- Email: [email protected]
Improving phenylketonuria genotyping by screening for the IVS4 + 5g > t mutation in the PAH gene
Clinica Chimica Acta 402 (2009) 206–208
Contents lists available at ScienceDirect
Clinica Chimica Acta j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / c l i n c h i m
Letter to the Editor Improving phenylketonuria genotyping by screening for the IVS4 + 5g > t mutation in the PAH gene Dear Editor, PKU is the most common inborn error of amino acid metabolism and has been studied worldwide. Until now, about 500 different mutations have been described in the PAH gene (OMIM 261600) (www.pahdb.mcgill.ca). The PAH locus also contains a number of neutral polymorphisms useful to define haplotypes. These polymorphic haplotypes associated with specific PKU mutations, have been helpful in studying populations genetics and determining the origin of PAH mutations [1–4]. Due to this high genetic heterogeneity, most laboratories use gene scanning procedure such as DGGE to analyze the PAH gene. Although this system was published in 1993, it continuous being using in many countries reporting high detection rates between 90 and 100% [5–7]. However, in Venezuela the PKU detection rate using DGGE is low around 86% (with 6 unidentified alleles out of 43). Although DGGE is a highly sensitive and simple technique for mutation detection, this method has been applied only for studying exons and splice junctions in PAH gene, but not for regulatory and deep intronic regions [8]. In order to increase the detection rate in Venezuela, we designed a new pair of primers for analyzing part of introns 3 and 4 in our PKU patients and we found the IVS4 + 5g N t mutation. The aim of this manuscript is to describe the high frequency of this mutation in the Venezuelan PKU patients. These observations extend the knowledge about spectrum of PKU mutations in Venezuela and it can be applied in other countries historically related to Venezuela for improving PKU detection rate. Five PKU patients (9 independent alleles) coming from different families were studied. They were referred to the UDEIM-IDEA for newborn or selective metabolic screening. From each patient and their relatives, genomic DNA was extracted from whole blood samples with EDTA according to the protocol described by Lahiri et al. [9]. Samples were subjected to DGGE for studying the whole coding region and
splice junctions of the PAH gene in a single gel, according to the modification made by Guldberg et al. [8]. Electrophoresis was carried out in a DCode Universal Mutation Detection System (Bio-Rad, Hercules, CA). The fragments with mobility shifts in the DGGE were directly sequenced by PCR in both directions. After that, a new pair of primers was designed for sequencing part of intron 3, exon 4 and intron 4 [Fig. 1]. Primer A (forward: 5'GGGATCCCCACTTCTGATCT3') is located on intron 3 at position −65 from exon 4 and primer B (reverse: 5'TAAGAGGAAGGGAGGGGAGT3') is located on intron 4, +48 nucleotide after the 3' end of exon 4. Sequencing were performed on an ABI PRISM 377 DNA sequencer (Perkin-Elmer, Applied Biosystems, Foster, CA). Detected mutations were always confirmed by sequencing of a new PCR product; moreover, the presence of mutations was confirmed by analyzing the parents. Five single nucleotide polymorphisms (SNP) were analyzed by means of PCR-RFLP assays, namely BglII [10], PvuII(a) [11], PvuII(b), MspI [12], and XmnI [13]. Intragenic VNTR system was analyzed according to Goltsov et al. [3]. Haplotypes were assigned according to the nomenclature suggested by Eisensmith et al. [4]. Nine independent alleles from 5 PKU patients and their parents were studied by DGGE and sequencing. We only characterized 3 out of 9 alleles with these techniques (Table 1). p.S349L (c.1046C N T), p.V388M (c.1162G NA), and p.R408W (c.1222C N T) mutations were found in heterozygous state in patients 1, 2, and 5, respectively. This low detection rate