Improving the efficiency for generation of genome-edited zebrafish by labeling primordial germ cells

G Model

ARTICLE IN PRESS

BC 4420 1–6

The International Journal of Biochemistry & Cell Biology xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

The International Journal of Biochemistry & Cell Biology journal homepage: www.elsevier.com/locate/biocel

Short communication

1

Improving the efficiency for generation of genome-edited zebrafish by labeling primordial germ cells

2

3

4 5

Q1

Zhangji Dong, Xiaohua Dong, Wenshang Jia, Shasha Cao, Qingshun Zhao ∗ MOE Key Laboratory of Model Animal for Disease Study, Model Animal Research Center, Nanjing University, Nanjing 210061, China

6

7 21

a r t i c l e

i n f o

a b s t r a c t

8 9 10 11 12 13

Article history: Received 20 May 2014 Received in revised form 14 August 2014 Accepted 27 August 2014 Available online xxx

14

20

Keywords: Zebrafish Gene targeting Homologous recombination CRISPR/Cas9 Germline transmission

22

1. Introduction

15 16 17 18 19

23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41

Although CRISPR/Cas, a new versatile genome-editing tool, has been widely used in a variety of species including zebrafish, an important vertebrate model animal for biomedical research, the low efficiency of germline transmission of induced mutations and particularly knockin alleles made subsequently screening heritable offspring tedious, time-consuming, expensive and at times impossible. In this study, we reported a method for improving the efficiency of germline transmission screening for generation of genome-edited zebrafish mutants. Co-microinjecting yfp-nanos3 mRNA with Cas9 mRNA, sgRNA and single strand DNA donor to label the distribution of microinjected nucleotides in PGCs (primordial germ cells), we demonstrated that founders carrying labeled PGCs produced much higher numbers of knockin and knockout progeny. In comparison with the common practice of selecting founders by genotyping fin clips, our new strategy of selecting founders with tentatively fluorescent-labeled PGCs significantly increase the ease and speed of generating heritable knocking and knockout animals with CRISPR/Cas9. © 2014 Published by Elsevier Ltd.

Gene targeting, a genetic technique that uses homologous recombination (HR) to modify an endogenous gene, is a powerful tool to uncover gene functions. Traditionally, it relies on cultured embryonic stem cells (ESCs). However, the lack of ESCs in animals other than mouse and rat (Jacob et al., 2010) and very low frequency of HR (about 1 × 10−6 ) between an artificial donor and its genomic recipient in ESCs have become the bottle neck of the technology, preventing from its application to other animals (Johnson and Jasin, 2001). The frequency of HR occurring nearby double strand breaks (DSB) is significantly increased (Johnson and Jasin, 2001). Therefore, increasing DSB would improve the efficiency of gene targeting. CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9), a newly established engineered endonuclease (EEN) (Cong et al., 2013; Mali et al., 2013), has been demonstrated to create genome-edited animals independent of ESCs by generating DSB with high efficiency in a variety of animals. It has been used to produce not only knockout animals including zebrafish (Hruscha et al., 2013; Hwang et al., 2013), mouse (Li et al., 2013; Mashiko et al., 2013; Sung et al., 2014;

∗ Corresponding author at: Model Animal Research Center, Nanjing University, 12 Xuefu Road, Pukou High-tech Development Zone, Nanjing 210061, China. Tel.: +86 25 58641527; fax: +86 25 58641500. E-mail address: [email protected] (Q. Zhao).

Zhou et al., 2014), rat (Hu et al., 2013; Li et al., 2013), fruit fly (Bassett et al., 2013a, Gratz et al., 2013; Kondo and Ueda, 2013; Ren et al., 2013; Yu et al., 2013), silkworm (Ma et al., 2014), Caenorhabditis elegans (Chen et al., 2013; Cho et al., 2013; Friedland et al., 2013; Katic and Großhans, 2013; Tzur et al., 2013), and frog (Guo et al., 2014) when the induced DSB was repaired by NHEJ, an error-prone repair pathway, but also knockin (via homology-mediated repair) animals including C. elegans (Chen et al., 2013; Tzur et al., 2013; Zhao et al., 2014) and fruit fly (Bassett et al., 2013b; Dickinson et al., 2013; Gratz et al., 2013, 2014) when the induced DSB was repaired by HR with an artificial DNA donor. Zebrafish, a vertebrate animal model, is widely used in various genetic studies and biomedical researches. Although knockout zebrafish mutants have been created by CRISPR/Cas9 (Hruscha et al., 2013; Hwang et al., 2013), the low efficiency of germline transmission of induced mutations and particularly knockin alleles made subsequently screening heritable offspring tedious, timeconsuming, expensive and at times impossible. For example, no heritable zebrafish carrying a knockin allele via gene targeting has been created to date though point mutations (Hwang et al., 2013), loxP (Chang et al., 2013) and HA tag (Hruscha et al., 2013) were integrated into zebrafish somatic genome by CRISPR/Cas9-triggered HR. In this study, we developed a method to improve the screening efficiency of germline transmitted CRISPR/Cas9-based gene targeting in zebrafish by screening founder embryos carrying primordial germ cells (PGCs) tentatively labeled with enhanced yellow fluorescent protein (eYFP). Using this method, we demonstrated that

