In vitro cadmium effects on ECM gene expression in human bronchial epithelial cells

Cytokine 72 (2015) 9–16

Contents lists available at ScienceDirect

Cytokine journal homepage: www.journals.elsevier.com/cytokine

In vitro cadmium effects on ECM gene expression in human bronchial epithelial cells q Tiziano Baroni a,⇑,1, Cinzia Lilli a,1, Catia Bellucci a, Giovanni Luca a, Francesca Mancuso a, Francesca Fallarino a, Giulia Falabella a, Iva Arato a, Mario Calvitti a, Lorella Marinucci a, Giacomo Muzi b, Marco Dell’Omo b, Angela Gambelunghe b, Maria Bodo a a b

Department of Experimental Medicine, University of Perugia, Perugia, Italy Department of Medicine, University of Perugia, Perugia, Italy

a r t i c l e

i n f o

Article history: Received 11 October 2014 Received in revised form 30 November 2014 Accepted 2 December 2014

Keywords: Apoptosis Cadmium Epithelial bronchial cells Extracellular matrix Transforming growth factor

a b s t r a c t Occupational and environmental exposure to the heavy metal cadmium (Cd) and its inhalation from cigarette smoke are associated with emphysema. Many growth factors and extracellular matrix (ECM) cell signaling molecules are directly involved in the epithelial bronchial cell pathway. This study investigated the direct effects of Cd on the production of several ECM components in human bronchial epithelial cells (BEAS-2B) that were exposed in vitro for 48 h to sub-toxic and toxic concentrations of Cd. Gene expression of collagens, metalloproteases (MMPs), integrins, tenascin and vitronectin were quantified by RT-PCR. To study apoptosis cascade, annexin assay and cellular cytotoxicity by MTT assay were performed. We also investigated whether an imbalance in the TGFb/TGFb receptor (TGFbR) expression mediated Cd effects. The results showed the sub-toxic Cd dose significantly increased tenascin, vitronectin, b1 and b5 integrin gene expression. The toxic Cd dose decreased type IV and V collagen, a1, a2 and b3 integrins. Both Cd doses down-regulated type I collagen and up-regulated metalloproteases. Each Cd dose caused a different imbalance in the complex pattern of TGFb and its receptors. No alteration in classic apoptotic marker protein expression was observed in presence of the sub-toxic dose of Cd, suggesting this metal alters ECM production without apoptotic activation. In conclusion, all these data show even sub-toxic Cd dose exposure alters the specific gene expression of several ECM components that are crucially implicated in the mechanical properties of lung parenchyma supporting the hypothesis that the mechanism underlying Cd-induced lung disease may involve downstream changes in TGFb/ TGFbR signaling. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction Cadmium (Cd), a heavy metal, is known for its toxicity and worldwide distribution. Since being found in most human foodstuffs, diet is the primary source of Cd exposure in the nonsmoking population [15,33]. Intoxication is also associated with cigarette smoke, water and air contamination. Occupational

q Contract grant sponsor: This study was supported by the Basic Research Fund, University of Perugia and a grant from the Fondazione Cassa di Risparmio di Perugia (project number: 2009.010.0430). ⇑ Corresponding author at: Department of Experimental Medicine, Polo Unico Sant’Andrea delle Fratte, Piazzale Gambuli, 1 – Edificio D, University of Perugia, 06156 Perugia, Italy. Tel.: +39 075 5858233; fax: +39 075 5858415. E-mail address: [email protected] (T. Baroni). 1 The first and the second authors contributed equally to the project.

http://dx.doi.org/10.1016/j.cyto.2014.12.002 1043-4666/Ó 2014 Elsevier Ltd. All rights reserved.

exposure derives from mining, the metallurgy industry and nickel manufacturing, batteries, pigments and plastic stabilizers. Epidemiological studies linked low-level Cd exposure with adverse effects on almost every organ and tissue where cadmium accumulates, due to its low excretion rate and 15–20 year half-life [21]. Acute Cd exposure was associated with bone disorders, such as osteoporosis [28], alterations in specific bone differentiation markers [11], renal failure, immune suppression, obstructive airway disease and emphysema [7]. Chronic exposure was also linked with lung cancer [27,40]. Although Cd-induced changes impact critically upon lung architecture and respiratory function, their molecular bases are still not clear. Many lung diseases are characterized by airway remodelling and imbalances in extracellular matrix (ECM) components and growth factors [8,9,10,32,36] such as transforming growth factor beta (TGFb), a major mediator of cell growth, differentiation, signaling and repair [30,13,39]. Indeed, TGFb was

10

T. Baroni et al. / Cytokine 72 (2015) 9–16

Table 1 Oligonucleotides used for real-time PCR. mRNA

Sequences (50 –30 )

Product (bp)

GenBank Accession No.