led us to analyze other regions from the PAH gene. Exon–intron junction from exon 4 is the only region that was not analyzed by DGGE, because the reverse primer anneals close to the end of this exon, as illustrated in the Fig. 1. Therefore, using new primers A and B, we analyzed by sequencing exon–intron junction from exon 4. The mutation was found in 4 patients (Table 1) 2 patients homozygous and the other 2 heterozygous. Additionally, the presence of IVS4 + 5g N t mutation was confirmed by analyzing the parents, and in two cases a sibling was also analyzed. Parents from patient 3 both with IVS4 + 5g N t in heterozygous state have surname isonymy, but they do not know if they are relatives. In
Fig. 1. PAH gene scheme showing introns 3 and 4, and exon 4. Primers A and B are new primers designed for analyzing this region. Highlighted nucleotide (boxed) in the DGGE reverse primer, correspond to nucleotide + 5 (g) from intron 4. This nucleotide is affected in the IVS4 + 5g N t mutation. 0009-8981/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.cca.2008.10.029
Letter to the Editor Table 1 Venezuelan PKU patients with the IVS4 + 5g N t mutation Patient
Genotype
Haplotype
Venezuelan regiona
1
IVS4 + 5g N t p.S349L p.S349L N IVS4 + 5g N t N N N IVS4 + 5g N t p.V388M p.V388M N IVS4 + 5g N t N IVS4 + 5g N t IVS4 + 5g N t IVS4 + 5g N t N IVS4 + 5g N t N IVS4 + 5g N t IVS4 + 5g N t IVS4 + 5g N t N IVS4 + 5g N t N p.R408W ? ? N p.R408W N p.R408W N
5.8 ó 6.8 6.7 6.7 1.7 5.8 ó 6.8 4.3 ? ? 5.8 ó 6.8 1.7 1.7 12.12 5.8 ó 6.8 4.3 5.8 ó 6.8 5.8 ó 6.8 5.8 ó 6.8 5.9 ó 6.9 5.8 ó 6.8 5.7 ó 6.7 5.8 ó 6.8 5.8 ó 6.8 5.8 ó 6.8 5.3 ó 6.3 5.8 ó 6.8 12.12 2.3 1.8 1.8 15.8 2.3 8.8 2.3 15.8
Central
M1 F1 S1 2 M2 F2 3 M3 F3 4 M4 F4 5 M5 F5 S5
Central East Central Centralb Central West (The Andes) West (The Andes)c West (The Andes) West (The Andes) West (The Andes)d West (The Andes) West (The Andes) East Easte East East
M: mother; F: father; S: sibling; ?: unidentified; N: normal. a Region of Venezuela where the family come from. b Spanish ancestor on fourth maternal generation. c Parents have surname isonymy. d Parents are distance relatives. e Spanish and French ancestors on fourth maternal generation.
the case of patient 4, these alleles were accounted for one allele because their parents are distant relatives. In conclusion, we found IVS4 + 5g N t mutation in 5 out of the 6 remaining unidentified alleles; representing 11.6% of all Venezuelan PKU alleles (43 alleles), and the third most frequent mutation in Venezuela. Additionally, PAH mutation-haplotype association was confirmed by RFLP analysis. Combined SNP and VNTR haplotypes were determined for all families (Table 1) finding that IVS4 + 5g N t was associated with haplotypes 5.8 or 6.8. We could not distinguish between these 2 haplotypes because EcoRV restriction site, which require analysis by Southern blotting, was not analyzed. Until now, all detected mutations in the Venezuelan population had already been described in European populations except for p.S349L and p.P314 N Lfs (c.940delC), which has only been detected in Venezuela [14] and IVS4+ 5gN t described in Israel [15], US [16], Germany, Poland, Kuwait, Yugoslavia, and Turkey (www.pahdb.mcgill.ca). The detected mutations reflect the genetic origin of the Venezuelan population, characterized by a high number of immigrants coming from Spain. Consequently, the most frequently mutation is IVS10-11gN a for both Venezuelan and Spain populations [17]. The IVS4 + 5g N t mutation has been detected in 8 alleles in Germany, Poland, Kuwait, Yugoslavia, and Turkey. It has been associated to a severe phenotype when it is found in homozygosis (www.pahdb.mcgill.ca). Recently, Dobrowolski et al. [15] reported IVS4 + 5g N t in 2 out of 190 alleles in the US, using a new method based upon thermal melt profiles. Also, Bercovich et al. [17] described 19 IVS4 + 5g N t PKU alleles in Israel by using PCR and denaturing HPLC.