http://dx.doi.org/10.1016/j.biocel.2014.08.020 1357-2725/© 2014 Published by Elsevier Ltd.

Please cite this article in press as: Dong Z, et al. Improving the efficiency for generation of genome-edited zebrafish by labeling primordial germ cells. Int J Biochem Cell Biol (2014), http://dx.doi.org/10.1016/j.biocel.2014.08.020

42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68

G Model BC 4420 1–6

ARTICLE IN PRESS Z. Dong et al. / The International Journal of Biochemistry & Cell Biology xxx (2014) xxx–xxx

2

77

founders carrying labeled PGCs produced much higher numbers of knockin and knockout progeny. In comparison with the common practice of selecting founders by genotyping fin-clips, our new strategy of selecting founders with tentatively fluorescentlabeled PGCs significantly increase the ease and speed of generating genome-edited animals with CRISPR/Cas9. Particularly, we generated gene targeted zebrafish carrying a loxP in intron 3 and intron 4 of aldh1a2, respectively, laying the foundation for creating a conditional knockout zebrafish.

78

2. Materials and methods

79

2.1. Animals

69 70 71 72 73 74 75 76

80 81 82 83 84

85 86

87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118

119 120

121 122 123 124 125 126 127

Tubingen zebrafish used in this study are housed in the zebrafish facility of Model Animal Research Center, Nanjing University. The research protocol was approved by the Institutional Animal Care and Use Committee of Model Animal Research Center, Nanjing University. 2.2. Determination of indel rate in zebrafish embryos during early development after CRISPR/Cas9 injection by sequencing Capped Cas9 mRNA was transcribed from plasmid pXT7-Cas9 (Chang et al., 2013) and tailed with mMessage mMachine T7 Ultra Kit (Ambion, USA). sgRNAs were transcribed from templates prepared by PCR with gene specific primers and a universal reverse primer gRNAR (Table 1) using plasmid pT7-gRNA as template (Chang et al., 2013). To examine the activities of sgRNAs, 1 nl solution containing 250 pg Cas9 mRNA and 50 pg sgRNA (Supplementary Table 1) was microinjected into 1-cell zebrafish embryos (Each sgRNA was tested separately). When reaching 24 hpf, 20 of the microinjected embryos were randomly selected for genomic DNA isolation using the method described previously (Dong et al., 2011). The genomic fragment containing the sgRNA (a3gR11) binding site in intron 3 of aldh1a2 was amplified with primers a3F2 and a3R2, while the genomic fragment containing the sgRNA (a4gR05) binding site in intron 4 of aldh1a2 was amplified with primers a4F3 and a4R3 (Table 1). The PCR program was 95 ◦ C 2 min, 35 cycles of (95 ◦ C 30 s, 56 ◦ C 30 s, and 72 ◦ C 1 min), and a final extension at 72 ◦ C for 5 min. The PCR products were cloned into pGEM-T easy vector (Promega, USA). Forty positive transformants from each group of embryos were sequenced to determine the indel mutations. The sgRNAs with the highest activity in the two different sites were chosen for subsequent experiments. To determine the rate of indel mutations induced in zebrafish embryos at different developmental stages, 1 nl solution containing 250 pg Cas9 mRNA and 50 pg sgRNA a4gR5 was microinjected into 1-cell embryos. Thirty embryos at 8-cell, 16-cell and 32-cell stages and 20 embryos at 1 K-cell, 30% epiboly, 50% epiboly, 6-somite and prim-5 were collected for indel mutation determination, respectively. The experiment was performed 3 times independently and the indel ratios were shown in mean ± standard error of the mean (SEM). 2.3. Observation of yfp-nanos3 distribution in zebrafish PGCs after microinjection by fluorescence photography yfp-nanos3 cDNA was constructed by overlapping PCR. Briefly, yfp was amplified using primers YFPF and nos3 U-YFPR from plasmid pycbeta-actinpr eYFP (Ge et al., 2012). The 3 untranslated region (UTR) of zebrafish nanos3 (GenBank Gene ID 140631) was amplified using primers YFP-nos3 UF and nos3 UR (Table 1) from cDNA reverse transcribed from the total RNA isolated from zebrafish ovaries. The two overlapping fragments were purified,