MMP1

Fw: TACACGCCAGATTTGCCAAG Rv: ATGAGCAAGATTTCCTCCAG Fw: TTCCCAGTGGTGGTGATGAA Rv: CATGGAGCTTGCTGCATTCT Fw: CTCTGGATGGGTTCACAGGT Rv: GCCGCATCTACATCTCAGG Fw: GCTGATTGAGACTCCAAGGC Rv: TACTCTTTCCCCCAACGATG Fw: ATCTATGACAAGTTCAAGCAGAGTA Rv: ACCACTGCCGCACAACTCCGGTGAC Fw: GCCCTTCTTCCCCTCCGAA Rv: GCGCTGGGTTGGAGATGTT Fw: GCACTTGCAAAGGGCTCTG Rv: GGCATAGTATTCCGACTCGG Fw: CCTCTAGAGAAGAACGTTCGT Rv: GGCTTTCCTTGGGTACCAACAA Fw: GGTCGCTTTGCTGAGGTCTA Rv: CTTGAGGTCCCTGTGCACGAT Fw: CCTGTCATTCCCAGCATACAACT Rv: ATCACCTGACTCCAGATCTTCATA Fw: TGTTGTTGCAGAAATGTCAGC Rv: TGTAGCATAAGCTCCTAGGTTGC Fw: GTAGTTGACAACACAAAACAAACAA Rv: AAATAAAATTTTGTTGGAATGAAGC Fw: TGCCGGGTTTCACTTTGC; Rv: GTGACATTGTCCATCATTTGGTAAA Fw: GTTCCCAGTGAGTGAGGCCCGAGTA Rv: AAGCGGGTCACCTGGTCAGTTAGCG Fw:CGAGCTTGGGATAAAGCAAG Rv: TCAACAGGCATCTCAACAGC Fw:GTGAGACAGGCGAACAGG; Rv: GACCAGCAGGCACAGAGG Fw: AAGCTGTAAGCGTTTGCGT Rv: ACTCTTTTGTGATGCACACCA Fw: AAGGGGACCTACATGTTCTGG Rv: ATAGGGCAGGGCTAAAAAGG Fw: ACCTTCTACAATGAGCTGCG Rv: TCCATCACGATGCCAGTGGTA

189

NM_002421.2

128

NM_002427.2

250

NM_000638.3

133

NM_002160.2

267

NM_000660.3

223

NM_003238.1

298

NM_0003239

277

NM_004612

387

NM_003242

363

XM_001924

115

NM_181501.1

150

NM_002203.3

70

NM_033668.1

419

NM_000212.2

327

NM_002213.3

129

NM_000088.3

150

NM_001845.4

241

NM_000393.3

197

NM_001101.3

MMP13 Vitronectin Tenascin C TGFb1 TGFb2 TGFb3 TGFbR1 TGFbR2 TGFbR3/Betaglycan Integrin a1 Integrin a2 Integrin b1 Integrin b3 Integrin b5 Collagen I Collagen IV Collagen V b-actin

Fig. 1. Effects of exposure in vitro of normal human bronchial epithelial cells, BEAS2B to cadmium (Cd) on cell number. The cells were maintained in BEGM for 48 h with or without 10 lM Cd or 20 lM Cd. The values represent the mean ± SEM of four independent experiments each in quadruplicate. Data were analyzed by paired Student’s t-test. Differences vs. control: ⁄P < 0.01; NS: not significant. Differences of 20 lM Cd vs. 10 lM Cd: §P < 0.01.

identified as potential susceptibility gene for lung fibrosis [5], chronic obstructive pulmonary disease and emphysema [18]. In order to establish the effects of Cd on ECM metabolism, the present study investigated the effects of sub-toxic and toxic Cd doses on the specific gene expression of ECM components that are crucially implicated in the lung parenchyma mechanical properties such as type I, IV and V collagens, metalloprotease (MMP1–13), integrins (a1, a 2, b3, b5), tenascin and vitronectin, and on TGFb family members and their receptors TGFb R1, R2, R3/betaglycan. Finally, we investigated whether the changes in ECM production in response to Cd were related to apoptosis mechanisms.