207
We detected the IVS4 + 5g N t mutation in 5 alleles in Venezuela, which improved the detection rate from 86% to 97.7% with only one allele unidentified. However, the detection efficiency using DGGE described here (86%) is similar to other studies done in Northern France (86%), Spain (89%), and lower than in other reports from Germany (98%) and Sicily (91%) [5]. The DGGE technique, described by Gulberg et al. [8], is still used for PAH mutation analysis in many laboratories in the world. However, the primers to assess the 4th exon and flanking sequence impede to identify those mutations that impact mRNA processing such as IVS4 + 5g N t. As a result, we suggest use of a different primer set for analyzing this region. Additionally, this mutation can be analyzed by sequencing or restriction analysis with PleI enzyme after amplification of this region with the appropriate primers. Consequently, we infer from these results that IVS4 + 5g N t screening could improve PKU mutation detection rate, in those related countries where genetic diagnosis is incomplete like Spain, Portugal, Italy and some Latin American countries. Regarding to mutation-haplotype association, there is only one report from Germany where IVS4 + 5g N t was found associated with the 1.8 haplotype (www.pahdb.mcgill.ca). In Venezuela, this mutation has been detected on the background of 5.8 or 6.8 haplotypes. We could not differentiate between 5 and 6 haplotypes but it would be a unique haplotype and VNTR. The ethnic background in Venezuelan families with the IVS4 + 5g N t mutation revealed not known European ancestors back to four generations, which could suggest its independent origin. Also, it is almost sure to infer that they could have one common distance ancestor; since most of these alleles come from a small town on the west of Venezuelan country in the Andes region. On the other hand, majority of the Venezuelan PKU mutations have the same haplotype association than in the European populations, suggesting a founder effect in specific European regions and subsequent expansion to Latin America. In all these cases, genealogical data from these patients further support this idea [14]. In Venezuelan patients, European ancestors are mainly from Spain, therefore, we cannot rule out this origin without any further information. Consequently, the origin of the IVS4 + 5g N t mutation remains unclear. Acknowledgements The authors thank Leny Sua, Graciela Neira, and Gabriela Maldonado from the IDEA for detecting Phenylalanine levels and to Drs. Marines Longart, Juan Carlos Martínez, and Gustavo Benaim for the critical reading of the manuscript, and Yemilet Ceballos for the technical assistance. References [1] DiLella A, Kwok S, Ledley F, Marvit J, Woo S. Molecular structure and polymorphic map of the human phenylalanine hydroxylase gene. Biochemistry 1986;25:749–53. [2] Woo S. Collation of RFLP haplotypes at the human phenylalanine hydroxylase (PAH) locus. Am J Hum Genet 1988;43:781–3. [3] Goltsov AA, Eisensmith RC, Konecki DS, Lichter-Konecki U, Woo SL. Associations between mutations and a VNTR in the human phenylalanine hydroxylase gene. Am J Hum Genet 1992;51:627–36. [4] Eisensmith R, Woo S. Updated listing of haplotypes at the human phenylalanine hydroxylase (PAH) locus. Am J Hum Genet 1992;51:1445–8. [5] Zschocke J. Phenylketonuria mutations in Europe. Human Mutat 2003;21:345–56. [6] Desviat LR, Pérez B, Gutierrez E, Sánchez A, Barrios B, Ugarte M. Molecular basis of phenylketonuria in Cuba. Hum Mutat 2001;18:252. [7] Acosta A, Silva Jr W, Carvalho T, Gomes M, Zago M. Mutations of the phenylalanine hydroxylase (PAH) gene in Brazilian patients with phenylketonuria. (91%). Hum Mutat 2001;17:122–30. [8] Guldberg P, Güttler F. A simple method for identification of point mutations using denaturing gradient gel electrophoresis. Nucleic Acids Res 1993;21:2261–2. [9] Lahiri D, Nurnberger J. A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Research 1991;19:5444–5.