mixed and then used as templates to amplify the yfp-nanos3 DNA fragment using primers YFPF and nos3 UR (Table 1). The resultant product was cloned into pGEM-T easy vector (Promega, USA), transcribed, capped, and tailed with mMessage mMachine T7 Ultra Kit (Ambion, USA). A mixture containing 500 pg yfp-nanos3 mRNA (Fig. 1A) and 50 ng Rhodamine B isothiocyanate (RITC)-dextran (Sigma, USA) was microinjected into 1-cell zebrafish embryos. The microinjected embryos were observed under an Olympus DVX10 stereo fluorescence microscope when they reached 48 hpf. RITC signal was captured in RFP channel, while YFP signal was observed in YFP channel. 2.4. Measuring the effects of Cas9 mRNA, sgRNA and ssODN at different concentrations on knockin efficiency by polymerase chain reaction Single stranded oligodeoxynucleotide (ssODN) a4gR5ssD harboring a 20-bp left homology-arm, a 19-bp right homology-arm and a modified loxP sequence (Bedell et al., 2012), synthesized commercially and dissolved to a 1 ␮g/␮l stock solution, was used as a homologous donor. 1× (containing 15.625 pg Cas9 mRNA, 3.125 pg gRNA a4gR5 and 3.125 pg ssODN donor a4gR5ssD, Table 1 and Supplementary Table 1), 4× and 16× doses were microinjected into 1-cell zebrafish embryos, respectively. Knockin event was detected by nested PCR. The first round PCR was performed in the same way as the detection of indel mutation described above. The second round PCR detected mloxP integration using forward primer mloxPf complementary to mloxP and gene specific reverse primer a4R12 (Table 1), and 1 ␮l of 1st round PCR product as template. The PCR program was 94 ◦ C 2 min, 30 cycles of (95 ◦ C 30 s, 57 ◦ C 30 s, and 72 ◦ C 35 s), and a final extension at 72 ◦ C for 5 min. 4 ␮l of the 2nd round PCR was then analyzed on 1.1% agarose gel. The images of the gels were analyzed with ImageJ (http://imagej.nih.gov/ij/). The experiment was performed 3 times independently and the relative knockin efficiency was shown in mean ± SEM. The results were subjected to Student’s t-test. 2.5. Selecting founder embryos carrying PGCs labeled with enhanced yellow fluorescent protein via fluorescence photography To perform gene targeting in zebrafish aldh1a2, 1 nl solution containing 500 pg yfp-nanos3 mRNA, 250 pg Cas9 mRNA, 50 pg sgRNA a3gR11, 50 pg sgRNA a4gR5, 50 pg donor a3gR11ssD and 50 pg donor a4gR5ssD (Table 1 and Supplementary Table 1, Supplementary Protocol) was co-microinjected into 1-cell embryos. At 48 hpf, the embryos were observed for yellow fluorescence as described above. Embryos exhibiting YFP signal in their PGCs were selected as founders (on-PGC founders) and grown to sexual maturity. The embryos microinjected with the same solution but not selected by yellow fluorescence were raised as control founders. Gene targeting (knockin) efficiency was first detected in the oocytes isolated from adult founder ovaries using nested PCR as described above. To detect knockin events in intron 3, the gene specific reverse primer used in 2nd round PCR was a3R3 (Table 1). The relative knockin efficiency in founder ovaries was measured as described above and normalized to the average ratio of knockin at a3gR11 locus of control founders. The results were subjected to Student’s t-test. To determine knockin and knockout efficiencies in the F1 progeny, 35 of on-PGC founders and 60 of control founders were allowed to mate ad libitum, respectively. 16 of 24 hpf embryos derived from on-PGC founders and 93 of 24 hpf embryos derived from control embryos were then randomly selected to examine their genotypes by directly sequencing the 1st round of PCR products amplified from the 24 hpf embryos using the method

Please cite this article in press as: Dong Z, et al. Improving the efficiency for generation of genome-edited zebrafish by labeling primordial germ cells. Int J Biochem Cell Biol (2014), http://dx.doi.org/10.1016/j.biocel.2014.08.020

128 129 130 131 132 133 134 135 136 137 138 139

140 141 142

143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162

163 164

165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188

G Model

ARTICLE IN PRESS

BC 4420 1–6

Z. Dong et al. / The International Journal of Biochemistry & Cell Biology xxx (2014) xxx–xxx

3

Table 1 Primers and ssODN donors used in this study.