Fig. 2. Effects of exposure in vitro of normal human bronchial epithelial cells, BEAS2B to cadmium (Cd) on cytotoxicity tested by the MTT assay. The cells were maintained in BEGM for 48 h with or without 10 lM or 20 lM Cd. The optical density was measured at 570 nm, and values represent the mean ± SEM of four independent experiments each in quadruplicate. Data were analyzed by paired Student’s t-test. Differences vs. control: ⁄P < 0.01; NS: not significant. Differences of 20 lM Cd vs. 10 lM Cd: §P < 0.01.

2. Materials and methods 2.1. Cell culture and exposure to cadmium BEAS-2B cells derived from normal human bronchial epithelium and immortalized by adenovirus 12-SV 40 hybrid virus transfection were obtained from the American Type Culture Collection (ATCC, Rockville, MD CRL-9609).

T. Baroni et al. / Cytokine 72 (2015) 9–16

11

Fig. 3. Quantitative analysis (mRNA levels) for collagen I (A), collagen IV (B), collagen V (C), tenascin C (D) and vitronectin (E) obtained from normal human bronchial epithelial cells, BEAS-2B. The cells were maintained in BEGM for 48 h with or without 10 lM or 20 lM cadmium (Cd). The mRNA levels were quantified by real-time quantitative PCR. Values were the mean ± SEM of three independent experiments each performed in triplicate. Data were analized by paired Student’s t-test. The results were expressed as fold change in b-actin normalized mRNA values. Differences vs. mRNA levels in control: ⁄P < 0.01; NS: not significant. Differences of 20 lM Cd vs. 10 lM Cd: §P < 0.01; ns: not significant.

Sub-confluent cells were maintained for 48 h at 37 °C and 5% CO2 in BEGM medium (Cambrex, Bio Science Walkersville, MD USA) with or without cadmium chloride (Cd, Sigma, MO, USA) at the doses of 10 and 20 lM for 48 h.

temperature. The number of viable cells was counted with a Countess™ Automated Cell Counter (Invitrogen).

2.2. Cell number

Cell viability was measured using 3-(4,5-dimethylthiazolyl-2)2,5-diphenyltetrazoliumbromide (MTT) reagent [25]. Briefly, 10 ll of 5 lg ml1 MTT solution were added to each cell culture well of an optical clear 96-well flat bottom microtiter plate (MTP) and incubated for 4 h at 37 °C, protecting MTP from the light. The mitochondrial dehydrogenases of viable cells cleave the tetrazolium, yielding purple formazan crystals that are insoluble in aqueous media. At the end of incubation, the crystals were dissolved adding 100 ll/well of DMSO under gentle shaking for 30 min and absorbance was measured at 570 nm using a spectrophotometric microtiter plate reader. Enzyme activity

Preliminary studies determined the effects of Cd on cell number as a function of concentrations. BEAS-2B cell growth was estimated by counting cells adhering to wells after 48 h in complete medium with and without Cd at different concentrations (10, 20 and 50 lM). Cells were harvested with 0.05% trypsin–EDTA (Gibco, Gaithersburg, MD) (2 min), collected by centrifugation at 720 g and dissolved in 1 ml of medium. Trypan Blue was added to the cell suspension to obtain a final concentration of 2 mg/ml and incubated for 5 min at room