208
Letter to the Editor
[10] Dworniczak B, Wedemeyer N, Horst J. PCR detection of the BglII RFLP at the human phenylalanine hydroxylase (PAH) locus. Nucleic Acids Res 1991;19:1958. [11] Iyengar S, Seaman M, Deinard AS, et al. Analyses of cross-species polymerase chain reaction products to infer the ancestral state of human polymorphisms. DNA Sequence 1998;8:317–27. [12] Wedemeyer N, Dworniczak B, Horst J. PCR detection of the MspI (Aa) RFLP at the human phenylalanine hydroxylase (PAH) locus. Nucleic Acids Res 1991;19: 1959. [13] Goltsov AA, Woo SL. Detection of the XmnI RFLP at the human phenylalanine hydroxylase locus by PCR.; 1992. Genbank accession number Z11537. [14] De Lucca M, Pérez B, Desviat LR, Ugarte M. Molecular basis of phenylketonuria in Venezuela: presence of two novel null mutations. Human Mutat 1998;11: 354–9. [15] Dobrowolski SF, Ellingson C, Coyne T, et al. Mutations in the phenylalanine hydroxylase gene identified in 95 patients with phenylketonuria using novel systems of mutation scanning and specific genotyping based upon thermal melt profiles. Mol Genet Metab 2007;91:218–27. [16] Desviat LR, Pérez B, Gámez A, et al. Genetic and phenotypic aspects of phenylalanine hydroxylase deficiency in Spain: molecular survey by regions. Eur J Hum Genet 1999;7:386–92. [17] Bercovich D, Elimelech A, Zlotogora J, et al. Genotype–phenotype correlations analysis of mutations in the phenylalanine hydroxylase (PAH) gene. J Hum Genet 2008;53:407–18.
Marisel De Lucca⁎ Isabel Arias Liliana Casique Katiuska Araujo Rosa María Merzon Fundación Instituto de Estudios Avanzados (IDEA), Unidad de Estudio de Errores Innatos del Metabolismo (UDEIM), Caracas, Venezuela ⁎Corresponding author. Unidad de Estudio de Errores Innatos del Metabolismo, Centro de Biociencias y Medicina Molecular, Instituto de Estudios Avanzados, Carretera Nacional Hoyo de la Puerta, Valle de Sartenejas, Baruta, Edo. Miranda, Venezuela. Tel.: +58 212 9035127; fax: +58 212 9035118. E-mail address: [email protected] (De Lucca). 26 September 2008
Contents lists available at ScienceDirect
Clinica Chimica Acta j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / c l i n c h i m
Letter to the Editor Improving phenylketonuria genotyping by screening for the IVS4 + 5g > t mutation in the PAH gene Dear Editor, PKU is the most common inborn error of amino acid metabolism and has been studied worldwide. Until now, about 500 different mutations have been described in the PAH gene (OMIM 261600) (www.pahdb.mcgill.ca). The PAH locus also contains a number of neutral polymorphisms useful to define haplotypes. These polymorphic haplotypes associated with specific PKU mutations, have been helpful in studying populations genetics and determining the origin of PAH mutations [1–4]. Due to this high genetic heterogeneity, most laboratories use gene scanning procedure such as DGGE to analyze the PAH gene. Although this system was published in 1993, it continuous being using in many countries reporting high detection rates between 90 and 100% [5–7]. However, in Venezuela the PKU detection rate using DGGE is low around 86% (with 6 unidentified alleles out of 43). Although DGGE is a highly sensitive and simple technique for mutation detection, this method has been applied only for studying exons and splice junctions in PAH gene, but not for regulatory and deep intronic regions [8]. In order to increase the detection rate in Venezuela, we designed a new pair of primers for analyzing part of introns 3 and 4 in our PKU patients and we found the IVS4 + 5g N t mutation. The aim of this manuscript is to describe the high frequency of this mutation in the Venezuelan PKU patients. These observations extend the knowledge about spectrum of PKU mutations in Venezuela and it can be applied in other countries historically related to Venezuela for improving PKU detection rate. Five PKU patients (9 independent alleles) coming from different families were studied. They were referred to the UDEIM-IDEA for newborn or selective metabolic screening. From each patient and their relatives, genomic DNA was extracted from whole blood samples with EDTA according to the protocol described by Lahiri et al. [9]. Samples were subjected to DGGE for studying the whole coding region and