189 190

191

192 193

194 195 196 197 198 199 200 201 202 203 204 205 206 207 208

209 210

211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228

Primer

Sequence

YFPF nos3 U-YFPR YFP-nos3 UF nos3 UR a3gRF11 a4gRF05 gRNAR a3gR11ssD a4gR5ssD mloxP forward a3F2 a3R2 a3R3 a4F3 a4R3 a4R12

ATGGTGAGCAAGGGCGAGGA ccggagcatcaatgtccgctTTACTTGTACAGCTCGTCCA TGGACGAGCTGTACAAGTAAagcggacattgatgctccgg AAGTCTAGAGAAAATGTTTATATTTTCCTCAC TAATACGACTCACTATAGACCCAAGATTCTCTAAGTTGTTTTAGAGCTAGAAATAGC TAATACGACTCACTATAGGGGAAACCGAGGCACCTAGGTTTTAGAGCTAGAAATAGC AAAAAAAGCACCGACTCGGTGCCAC tctgcatggacccaagattcATAACTTCGTATAGCATACATTATAGCAATTTATagaaggaaaaatcatggtt cgcatgtttttgaacttgtgATAACTTCGTATAGCATACATTATAGCAATTTATaaacctacgtgaacactgg CGTATAGCATACATTATAGCAATTTAT ACACCTGGAATTACACTTAA TCCTGGACCACCTTGAC TTTGATGTGGTGGCTGA TTCCACAATTTGGTTCCCTT CCTGCCGCGTTCCTTTC GCTGTCACTGTGCTCCA

as described above, respectively. The ratios of knockin and knockout in F1 progeny were subjected to 2 test, respectively.

3. Results 3.1. The rate of indel mutation induced by CRISPR/Cas9 in zebrafish embryos is increased with development We first identified sgRNAs recognizing targets in intron 3 and intron 4 of aldh1a2 in zebrafish embryos. Five and three sgRNAs were designed to recognize targets in intron 3 and intron 4, respectively. sgRNA a3gR11 and a4gR5 showed the highest activities, inducing 33% and 42% indel mutations in intron 3 and intron 4 of zebrafish aldh1a2, respectively (Supplementary Table 1). We then examined the rate of indel mutation in intron 4 of aldh1a2 in the embryos microinjected with Cas9 mRNA and sgRNA a4gR5 at different developmental stages. The results showed that the CRISPR/Cas9 induced 1.7 ± 2.9% indel mutation at 8-cell stage and the indel rate increased with proceeding of development. At 50% epiboly, the indel rate reached 35 ± 5% and was maintained from 6-somite stage through 24 hpf (Supplementary Figure 1).

3.2. The RNAs microinjected into zebrafish embryos are unevenly distributed in somatic cells and PGCs It is necessary to investigate what proportion of the Cas9 mRNA and sgRNA microinjected into 1-cell embryos later reach PGCs, the precursors of germ cells that are responsible for transmitting the genetic information into the next generation, during early development. To do it, we microinjected into zebrafish fertilized eggs RITC-dextran plus yfp-nanos3 mRNA (Fig. 1A) whose stability was regulated by degradation in somatic cells and protection in PGCs (Köprunner et al., 2001) and observed them under a fluorescent dissecting microscope. Interestingly, although all the 59 microinjected embryos at 48 hpf exhibited global distribution of RITC (Fig. 1B and C), suggesting all embryos had been effectively microinjected, 71% (42/59) of the embryos exhibit no YFP fluorescence in their PGCs (Fig. 1B and B ) whereas only 29% (17 of 59) harbored YFP-label PGCs (Fig. 1C and C ). The results demonstrated that only relatively small portion of the RNAs introduced into zebrafish embryos by microinjection reached PGCs during early development. Actually, the unevenly distribution of YFP signals were also observed in somatic cells of zebrafish embryos (Fig. 1B and C ).

