2002;57(Suppl. 11):29–41. [7] Oslancova A, Janecek S. Oligo-1,6-glucosidase and neopullulanase enzyme subfamilies from the a-amylase family defined by the fifth conserved sequence region. Cellular and Molecular Life Sciences 2002;59:1945–59. [8] Janecek S. ␣-Amylase family: molecular biology and evolution. Progress in Biophysics and Molecular Biology 1997;67:67–97. [9] David MH, Gunther H, Roper H. Catalytic properties of Bacillus megaterium amylase. Starch 1987;39:436–40. [10] Park KH, Kim TJ, Cheong TK, Kim JW, Oh BH, Svensson B. Structure, specificity and function of cyclomaltodextrinase, a multispecific enzyme of the ␣-amylase family. Biochimica Biophysica Acta 2000;1478:165–85. [11] Yazdani M, Naderi-Manesh H, Khajeh K, Soudi MR, Asghari SM, Sharifzadeh M. Isolation and characterization of a novel gamma-radiation-resistant bacterium from hot spring in Iran. Journal of Basic Microbiology 2009;49:119–27. [12] Declerck N, Machius M, Joyet P, Wiegand G, Huber R, Gaillardin C. Hyperthermostabilization of Bacillus licheniformis ␣-amylase and modulation of its stability over a 50 ◦ C temperature range. Protein Engineering 2003;16:287–93. [13] Tan TC, Mijts BN, Swaminathan K, Patel BKC, Divne C. Crystal structure of the polyextremophilic alpha-amylase AmyB from Halothermothrix orenii: details of a productive enzyme-substrate complex and an N domain with a role in binding raw starch. Journal of Molecular Biology 2008;378:850–68. [14] Tan TC, Yien YY, Patel BKC, Mijts BN, Swaminathan K. Crystallization of a novel ␣-amylase, AmyB, from the thermophilic halophile Halothermothrix orenii. ACTA Crystallographica 2003;D59:2257–8. [15] Sivakumar N, Li N, Tang JW, Patel BKC, Swaminathan K. Crystal structure of AmyA lacks acidic surface and provide insights into protein stability at polyextreme condition. FEBS Letters 2006;580:2646–52. [16] Liu Y, Shen W, Shi GY, Wang ZX. Role of the calcium-binding residues Asp231, Asp233, and Asp438 in Alpha-Amylase of Bacillus amyloliquefaciens as revealed by mutational analysis. Current Microbiology 2010;60:162–6.

M. Ghollasi et al. / Enzyme and Microbial Technology 53 (2013) 406–413 [17] Lee S, Mouri Y, Minoda M, Oneda H, Inouye K. Comparison of the wild-type alpha-amylase and its variant enzymes in Bacillus amyloliquefaciens in activity and thermal stability, and insights into engineering the thermal stability of Bacillus alpha-amylase. Journal of Biochemistry 2006;139:1007–15. [18] Majzlova K, Pukajova Z, Janecek S. Tracing the evolution of the ␣amylase subfamily GH13 36 covering the amylolytic enzymes intermediate between oligo-1,6-glucosidases and neopullulanases. Carbohydrate Research 2013;367:48–57. [19] Lumry R, Eyring H. Conformational changes of proteins. Journal of Physical Chemistry 1954;58:110–20. [20] Sambrook J, Russell DW. Molecular cloning: a laboratory manual. 3rd ed. New York: Cold Spring Harbor; 2001. [21] Owen RJ, Borman P. A rapid biochemical method for purifying high molecular weight bacterial chromosomal DNA for restriction enzyme analysis. Nucleic Acids Research 1987;15:3631–2. [22] Ghollasi M, Khajeh K, Naderi-Manesh H, Ghasemi A. Engineering of a bacillus ␣-amylase with improved thermostability and calcium independency. Applied Biochemistry and Biotechnology 2010;162:444–59. [23] Fisher CL, Pei GK. Modification of a PCR-based site-directed mutagenesis method. BioTechniques 1997;23:570–4. [24] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 1976;72:248–54. [25] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680–5. [26] Miller GL. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Analytical Chemistry 1959;31:426–8. [27] Ahmadi A. Purification of ␣-amylase from Bacillus sp. GHA1 and its partial characterization. Journal of the Iranian Chemical Society 2010;7:432–40. [28] Arrhenius S. Über die Reaktionsgeschwindigkeit bei der Inversion von Rohrzucker durch Säuren. Zeitschrift Fur Physikalische Chemie 1889;4:226–48. [29] Mijts BN, Patel BKC. Cloning, sequencing and expression of an ␣-amylase gene, amyA, from the thermophilic halophile Halothermothrix orenii and purification and characterization of the recombinant enzyme. Microbiology 2002;148:2343–9. [30] Bloemendal M, Johnson Jr WC. Structural information on proteins from CD spectroscopy: possibilities and limitations. In: Herron JN, Jiskoot W, Crommelin DJA, editors. Physical methods to characterize pharmaceutical proteins. New York: Plenum Press; 1995. p. 65–100. [31] Lin LL, Huang CC, Lo HF. Impact of Arg210-Ser211 deletion on thermostability of a truncated Bacillus sp. strain TS-23 ␣-amylase. Process Biochemistry 2008;43:559–65. [32] Danson MJ, Hough DW, Russell RJ, Taylor GL, Pearl L. Enzyme thermostability and thermoactivity. Protein Engineering 1996;9:629–30. [33] Laidler KJ. Influence of ionic strength. In: Chemical Kinetics. 3rd ed. New York: Harper Collins Publisher; 1987. p. 197–201.