splice junctions of the PAH gene in a single gel, according to the modification made by Guldberg et al. [8]. Electrophoresis was carried out in a DCode Universal Mutation Detection System (Bio-Rad, Hercules, CA). The fragments with mobility shifts in the DGGE were directly sequenced by PCR in both directions. After that, a new pair of primers was designed for sequencing part of intron 3, exon 4 and intron 4 [Fig. 1]. Primer A (forward: 5'GGGATCCCCACTTCTGATCT3') is located on intron 3 at position −65 from exon 4 and primer B (reverse: 5'TAAGAGGAAGGGAGGGGAGT3') is located on intron 4, +48 nucleotide after the 3' end of exon 4. Sequencing were performed on an ABI PRISM 377 DNA sequencer (Perkin-Elmer, Applied Biosystems, Foster, CA). Detected mutations were always confirmed by sequencing of a new PCR product; moreover, the presence of mutations was confirmed by analyzing the parents. Five single nucleotide polymorphisms (SNP) were analyzed by means of PCR-RFLP assays, namely BglII [10], PvuII(a) [11], PvuII(b), MspI [12], and XmnI [13]. Intragenic VNTR system was analyzed according to Goltsov et al. [3]. Haplotypes were assigned according to the nomenclature suggested by Eisensmith et al. [4]. Nine independent alleles from 5 PKU patients and their parents were studied by DGGE and sequencing. We only characterized 3 out of 9 alleles with these techniques (Table 1). p.S349L (c.1046C N T), p.V388M (c.1162G NA), and p.R408W (c.1222C N T) mutations were found in heterozygous state in patients 1, 2, and 5, respectively. This low detection rate led us to analyze other regions from the PAH gene. Exon–intron junction from exon 4 is the only region that was not analyzed by DGGE, because the reverse primer anneals close to the end of this exon, as illustrated in the Fig. 1. Therefore, using new primers A and B, we analyzed by sequencing exon–intron junction from exon 4. The mutation was found in 4 patients (Table 1) 2 patients homozygous and the other 2 heterozygous. Additionally, the presence of IVS4 + 5g N t mutation was confirmed by analyzing the parents, and in two cases a sibling was also analyzed. Parents from patient 3 both with IVS4 + 5g N t in heterozygous state have surname isonymy, but they do not know if they are relatives. In
Fig. 1. PAH gene scheme showing introns 3 and 4, and exon 4. Primers A and B are new primers designed for analyzing this region. Highlighted nucleotide (boxed) in the DGGE reverse primer, correspond to nucleotide + 5 (g) from intron 4. This nucleotide is affected in the IVS4 + 5g N t mutation. 0009-8981/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.cca.2008.10.029
Letter to the Editor Table 1 Venezuelan PKU patients with the IVS4 + 5g N t mutation Patient
Genotype
Haplotype
Venezuelan regiona
1
IVS4 + 5g N t p.S349L p.S349L N IVS4 + 5g N t N N N IVS4 + 5g N t p.V388M p.V388M N IVS4 + 5g N t N IVS4 + 5g N t IVS4 + 5g N t IVS4 + 5g N t N IVS4 + 5g N t N IVS4 + 5g N t IVS4 + 5g N t IVS4 + 5g N t N IVS4 + 5g N t N p.R408W ? ? N p.R408W N p.R408W N
5.8 ó 6.8 6.7 6.7 1.7 5.8 ó 6.8 4.3 ? ? 5.8 ó 6.8 1.7 1.7 12.12 5.8 ó 6.8 4.3 5.8 ó 6.8 5.8 ó 6.8 5.8 ó 6.8 5.9 ó 6.9 5.8 ó 6.8 5.7 ó 6.7 5.8 ó 6.8 5.8 ó 6.8 5.8 ó 6.8 5.3 ó 6.3 5.8 ó 6.8 12.12 2.3 1.8 1.8 15.8 2.3 8.8 2.3 15.8
Central
M1 F1 S1 2 M2 F2 3 M3 F3 4 M4 F4 5 M5 F5 S5
Central East Central Centralb Central West (The Andes) West (The Andes)c West (The Andes) West (The Andes) West (The Andes)d West (The Andes) West (The Andes) East Easte East East
M: mother; F: father; S: sibling; ?: unidentified; N: normal. a Region of Venezuela where the family come from. b Spanish ancestor on fourth maternal generation. c Parents have surname isonymy. d Parents are distance relatives. e Spanish and French ancestors on fourth maternal generation.