3.3. Cas9 mRNA and sgRNA plus ssODN triggers gene targeting in zebrafish embryos in a dose-dependent manner In order to optimize the concentrations of Cas9 mRNA and sgRNA plus donor used in gene targeting, we tested the gene targeting efficiency in zebrafish embryos with 1×, 4× and 16× dosages (Table 1 and Fig. 2A). The results showed that 4× dosage yielded a frequency of gene targeting events 7-fold as much as (p < 0.05) that of 1× dosage. However, the efficiencies of 4× and 16× were similar (p > 0.05) (Supplementary Figure 2).

3.4. Founders carrying labeled primordial germ cells produced much higher ratios of knockin and knockout progeny Because only a small portion of the microinjected embryos harbored detectable microinjected nucleotides in their PGCs, we therefore explored an approach to increase gene targeting founders by microinjecting Cas9 mRNA, a3gR11, a3gR11ssD, a4gR5, and a4gR5ssD (Table 1, Supplementary Table 1 and Fig. 2A) into zebrafish fertilized eggs together with yfp-nanos3 mRNA as a selectable marker. At 48hpf, the embryos were screened under a fluorescent dissecting microscope. The microinjected embryos showed a survival rate of 82 ± 12%. Indeed, only 13 ± 9% of the microinjected embryos displayed YFP expression in their PGCs (Fig. 2C), while the majority (87 ± 9%) showed no YFP signals in their PGCs (Fig. 2B). When the founders reached 3-months old, oocytes in ovaries from 5 of on-PGC founders and 7 of control founders were collected for mloxP knockin detection. The results showed that on-PGC founders yielded 9-fold of mloxP knockin as much as (p < 0.01) that of control founders in intron 3 and 2-fold as much as (p < 0.01) that of control in intron 4 of zebrafish aldh1a2, respectively (Fig. 2D). When genotyping offspring derived from founders, we found on-PGC founders produced 6.3% (1/16) progeny carrying knockin of mloxP in intron 3, while no progeny (0/93) of control founders carrying mloxp (p < 0.05); and on-PGC founders produced 12.5% (2/16) progeny carrying knockin of mloxP in intron 4 of zebrafish aldh1a2, which was about 6-fold as much as (p < 0.05) that (2/93) derived from control founders (Fig. 2E and Supplementary Figure 3). Similarly, 38% (6/16) offspring of on-PGC founders carried indel mutations in intron 3, which was about 3-fold as much as (p < 0.01) that (11% = 10/93) of control founders; and 50% (8/16) offspring of on-PGC founders carried indel mutations in intron 4 of zebrafish aldh1a2, which was about 2-fold as much as (p < 0.05) that (23% = 21/93) of control founders (Fig. 2F).

Please cite this article in press as: Dong Z, et al. Improving the efficiency for generation of genome-edited zebrafish by labeling primordial germ cells. Int J Biochem Cell Biol (2014), http://dx.doi.org/10.1016/j.biocel.2014.08.020

229 230

231 232 233 234 235 236 237

238 239

240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272

G Model BC 4420 1–6

ARTICLE IN PRESS Z. Dong et al. / The International Journal of Biochemistry & Cell Biology xxx (2014) xxx–xxx

4

Fig. 1. Only the small proportion of eYFP reporter mRNAs are distributed into PGCs of zebrafish embryos after microinjection. (A) Schematic diagram showing the template of mRNA of eYFP reporter comprising CDS of enhanced yellow florescent protein (eYFP) fused with 3 UTR of zebrafish nanos3 mRNA. The expression of the mRNA is driven by T7 promoter (in bold). Sequence of eYFP CDS is in upper case and highlighted in yellow. The nanos3 3 UTR is underlined. (B and C) The evenly distribution of RITC in all embryos at 48 hpf. (B and C ) The unevenly distribution of YFP (pseudo coloring to green) in different embryos at 48 hpf. (B) and (B ) are the same embryo observed under fluorescent dissecting microscope in red and yellow channel, respectively. So do panels (C) and (C ). (B ) Merged panel of (B) and (B ). (C ) Merged panel of (C) and (C ). PGCs Q3 exhibiting little YFP signal are indicated with a hollow arrow head (B and B ) whereas those exhibiting strong YFP signal are indicated with a white solid arrow head (C and C ). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

273

274 275 276

4. Discussion Fertilized eggs of vertebrate animals are totipotent cells that differentiate into three different germ layers and PGCs during early development. The germ layer cells then differentiate into somatic

cells whereas PGCs give rise to gametes, for transmitting genetic information into the next generation. Microinjected into fertilized eggs, EENs including ZFN (zinc-finger nuclease), TALEN (transcription activator-like effector nuclease) and CRISPR/Cas9 are powerful tools to create