2.3. Cytotoxicity assay (MTT assay)

12

T. Baroni et al. / Cytokine 72 (2015) 9–16

directly correlates to the amount of formazan produced by reduction of the tetrazolium salt. Background and negative controls were obtained by measuring culture medium and untreated cell medium, respectively. Data from control and treated cells were calculated and expressed as percentage of viable cells (enzyme activity of treated cell/enzyme activity of control cells  100). 2.4. Real-time PCR detection of mRNA levels for type I, IV and V collagens, metalloproteases (MMP1–13), vitronectin, tenascin C, TGFb1, b2, b3, TGFbR1, TGFbR2, TGFbR3/betaglycan and integrins Total RNA was isolated from BEAS-2B cultured as above, by RNA purification kit (Versagene RNA Cell Kit, Gentra Systems, Minneapolis, MN) and quantified by reading the optical density at 260 nm. Briefly, 1 lg of total RNA was subjected to reverse transcription (RT) in a final volume of 50 ll. Real time PCR was performed using 1 ll of the cDNA prepared by the RT reaction and SYBR Green (Stratagene, Amsterdam, Netherlands). Real-time PCR was performed in an Mx3000P cycler (Stratagene) using FAM for detection and ROX as reference dye. The mRNA level of each sample was normalized against b-actin mRNA and expressed as fold changes vs. the level in untreated control cells. Oligonucleotides used for real-time PCRs were listed in Table 1. 2.5. Annexin-V/PI-binding assay

3.2. Toxic effects of cadmium To evaluate toxicity of different Cd concentrations on BEAS-2B cells, SDH activity was determined by the colorimetric MTT method. No significant toxicity was observed in cells exposed to 10 lM Cd (Fig. 2). SDH activity was strongly decreased in cells exposed to 20 lM Cd (by 68%). Based upon these results, subsequent gene expression experiments were conducted using sub-toxic (10 lM) and toxic (20 lM) Cd concentrations.

3.3. Effects of cadmium on gene expression of type I, IV and V collagens, vitronectin, tenascin C, integrins and MMP1–13 Fig. 3 shows mRNA steady state levels of type I, IV and V collagens, tenascin C and vitronectin and the effects of the two doses of cadmium. Compared with controls, type I collagen expression was down-regulated by both sub-toxic and toxic Cd doses (by 73% and by 74%, respectively). Compared with controls, collagens IV and V were unaffected by 10 lM Cd but were significantly downregulated by 20 lM Cd (by 42% and by 30%, respectively). Tenascin C production was stimulated by respectively six- and eightfold. Vitronectin mRNA was up-regulated by 10 lM Cd (+27%) but unaffected by 20 lM Cd. MMP1 and MMP13 levels were significantly up-regulated by both Cd doses (Fig. 4).

Apoptosis was analyzed by two different methods: detection of nuclei with hypodiploid DNA content and analysis of annexin-VFITC and propidium iodide (PI) stained cells. Hypodiploid DNA content was evaluated as previously described [29]. Briefly 3  105 cells were harvested, permeabilized in PI staining solution (50 lg/ml PI, 0.1% sodium citrate, 0.1% Triton X-100) and stored at 4 °C in the dark overnight. The PI fluorescence of individual nuclei was measured by flow cytometry (Beckman Coulter). Annexin V/PI double staining was carried out using a commercial kit (Immunotech Coulter) according to the manufacturer’s instructions. Briefly, 1  106 cells were washed twice with cold ice PBS and resuspended in 100 ll of binding buffer containing 0.5 lg/ml annexin and 10 lg/ml PI. After incubation on ice in the dark for 10 min, 400 ll of binding buffer were added to the cells which were then analyzed by flow cytometry. The annexin V/PI assay simultaneously determines cellular viability and rate of apoptosis, discriminating live cells (annexin-negative/PI-negative), early apoptotic cells (annexin-positive/PI-negative), late apoptotic cells (annexin-positive/PI-positive) and necrotic cells (annexin-negative/PI-positive). 2.6. Statistical analysis Results reported in figures were the mean and standard error (SEM) of four independent experiments, each performed in quadruplicate. Statistical analysis was performed by paired Student’s t-test. 3. Results 3.1. Cell count The Cd effects on cell growth varied with concentrations. No significant differences in cell count were observed in cells treated with 10 lM Cd for 48 h (Fig. 1). Count significantly decreased after 20 lM Cd treatment (by 55%). Exposure to 50 lM Cd, resulted in a strong drop in cell count and cultures showed floating cells were almost dead (data not shown).

Fig. 4. Quantitative analysis (mRNA levels) for MMP1 (A) and MMP13 (B) obtained from normal human bronchial epithelial cells, BEAS-2B. The cells were maintained in BEGM for 48 h with or without 10 lM or 20 lM cadmium (Cd). The mRNA levels were quantified by real-time quantitative PCR. Values were the mean ± SEM of three independent experiments each performed in triplicate. Data were analyzed by paired Student’s t-test. The results were expressed as fold change in b-actin normalized mRNA values. Differences vs. mRNA levels in control: ⁄P < 0.01; NS: not significant. Differences of 20 lM Cd vs. 10 lM Cd: §P < 0.01; ns: not significant.