413

[34] Takase K. Effect of mutation of an amino acid residue near the catalytic site on the activity of Bacillus stearothermophilus ␣-amylase. European Journal of Biochemistry 1993;211:899–902. [35] Collins T, Meuwis MA, Gerday C, Feller G. Activity, stability and flexibility in glycosidase adapted to extreme thermal environments. Journal of Molecular Biology 2003;328:419–28. [36] Dunitz JD. The entropic cost of bound water in crystals and biomolecules. Science 1994;264:670. [37] Tanaka A, Hoshino E. Secondary calcium-binding parameter of bacillus amyloliquefaciens ␣-amylase obtained from inhibition kinetics. Journal of Bioscience and Bioengineering 2003;96:262–7. [38] Tanaka A, Hoshino E. Calcium-binding parameter of Bacillus amyloliquefaciens alpha-amylase determined by inactivation kinetics. Biochemistry Journal 2002;364:635–9. [39] Feller G, D’Amico D, Gerday C. Thermodynamic stability of a cold-active ␣amylase from the antarctic bacterium alteromonas haloplanctis. Biochemistry Journal 1999;38:4613–9. [40] Vieille C, Zeikus JG. Thermozymes: identifying molecular determinants of protein structural and functional stability. Trends in Biotechnology 1996;14:183–90. [41] Mitani M, Harushima Y, Kuwajima K, Ikeguchi M, Sugai S. Innocuous character of [ethylenebis (oxyethylenenitrilo)] tetraacetic acid and EDTA as metal-ion buffers in studying Ca2+ binding by ␣-lactalbumin. Journal of Biological Chemistry 1986;261:8824–9. [42] Igarashi K, Hatada Y, Ikawa K, Araki H, Ozawa T, Kobayashi T, Ozaki K, Ito S. Improved thermostability of a Bacillus ␣-amylase by deletion of an arginineglycine residue is caused by enhanced calcium binding. Biochemical and Biophysical Research Communications 1998;248:372–7. [43] Ohnishi H, Sakai H, Nosoh Y, Sekiguchi T. Protein engineering for thermostability. Trends in Biotechnology 1996;19:16–20. [44] Jaenicke R, Schurig H, Beaucamp N, Ostendorp R. Structure and stability of hyperstable proteins: glycolytic enzymes from hyperthermophilic bacterium Thermotoga maritime. Advances in Protein Chemistry 1996;48: 181–269. [45] Sadeghi L, Khajeh K, Mollania N, Dabirmanesh B, Ranjbar B. Extra EF Hand Unit (DX) mediated stabilization and calcium independency of ␣-amylase. Molecular Biotechnology 2013;53:270–7. [46] Watanabe K, Masuda T, Ohashi H, Mihara H, Suzuki Y. Multiple proline substitutions cumulately thermostabilize Bacillus cerues ATCC7064 oligo-1,6glucosidae: Irrefragable proof supporting the proline rule. European Journal of Biochemistry 1994;226:277–83. [47] Burmeister WP, Ruigrok RW, Cusack S. The 2.2 A˚ resolution crystal structure of influenza B neuraminidase and its complex with sialic acid. EMBO Journal 1992;11:49–56.