Please cite this article in press as: Dong Z, et al. Improving the efficiency for generation of genome-edited zebrafish by labeling primordial germ cells. Int J Biochem Cell Biol (2014), http://dx.doi.org/10.1016/j.biocel.2014.08.020

277 278 279 280 281

G Model BC 4420 1–6

ARTICLE IN PRESS Z. Dong et al. / The International Journal of Biochemistry & Cell Biology xxx (2014) xxx–xxx

5

Fig. 2. Founders carrying labeled PGCs have much more germ cells containing mloxP knockin allele and indel mutations. (A) Schematic diagram showing knockin of mloxP in introns 3 and 4 of zebrafish aldh1a2 through HR. Green boxes in the genomic fragment represent exons, and white boxes introns. Red boxes are sgRNA recognition sites. In the magnified view, green single stranded sequences are homology arms, and blue sequences are mloxP in the ssODN donor. In the double stranded DNA sequences represent genomic fragments at the sgRNA recognition sites. Red sequences are sgRNA recognition sites. Crosses show homologous recombination between donors and recipients. (B and C) Representative embryos with little (B) or abundant (C) YFP signal in PGCs. (D) Relative knockin level of mloxP in oocytes of on-PGC and control founder zebrafish. All values are normalized to the result of knockin in intron 3 in control founder zebrafish. Data are shown in mean ± SEM (error bar). (E) The ratios of progeny carrying knockin of mloxP derived from on-PGC and control founders, respectively. (F) The ratios of progeny carrying indel mutations derived from on-PGC and control founders, respectively. Double asterisks show a difference that is statistically significant with p < 0.01 (D and F). Single asterisks show a difference that is statistically significant with p < 0.05 (E and F). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313

genome-edited animals. However, only a small portion of mutations in founders developed from the microinjected embryos with EENs occur in germ cells, which significantly limits mutagenesis frequency. In zebrafish, for example, microinjection of ZFN into fertilized eggs induced 64–81% mutated alleles in founders but only 5–32% of the offspring inherited the mutations (Doyon et al., 2008). Likewise, microinjection of CRISPR/Cas9 into zebrafish fertilized eggs resulted in 50.5% mutated alleles in founder embryos but only about 11% of their progeny carried the mutations (Hruscha et al., 2013). Our previous researches also showed that yellow catfish founders with high ratio of ZFN- or TALEN-induced mutations produced much less or even no progeny carrying mutations (Dong et al., 2011, 2014). Compared with EEN-induced indel mutations, gene targeting events occur at a much lower ratio in animals. In zebrafish, for instance, only ∼1.5% founders derived from the embryos microinjected with TALEN plus enhanced green fluorescent protein donor carried germline transmitted knockin allele (Zu et al., 2013), and approximately 10% founders derived from the embryos microinjected with GoldyTALEN plus ssODN donors resulted in germline transmission of mloxP knockin (Bedell et al., 2012). Therefore, it is understandable that no heritable zebrafish carrying a knockin allele has been reported using CRISPR/Cas9 though gene targeting events including integration of point mutations, loxP and HA tag were achieved in zebrafish somatic genome by CRISPR/Cas9triggered HR (Chang et al., 2013; Hruscha et al., 2013; Hwang et al., 2013). Hence, it is important to increase germline transmission rate of gene targeting for generation of heritable zebrafish carrying knockin alleles. The fate of PGCs in zebrafish is specified by the germ plasm formed during oogenesis and localized to the cleavage furrows from the 1st cleavage through 32-cell stages (Yoon et al., 1997). At