T. Baroni et al. / Cytokine 72 (2015) 9–16

13

Fig. 5. Quantitative analysis (mRNA levels) for integrin a1 (A), integrin a2 (B), integrin b1 (C), integrin b3 (D) and integrin b5 (E) obtained from normal human bronchial epithelial cells, BEAS-2B. The cells were maintained in BEGM for 48 h with or without 10 lM or 20 lM cadmium (Cd). The mRNA levels were quantified by real-time quantitative PCR. Values were the mean ± SEM of three independent experiments each performed in triplicate. Data were analyzed by paired Student’s t-test. The results were expressed as fold change in b-actin normalized mRNA values. Differences vs. mRNA levels in control: ⁄P < 0.01; ⁄⁄P < 0.05; NS: not significant. Differences of 20 lM Cd vs. 10 lM Cd: §P < 0.01; §§P < 0.05; ns: not significant.

Fig. 5 shows expression of integrin a1, a2 and b3 signals were not significantly affected by 10 lM Cd. Signaling was decreased by 20 lM Cd (by 32%, by17%, and by 36%, respectively). Integrin b1 and b5 transcripts were significantly enhanced by 10 lM Cd (+38%) and unaffected by 20 lM Cd.

TGFbR1 and TGFbR2 expression. Compared with controls, 20 lM Cd decreased TGFbR3/betaglycan levels (by 26%) that were not affected by 10 lM Cd.

3.4. Effects of cadmium on TGFb and its receptor gene expression

Fig. 7 shows analysis of apoptosis determined by flowcytometry of cells labelled with annexin V and PI. Four different cell subpopulations were detected: (1) viable non-fluorescent cells, (2) early apoptotic cells labelled with annexin V-FITC but not with PI, (3) late apoptotic cells labelled with annexin and PI and (4) hypodiploid DNA nuclei. After 10 lM Cd treatment, all cell subpopulations did not show significant differences compared with controls. Twenty lM Cd

Ten lM Cd had no significant effect on TGFb1 and TGFb3 expression (Fig. 6). Twenty lM Cd reduced expression by 27% and 37%, respectively. Both Cd doses increased TGFb2 steady state mRNA levels by respectively 118% and 206%. Regarding Cd effects on TGFb receptors, 10 lM Cd enhanced TGFbR1 expression without affecting TGFbR2 m RNA level. Twenty lM Cd did not modulate

3.5. Annexin-V/PI-binding assay

14

T. Baroni et al. / Cytokine 72 (2015) 9–16

Fig. 6. Quantitative analysis (mRNA levels) for TGFb1 (A), TGFb2 (B), TGFb3 (C), TGFbR1 (D), TGFbR2 (E) and TGFbR3 (F) obtained from normal human bronchial epithelial cells, BEAS-2B. The cells were maintained in BEGM for 48 h with or without 10 lM or 20 lM cadmium (Cd). The mRNA levels were quantified by real-time quantitative PCR. Values were the mean ± SEM of three independent experiments each performed in triplicate. Data were analyzed by paired Student’s t-test. The results were expressed as fold change in b-actin normalized mRNA values. Differences vs. mRNA levels in control: ⁄P < 0.01; NS: not significant. Differences of 20 lM Cd vs. 10 lM Cd: §P < 0.01; §§P < 0.05; ns: not significant.

significantly decreased viable (by 33%) cells and increased the early (by 52%) and the late (by 300%) apoptotic as well as the necrotic (by 25%) cells.

4. Discussion Present data suggest even sub-toxic Cd induced changes in ECM components which were probably mediated by an imbalance in TGFb/TGFBRs signaling without involving apoptotic mechanisms. Integrins b1and b5 were up-regulated even at the sub-toxic Cd dose, while integrins a1, a2 and b3 were decreased by the toxic dose. Present results concur with other reports suggesting integrins are targets of Cd toxicity even though the effects may vary due to different experimental conditions. In fact, sub-toxic