the case of patient 4, these alleles were accounted for one allele because their parents are distant relatives. In conclusion, we found IVS4 + 5g N t mutation in 5 out of the 6 remaining unidentified alleles; representing 11.6% of all Venezuelan PKU alleles (43 alleles), and the third most frequent mutation in Venezuela. Additionally, PAH mutation-haplotype association was confirmed by RFLP analysis. Combined SNP and VNTR haplotypes were determined for all families (Table 1) finding that IVS4 + 5g N t was associated with haplotypes 5.8 or 6.8. We could not distinguish between these 2 haplotypes because EcoRV restriction site, which require analysis by Southern blotting, was not analyzed. Until now, all detected mutations in the Venezuelan population had already been described in European populations except for p.S349L and p.P314 N Lfs (c.940delC), which has only been detected in Venezuela [14] and IVS4+ 5gN t described in Israel [15], US [16], Germany, Poland, Kuwait, Yugoslavia, and Turkey (www.pahdb.mcgill.ca). The detected mutations reflect the genetic origin of the Venezuelan population, characterized by a high number of immigrants coming from Spain. Consequently, the most frequently mutation is IVS10-11gN a for both Venezuelan and Spain populations [17]. The IVS4 + 5g N t mutation has been detected in 8 alleles in Germany, Poland, Kuwait, Yugoslavia, and Turkey. It has been associated to a severe phenotype when it is found in homozygosis (www.pahdb.mcgill.ca). Recently, Dobrowolski et al. [15] reported IVS4 + 5g N t in 2 out of 190 alleles in the US, using a new method based upon thermal melt profiles. Also, Bercovich et al. [17] described 19 IVS4 + 5g N t PKU alleles in Israel by using PCR and denaturing HPLC.
207
We detected the IVS4 + 5g N t mutation in 5 alleles in Venezuela, which improved the detection rate from 86% to 97.7% with only one allele unidentified. However, the detection efficiency using DGGE described here (86%) is similar to other studies done in Northern France (86%), Spain (89%), and lower than in other reports from Germany (98%) and Sicily (91%) [5]. The DGGE technique, described by Gulberg et al. [8], is still used for PAH mutation analysis in many laboratories in the world. However, the primers to assess the 4th exon and flanking sequence impede to identify those mutations that impact mRNA processing such as IVS4 + 5g N t. As a result, we suggest use of a different primer set for analyzing this region. Additionally, this mutation can be analyzed by sequencing or restriction analysis with PleI enzyme after amplification of this region with the appropriate primers. Consequently, we infer from these results that IVS4 + 5g N t screening could improve PKU mutation detection rate, in those related countries where genetic diagnosis is incomplete like Spain, Portugal, Italy and some Latin American countries. Regarding to mutation-haplotype association, there is only one report from Germany where IVS4 + 5g N t was found associated with the 1.8 haplotype (www.pahdb.mcgill.ca). In Venezuela, this mutation has been detected on the background of 5.8 or 6.8 haplotypes. We could not differentiate between 5 and 6 haplotypes but it would be a unique haplotype and VNTR. The ethnic background in Venezuelan families with the IVS4 + 5g N t mutation revealed not known European ancestors back to four generations, which could suggest its independent origin. Also, it is almost sure to infer that they could have one common distance ancestor; since most of these alleles come from a small town on the west of Venezuelan country in the Andes region. On the other hand, majority of the Venezuelan PKU mutations have the same haplotype association than in the European populations, suggesting a founder effect in specific European regions and subsequent expansion to Latin America. In all these cases, genealogical data from these