1k-cell stage, there are only 4 PGC cells formed in a zebrafish embryo, which finally give rise to approximately 30 PGCs in the embryos at 24 hpf through mitoses (Yoon et al., 1997). In this study, we demonstrated that the RNAs microinjected into zebrafish embryos are unevenly distributed in somatic cells and PGCs, and only PGC-modified founders are valuable for heritable genome editing, for which we did not have a selection criterion before. Additionally, the frequency of DSB-induced indels induced by CRISPR/Cas9 is time dependent (also true for ZFN and TALEN, data not shown) and reach the plateau at 50% epiboly. The results led us to screen the microinjected embryos at 48 hpf and select those carrying labeled PGCs as on-PGC founders, instead of screening the founders by genotyping fin clips. In contrast, previous reports showed that there were no significant differences of germline transmission of gene targeting induced by TALEN between pre-screened somatic-positive founder zebrafish (2/16) and non-pre-screened zebrafish (4/42) (Bedell et al., 2012). Our results showed that the on-PGC founders produced much higher number of F1 progeny (up to 6-fold that of control) carrying the knockin alleles. Using this method, we generated heritable gene targeted zebrafish carrying a loxP in intron 3 and intron 4 of aldh1a2, respectively, laying the foundation for creating a conditional knockout zebrafish. The on-PGC founders from our selection system also produced much more F1 progeny carrying indel mutations (up to 3 fold that of control). In summary, we developed a method by screening founders with tentatively labeled PGCs to effectively improve the efficiency of producing heritable mutants including knockin and knockout zebrafish. The method considerably reduces time and labor for screening zebrafish mutants. It should be also applicable for genome editing in other animals that have PGCs fated by germ plasm.

Please cite this article in press as: Dong Z, et al. Improving the efficiency for generation of genome-edited zebrafish by labeling primordial germ cells. Int J Biochem Cell Biol (2014), http://dx.doi.org/10.1016/j.biocel.2014.08.020

314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345

G Model

ARTICLE IN PRESS

BC 4420 1–6

Z. Dong et al. / The International Journal of Biochemistry & Cell Biology xxx (2014) xxx–xxx

6 346

Acknowledgements

We thank Drs. Jingwei Xiong and Bo Zhang at Peking University for their providing us with the plasmids of pXT7-Cas9 and 348 Q2 pMD-gRNA. This work was supported by the Ministry of Science 349 and Technology of China (2011CB943804) and the National Natural 350 Science Foundation of China (31171434). 351 347

352

Appendix A. Supplementary data

355

Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.biocel.2014.08.020.

356

References

353 354

357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391

Bassett AR, Tibbit C, Ponting CP, Liu JL. Highly efficient targeted mutagenesis of Drosophila with the CRISPR/Cas9 system. Cell Rep 2013a;4:220–8. Bassett AR, Tibbit C, Ponting CP, Liu JL. Mutagenesis and homologous recombination in Drosophila cell lines using CRISPR/Cas9. Biol Open 2013b;3:42–9. Bedell VM, Wang Y, Campbell JM, Poshusta TL, Starker CG, Krug RG 2nd, et al. In vivo genome editing using a high-efficiency TALEN system. Nature 2012;491:114–8. Chang N, Sun C, Gao L, Zhu D, Xu X, Zhu X, et al. Genome editing with RNA-guided Cas9 nuclease in Zebrafish embryos. Cell Res 2013;23:465–72. Chen C, Fenk LA, de Bono M. Efficient genome editing in Caenorhabditis elegans by CRISPR-targeted homologous recombination. Nucleic Acids Res 2013;41:e193. Cho SW, Lee J, Carroll D, Kim JS, Lee J. Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins. Genetics 2013;195:1177–80. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, et al. Multiplex genome engineering using CRISPR/Cas systems. Science 2013;339:819–23. Dickinson DJ, Ward JD, Reiner DJ, Goldstein B. Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nat Methods 2013;10:1028–34. Dong Z, Ge J, Li K, Xu Z, Liang D, Li J, et al. Heritable targeted inactivation of myostatin gene in yellow catfish (Pelteobagrus fulvidraco) using engineered zinc finger nucleases. PLoS ONE 2011;6:e28897. Dong Z, Ge J, Xu Z, Dong X, Cao S, Pan J, et al. Generation of myostatin b Knockout Yellow Catfish (Tachysurus fulvidraco) using transcription activator-like effector nucleases. Zebrafish 2014;11:265–74. Doyon Y, McCammon JM, Miller JC, Faraji F, Ngo C, Katibah GE, et al. Heritable targeted gene disruption in zebrafish using designed zinc-finger nucleases. Nat Biotechnol 2008;26:702–8. Friedland AE, Tzur YB, Esvelt KM, Colaiacovo MP, Church GM, Calarco JA. Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat Methods 2013;10:741–3. Ge J, Dong Z, Li J, Xu Z, Song W, Bao J, et al. Isolation of yellow catfish ␤-actin promoter and generation of transgenic yellow catfish expressing enhanced yellow fluorescent protein. Transgenic Res 2012;21:995–1004. Gratz SJ, Cummings AM, Nguyen JN, Hamm DC, Donohue LK, Harrison MM, et al. Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics 2013;194:1029–35.