Cd concentrations increased these adhesion proteins enhancing lung epithelial resistance by 20–60% more than controls [4] or decreased them inducing barrier function collapse and alteration in human bronchial epithelial cells [14]. Since integrins recognize and link vitronectin and tenascin [31,35], two ECM glycoproteins that bind several growth factors [1,19,24], and play major roles in maintaining basement membrane integrity [3,12,36] we investigated the effects of Cd on these two glycoproteins. As even a sub-toxic Cd dose significantly stimulated them, we hypothesize that the Cd-induced changes affect integrin-vitronectin/tenascin binding, and consequently cell–cell and cellular adhesion processes to ECM proteins. The enhanced tenascin and vitronectin expression we observed could partially account for the lack of alterations in apoptotic marker protein expression after exposure to the sub-toxic Cd dose. In fact, these

T. Baroni et al. / Cytokine 72 (2015) 9–16

15

expression. Indeed, prolonged alterations in TGFb/TGFbR signaling were reported to result in structural and functional lung changes [39,40]. In exposed subjects, these changes may modify lung repair processes, impacting critically upon maintenance of an intact respiratory epithelium and consequently on normal respiratory function. Acknowledgments The authors would like to thank Dr. Geraldine A. Boyd for editing this paper. The authors declare that there are no conflicts of interest, financial or otherwise, regarding this work. References Fig. 7. Analysis of apoptosis in normal human bronchial epithelial cells BEAS-2B exposed or not to cadmium (Cd). The cells were maintained in BEGM for 48 h with or without 10 lM Cd or 20 lM Cd and apoptosis was determined by flow cytometric analysis of annexin V/PI-stained cells. The results are presented as the percentage of viable (annexin V/PI), early apoptotic (annexin V+/PI), late apoptotic (annexin V+/PI+) and necrotic (annexin V/PI+) cells. The values were the mean ± SEM of four independent experiments each in triplicate. Data were analyzed by paired Student’s t-test. Differences vs. control: ⁄P < 0.01; ⁄⁄P < 0.05; NS: not significant. Differences of 20 lM Cd vs. 10 lM Cd: §P < 0.01; ns: not significant.

two glycoproteins were reported to provide a significant level of protection from apoptosis [2]. One might speculate that vitronectin was the more efficient controller of apoptosis as the toxic Cd dose did not affect vitronectin expression but significantly increased the apoptosis rate. Interestingly, Cd-related changes in integrin expression could alter the TGFb activation status because TGFb is related to integrin expression [23,37] and because TGFb binds integrins [6,34]. We observed sub-toxic and toxic Cd doses modulated members of the TGFb family differently and provoked diverse imbalances in their receptors. Of particular interest was finding the toxic Cd dose decreased TGFb3 and its receptor since a loss of TGFb3 expression was observed during cancer progression [17,20,26] and defective TGFbR3 expression was reported in non small cell lung cancer (NSCLC cell lines). Since TGFb1 stimulates collagen synthesis in particular and is involved in lung fibrosis [5], Cd-induced changes could modify collagen metabolism. In fact, when we analysed various collagen type transcripts, we found a significant decrease of type I (with both Cd doses) and of type IV and V (only with toxic Cd dose) collagen expressions. Our results are in agreement with previous findings which showed that Cd treatment reduce collagen content in other tissues such as bone [16], thus suggesting that this effect could be linked to the parallel decrease induced by toxic Cd dose on TGFb1 expression The overall pattern of lung ECM is an intricate balance between synthesis and degradation of its major structural components. For this reason we also evaluated the effects of Cd on metalloproteases which are implicated in collagen degradation [22,38], observing both Cd doses increased MMP1 and MMP13 expression. Consequently, the toxic Cd dose acts upon both collagen synthesis and degradation while the sub-toxic dose affects mainly degradation.

5. Conclusion The results of this study showed that even a sub-toxic Cd dose affected gene expression of several ECM components that are crucially implicated in the mechanical properties of lung parenchyma. Since the underlying mechanism did not involve apoptosis, we suggest that Cd-induced variations in TGFb signaling and ECM metabolism could be due to modulation of TGFbR1, R2 or R3