patients further support this idea [14]. In Venezuelan patients, European ancestors are mainly from Spain, therefore, we cannot rule out this origin without any further information. Consequently, the origin of the IVS4 + 5g N t mutation remains unclear. Acknowledgements The authors thank Leny Sua, Graciela Neira, and Gabriela Maldonado from the IDEA for detecting Phenylalanine levels and to Drs. Marines Longart, Juan Carlos Martínez, and Gustavo Benaim for the critical reading of the manuscript, and Yemilet Ceballos for the technical assistance. References [1] DiLella A, Kwok S, Ledley F, Marvit J, Woo S. Molecular structure and polymorphic map of the human phenylalanine hydroxylase gene. Biochemistry 1986;25:749–53. [2] Woo S. Collation of RFLP haplotypes at the human phenylalanine hydroxylase (PAH) locus. Am J Hum Genet 1988;43:781–3. [3] Goltsov AA, Eisensmith RC, Konecki DS, Lichter-Konecki U, Woo SL. Associations between mutations and a VNTR in the human phenylalanine hydroxylase gene. Am J Hum Genet 1992;51:627–36. [4] Eisensmith R, Woo S. Updated listing of haplotypes at the human phenylalanine hydroxylase (PAH) locus. Am J Hum Genet 1992;51:1445–8. [5] Zschocke J. Phenylketonuria mutations in Europe. Human Mutat 2003;21:345–56. [6] Desviat LR, Pérez B, Gutierrez E, Sánchez A, Barrios B, Ugarte M. Molecular basis of phenylketonuria in Cuba. Hum Mutat 2001;18:252. [7] Acosta A, Silva Jr W, Carvalho T, Gomes M, Zago M. Mutations of the phenylalanine hydroxylase (PAH) gene in Brazilian patients with phenylketonuria. (91%). Hum Mutat 2001;17:122–30. [8] Guldberg P, Güttler F. A simple method for identification of point mutations using denaturing gradient gel electrophoresis. Nucleic Acids Res 1993;21:2261–2. [9] Lahiri D, Nurnberger J. A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Research 1991;19:5444–5.
208
Letter to the Editor
[10] Dworniczak B, Wedemeyer N, Horst J. PCR detection of the BglII RFLP at the human phenylalanine hydroxylase (PAH) locus. Nucleic Acids Res 1991;19:1958. [11] Iyengar S, Seaman M, Deinard AS, et al. Analyses of cross-species polymerase chain reaction products to infer the ancestral state of human polymorphisms. DNA Sequence 1998;8:317–27. [12] Wedemeyer N, Dworniczak B, Horst J. PCR detection of the MspI (Aa) RFLP at the human phenylalanine hydroxylase (PAH) locus. Nucleic Acids Res 1991;19: 1959. [13] Goltsov AA, Woo SL. Detection of the XmnI RFLP at the human phenylalanine hydroxylase locus by PCR.; 1992. Genbank accession number Z11537. [14] De Lucca M, Pérez B, Desviat LR, Ugarte M. Molecular basis of phenylketonuria in Venezuela: presence of two novel null mutations. Human Mutat 1998;11: 354–9. [15] Dobrowolski SF, Ellingson C, Coyne T, et al. Mutations in the phenylalanine hydroxylase gene identified in 95 patients with phenylketonuria using novel systems of mutation scanning and specific genotyping based upon thermal melt profiles. Mol Genet Metab 2007;91:218–27. [16] Desviat LR, Pérez B, Gámez A, et al. Genetic and phenotypic aspects of phenylalanine hydroxylase deficiency in Spain: molecular survey by regions. Eur J Hum Genet 1999;7:386–92. [17] Bercovich D, Elimelech A, Zlotogora J, et al. Genotype–phenotype correlations analysis of mutations in the phenylalanine hydroxylase (PAH) gene. J Hum Genet 2008;53:407–18.
Marisel De Lucca⁎ Isabel Arias Liliana Casique Katiuska Araujo Rosa María Merzon Fundación Instituto de Estudios Avanzados (IDEA), Unidad de Estudio de Errores Innatos del Metabolismo (UDEIM), Caracas, Venezuela ⁎Corresponding author. Unidad de Estudio de Errores Innatos del Metabolismo, Centro de Biociencias y Medicina Molecular, Instituto de Estudios Avanzados, Carretera Nacional Hoyo de la Puerta, Valle de Sartenejas, Baruta, Edo. Miranda, Venezuela. Tel.: +58 212 9035127; fax: +58 212 9035118. E-mail address: [email protected] (De Lucca). 26 September 2008