Gratz SJ, Ukken FP, Rubinstein CD, Thiede G, Donohue LK, Cummings AM, et al. Highly specific and efficient CRISPR/Cas9-catalyzed homology-directed repair in Drosophila. Genetics 2014;196:961–71. Guo X, Zhang T, Hu Z, Zhang Y, Shi Z, Wang Q, et al. Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis. Development 2014;141:707–14. Hruscha A, Krawitz P, Rechenberg A, Heinrich V, Hecht J, Haass C, et al. Efficient CRISPR/Cas9 genome editing with low off-target effects in zebrafish. Development 2013;140:4982–7. Hu X, Chang N, Wang X, Zhou F, Zhou X, Zhu X, et al. Heritable gene-targeting with gRNA/Cas9 in rats. Cell Res 2013;23:1322–5. Hwang WY, Fu Y, Reyon D, Maeder ML, Kaini P, Sander JD, et al. Heritable and precise zebrafish genome editing using a CRISPR-Cas System. PLOS ONE 2013;8:e68708. Jacob HJ, Lazar J, Dwinell MR, Moreno C, Geurts AM. Gene targeting in the rat: advances and opportunities. Trends Genet 2010;26:510–8. Johnson RD, Jasin M. Double-strand-break-induced homologous recombination in mammalian cells. Biochem Soc Trans 2001;29:196–201. Köprunner M, Thisse C, Thisse B, Raz E. A zebrafish nanos-related gene is essential for the development of primordial germ cells. Genes Dev 2001;15:2877–85. Katic I, Großhans H. Targeted Heritable Mutation and Gene Conversion by Cas9CRISPR in Caenorhabditis elegans. Genetics 2013;195:1173–6. Kondo S, Ueda R. Highly improved gene targeting by Germline-specific Cas9 expression in Drosophila. Genetics 2013;195:715–21. Li D, Qiu Z, Shao Y, Chen Y, Guan Y, Liu M, et al. Heritable gene targeting in the mouse and rat using a CRISPR-Cas system. Nat Biotechnol 2013;31:681–3. Ma S, Chang J, Wang X, Liu Y, Zhang J, Lu W, et al. CRISPR/Cas9 mediated multiplex genome editing and heritable mutagenesis of BmKu70 in Bombyx mori. Sci Rep 2014;4:4489. Mali P, Yang L, Esvelt KM, Aach J, Guell M, Dicarlo JE, et al. RNA-guided human genome engineering via Cas9. Science 2013;339:823–6. Mashiko D, Fujihara Y, Satouh Y, Miyata H, Isotani A, Ikawa M. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Sci Rep 2013;3:3355. Ren X, Sun J, Housden BE, Hu Y, Roesel C, Lin S, et al. Optimized gene editing technology for Drosophila melanogaster using germ line-specific Cas9. Proc Natl Acad Sci U S A 2013;110:19012–7. Sung YH, Kim JM, Kim HT, Lee J, Jeon J, Jin Y, et al. Highly efficient gene knockout in mice and zebrafish with RNA-guided endonucleases. Genome Res 2014;24:125–31. Tzur YB, Friedland AE, Nadarajan S, Church GM, Calarco JA, Colaiacovo MP. Heritable custom genomic modifications in Caenorhabditis elegans via a CRISPR-Cas9 system. Genetics 2013;195:1181–5. Yoon C, Kawakami K, Hopkins N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development 1997;124:3157–65. Yu Z, Ren M, Wang Z, Zhang B, Rong YS, Jiao R, et al. Highly efficient genome modifications mediated by CRISPR/Cas9 in Drosophila. Genetics 2013;195: 289–91. Zhao P, Zhang Z, Ke H, Yue Y, Xue D. Oligonucleotide-based targeted gene editing in C. elegans via the CRISPR/Cas9 system. Cell Res 2014;24:247–50. Zhou J, Shen B, Zhang W, Wang J, Yang J, Chen L, et al. One-step generation of different immunodeficient mice with multiple gene modifications by CRISPR/Cas9 mediated genome engineering. Int J Biochem Cell Biol 2014;46: 49–55. Zu Y, Tong X, Wang Z, Liu D, Pan R, Li Z, et al. TALEN-mediated precise genome modification by homologous recombination in zebrafish. Nat Methods 2013;10:329–31.

Please cite this article in press as: Dong Z, et al. Improving the efficiency for generation of genome-edited zebrafish by labeling primordial germ cells. Int J Biochem Cell Biol (2014), http://dx.doi.org/10.1016/j.biocel.2014.08.020

392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447