[1] Adair JE, Stober V, Sobhany M, Zhuo L, Roberts JD, Negishi M, et al. Inter-alphatrypsin inhibitor promotes bronchial epithelial repair after injury through vitronectin binding. J Biol Chem 2009;284:16922–30. [2] Aoshiba K, Rennard SI, Spurzem JR. Cell-matrix and cell-cell interactions modulate apoptosis of bronchial epithelial cells. Am J Physiol 1997;272(1 Pt 1):L28–37. [3] Bai J, Zhong X, Tang H, He Z, Zhang J, Deng J. Effect of integrin a5b1-mediated ERK signal pathway on proliferation and migration of A549 cells. Zhongguo Fei Ai Za Zhi 2011;14:568–74. [4] Balharry D, Sexton K, BéruBé KA. An in vitro approach to assess the toxicity of inhaled tobacco smoke components: nicotine, cadmium, formaldehyde and urethane. Toxicology 2008;244:66–76. [5] Baroni T, Bodo M, D’Alessandro A, Conte C, Calvitti M, Muzi G, et al. Silica and its antagonistic effects on transforming growth factor-beta in lung fibroblast extracellular matrix production. J Invest Med 2001;49:146–56. [6] Batmunkh R, Nishioka Y, Aono Y, Azuma M, Kinoshita K, Kishi J, et al. CCN6 as a profibrotic mediator that stimulates the proliferation of lung fibroblasts via the integrin b1/focal adhesion kinase pathway. J Med Invest 2011;58:188–96. [7] Bertin G, Averbeck D. Cadmium: cellular effects, modifications of biomolecules, modulation of DNA repair and genotoxic consequences (a review). Biochimie 2006;88:1549–59. [8] Bodo M, Baroni T, Bellocchio S, Calvitti M, Lilli C, D’Alessandro A, et al. Bronchial epithelial cell matrix production in response to silica and basic fibroblast growth factor. Mol Med 2001;7:83–92. [9] Bodo M, Bellocchio S, Bellucci C, Balloni S, Pietrella D, Sbaraglia G, et al. Silica, hyaluronate, and alveolar macrophage functional differentiation. J Investig Med 2003;51:95–103. [10] Bodo M, Muzi G, Bellucci C, Lilli C, Calvitti M, Lumare A, et al. Comparative in vitro studies on the fibrogenic effects of two samples of silica on epithelial bronchial cells. J Biol Regul Homeost Agents 2007;21:97–104. [11] Bodo M, Balloni S, Lumare E, Bacci M, Calvitti M, Dell’Omo M, et al. Effects of sub-toxic Cadmium concentrations on bone gene expression program: results of an in vitro study. Toxicol in Vitro 2010;24:1670–80. [12] Chang MH, Lee K, Lee KY, Kim YS, Kim YK, Kang JH. Prognostic role of integrin b1, E-cadherin, and rac1 expression in small cell lung cancer. APMIS 2012;120:28–38. [13] Cutroneo KR, White SL, Phan SH, Ehrlich HP. Therapies for bleomycin induced lung fibrosis through regulation of TGF-beta1 induced collagen gene expression. J Cell Physiol 2007;211:585–9. [14] Forti E, Bulgheroni A, Cetin Y, Hartung T, Jennings P, Pfaller W, et al. Characterisation of cadmium chloride induced molecular and functional alterations in airway epithelial cells. Cell Physiol Biochem 2010;25:159–68. [15] Franz E, Römkens P, Van Raamsdonk L, Van der Fels-Klerx I. A chain modeling approach to estimate the impact of soil cadmium pollution on human dietary exposure. J Food Prot 2008;71:2504–13. [16] Galicka A, Brzóska MM, Sredzin´ska K, Gindzienski A. Effect of cadmium on collagen content and solubility in rat bone. Acta Biochim 2004;51:825–9. [17] Gatza CE, Oh SY, Blobe GC. Roles for the type III TGF-beta receptor in human cancer. Cell Signal 2010;22:1163–74. [18] Hersh CP, Hansel NN, Barnes KC, Lomas DA, Pillai SG, Coxson HO, et al. Transforming growth factor-beta receptor-3 is associated with pulmonary emphysema. Am J Respir Cell Mol Biol 2009;41:324–31. [19] Hollier BG, Kricker JA, Van Lonkhuyzen DR, Leavesley DI, Upton Z. Substratebound insulin-like growth factor (IGF)-I-IGF binding protein-vitronectinstimulated breast cell migration is enhanced by coactivation of the phosphatidylinositide 3-Kinase/AKT pathway by alphav-integrins and the IGF-I receptor. Endocrinology 2008;149:1075–90. [20] Jiang X, Liu R, Lei Z, You J, Zhou Q, Zhang H. Defective expression of TGFBR3 gene and its molecular mechanisms in non-small cell lung cancer cell lines. Zhongguo Fei Ai Za Zhi 2010;13:451–7. [21] Jin T, Kong Q, Ye T, Wu X, Nordberg GF. Renal dysfunction of cadmiumexposed workers residing in a cadmium-polluted environment. Biometals 2004;17:513–8. [22] Löffek S, Schilling O, Franzke CW. Series matrix metalloproteinases in lung health and disease: biological role of matrix metalloproteinases: a critical balance. Eur Respir J 2011;38:191–208.

16

T. Baroni et al. / Cytokine 72 (2015) 9–16

[23] Markovics JA, Araya J, Cambier S, Somanath S, Gline S, Jablons D, et al. Interleukin-1beta induces increased transcriptional activation of the transforming growth factor-beta-activating integrin subunit beta8 through altering chromatin architecture. J Biol Chem 2011;286:36864–74. [24] McNally AK, Jones JA, Macewan SR, Colton E, Anderson JM. Vitronectin is a critical protein adhesion substrate for IL-4-induced foreign body giant cell formation. J Biomed Mater Res 2008;A86:535–43. [25] Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 1983;65:55–63. [26] Mythreye K, Blobe GC. The type III TGF-beta receptor regulates epithelial and cancer cell migration through beta-arrestin2-mediated activation of Cdc42. Proc Natl Acad Sci USA 2009;106:8221–822. [27] Nawrot T, Plusquinm M, Hogervorst J, Roels HA, Celis H, Thijs L, et al. Environmental exposure to cadmium and risk of cancer: a prospective population-based study. Lancet Oncol 2006;7:119–216. [28] Nawrot T, Geusens P, Nulens TS, Nemery B. Occupational cadmium exposure and calcium excretion, bone density, and osteoporosis in men. J Bone Miner Res 2010;25:1441–5. [29] Nicoletti I, Migliorati G, Pagliacci MC, Grignani F, Riccardi C. A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. J Immunol Methods 1991;139:271–9. [30] Pulichino AM, Wang IM, Caron A, Mortimer J, Auger A, Boie Y, et al. Identification of transforming growth factor beta1-driven genetic programs of acute lung fibrosis. Am J Respir Cell Mol Biol 2008;39:324–36. [31] Ratheesh A, Ingle A, Gude RP. Pentoxifylline modulates cell surface integrin expression and integrin mediated adhesion of B16F10 cells to extracellular matrix components. Cancer Biol Ther 2007;6:1743–52.

[32] Salazar LM, Herrera AM. Fibrotic response of tissue remodeling in COPD. Lung 2011;189:101–9. [33] Satarug S, Garrett SH, Sens MA, Sens DA. Cadmium, environmental exposure, and health outcomes. Cien Saude Colet 2010;16:2587–602. [34] Scaffidi AK, Petrovic N, Moodley YP, Fogel-Petrovic M, Kroeger KM, Seeber RM, et al. Alpha(v)beta(3) integrin interacts with the transforming growth factor beta (TGFbeta) type II receptor to potentiate the proliferative effects of TGFbeta1 in living human lung fibroblasts. J Biol Chem 2004;279:37726–33. [35] Stupack DG. The biology of integrins. Oncology (Williston Park) 2007;21:6–12. [36] Suki B, Bates JH. Extracellular matrix mechanics in lung parenchymal diseases. Respir Physiol Neurobiol 2008;163:33–43. [37] Tatler AL, John AE, Jolly L, Habgood A, Porte J, Brightling C, et al. Integrin avb5mediated TGF-b activation by airway smooth muscle cells in asthma. J Immunol 2011;187:6094–107. [38] Van den Brûle S, Misson P, Bühling F, Lison D, Huaux F. Overexpression of cathepsin K during silica-induced lung fibrosis and control by TGF-beta. Respir Res 2005;6:84. [39] Yue X, Li X, Nguyen HT, Chin DR, Sullivan DE, Lasky JA. Transforming growth factor-beta1 induces heparan sulfate 6-O-endosulfatase 1 expression in vitro and in vivo. J Biol Chem 2008;283:20397–407. [40] Zhou ZH, Lei YX, Wang CX. Analysis of aberrant methylation in DNA repair genes during malignant transformation of human bronchial epithelial cells induced by cadmium. Toxicol Sci 2012;125:412–7.